Running as unit: rb-build-amd64_4-38108.service ==================================================================================== Mon Nov 25 09:03:39 UTC 2024 - running /srv/jenkins/bin/reproducible_build.sh (for job reproducible_builder_amd64_4) on jenkins, called using "ionos15-amd64 ionos1-amd64" as arguments. Mon Nov 25 09:03:39 UTC 2024 - actually running "reproducible_build.sh" (md5sum 68e686e434c9ab7bc3ec047d8b309cbc) as "/tmp/jenkins-script-IwgIi7Lx" $ git clone https://salsa.debian.org/qa/jenkins.debian.net.git ; more CONTRIBUTING Mon Nov 25 09:03:39 UTC 2024 - checking /var/lib/jenkins/offline_nodes if ionos15-amd64.debian.net is marked as down. Mon Nov 25 09:03:39 UTC 2024 - checking via ssh if ionos15-amd64.debian.net is up. removed '/tmp/read-only-fs-test-DdIA1E' Mon Nov 25 09:03:40 UTC 2024 - checking /var/lib/jenkins/offline_nodes if ionos1-amd64.debian.net is marked as down. Mon Nov 25 09:03:40 UTC 2024 - checking via ssh if ionos1-amd64.debian.net is up. removed '/tmp/read-only-fs-test-juq4EO' ok, let's check if seqprep is building anywhere yet… ok, seqprep is not building anywhere… UPDATE 1 ============================================================================= Initialising reproducibly build of seqprep in trixie on amd64 on jenkins now. 1st build will be done on ionos15-amd64.debian.net. 2nd build will be done on ionos1-amd64.debian.net. ============================================================================= Mon Nov 25 09:04:02 UTC 2024 I: starting to build seqprep/trixie/amd64 on jenkins on '2024-11-25 09:03' Mon Nov 25 09:04:02 UTC 2024 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/amd64_4/38108/console.log 1732525442 amd64 trixie seqprep Mon Nov 25 09:04:02 UTC 2024 I: Downloading source for trixie/seqprep=1.3.2-9 --2024-11-25 09:04:03-- http://deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-9.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2260 (2.2K) [text/prs.lines.tag] Saving to: ‘seqprep_1.3.2-9.dsc’ 0K .. 100% 256M=0s 2024-11-25 09:04:03 (256 MB/s) - ‘seqprep_1.3.2-9.dsc’ saved [2260/2260] --2024-11-25 09:04:03-- http://deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-9.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2260 (2.2K) [text/prs.lines.tag] Saving to: ‘seqprep_1.3.2-9.dsc’ 0K .. 100% 256M=0s 2024-11-25 09:04:03 (256 MB/s) - ‘seqprep_1.3.2-9.dsc’ saved [2260/2260] Mon Nov 25 09:04:03 UTC 2024 I: seqprep_1.3.2-9.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-9 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille , Nilesh Patra Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 13), python3 , zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 11f37baa93c01a1a0d426c8be5962c16456a0179 12468 seqprep_1.3.2-9.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 53981b79fe38cce3023ba0ab9886195dcd2fd393c0057cd8ef43ffe06bbe32db 12468 seqprep_1.3.2-9.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz 597564b70492bef8006e45a6892f3b76 12468 seqprep_1.3.2-9.debian.tar.xz Dgit: 54dee1026394119b68bdc391655ecce7ce762485 debian archive/debian/1.3.2-9 https://git.dgit.debian.org/seqprep -----BEGIN PGP SIGNATURE----- iQJIBAEBCgAyFiEEj5GyJ8fW8rGUjII2eTz2fo8NEdoFAmXzUowUHGVtb2xsaWVy QGRlYmlhbi5vcmcACgkQeTz2fo8NEdrxww/8DPKZiUgRjm/L916gf0wJtQaqriYT DBNLVB4cW4VrgP2Bhe+wcINTTrnLH8zij6rbB59+AN/8JSf8JOQ6vaCaNnAdu5CQ FQriCWoDH33YcMkul2N5ygAx6idQIf0YH1ILpo9koiKsgjB+M7SN/eGw2pc2g0DS u2GEWe0jYlFN4CWdpn2Fy0ccBwbCj90hlAdAADqVRU0uBATRLP075qeWH4PaTS/Y pWGDwK5Z7Kpx8AGNpb1IvqXuZ6ngjU71blKFtu0oOTJSTqu6eTUy2OOGLlktyF2H 1TOnRp3+PVzJZHEgv2snySkdHILURfa6owQU9R+wPisotosbBcSy3lDjS0gXtRoP 00FiCu42xaLy0LC+jiSWMLZE5GUNfKjTdQgscQfke2r6c1FsQfiLagqde++QReh6 SCx9kHyUhswU0o0qdrbpZl6erAZ2yHIiiWkiNglhOJbjRqcyvlTS6+BSXsY8gdlJ 7r8ll/5717FPGiU2/syzXw8xpPmut6KneYecSxrB82/vDqRnzZif9X+0FFCicL7t 7VOnaXdVysscPBu2qEk1AHv9HM+E83B91kqPr+EaES4CBEZDl9TD+EeWOcnsJJJB 2EQR8Df8M1S1BYB9NzRb9+a2Ix/3Y+rRb5w9005O1MQ0/jU+9iGsBg7kfBVrzAJR /HQ7Z4cUVwbWMZM= =6Mqd -----END PGP SIGNATURE----- Mon Nov 25 09:04:03 UTC 2024 I: Checking whether the package is not for us Mon Nov 25 09:04:03 UTC 2024 I: Starting 1st build on remote node ionos15-amd64.debian.net. Mon Nov 25 09:04:03 UTC 2024 I: Preparing to do remote build '1' on ionos15-amd64.debian.net. Mon Nov 25 09:04:03 UTC 2024 - checking /var/lib/jenkins/offline_nodes if ionos15-amd64.debian.net is marked as down. Mon Nov 25 09:04:03 UTC 2024 - checking via ssh if ionos15-amd64.debian.net is up. removed '/tmp/read-only-fs-test-M2L1pE' ==================================================================================== Sun Dec 28 15:27:03 UTC 2025 - running /srv/jenkins/bin/reproducible_build.sh (for job /srv/jenkins/bin/reproducible_build.sh) on ionos15-amd64, called using "1 seqprep trixie /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke 1.3.2-9" as arguments. Sun Dec 28 15:27:03 UTC 2025 - actually running "reproducible_build.sh" (md5sum 68e686e434c9ab7bc3ec047d8b309cbc) as "/tmp/jenkins-script-06nztD1o" $ git clone https://salsa.debian.org/qa/jenkins.debian.net.git ; more CONTRIBUTING Sun Dec 28 15:27:03 UTC 2025 I: Downloading source for trixie/seqprep=1.3.2-9 Reading package lists... NOTICE: 'seqprep' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/seqprep.git Please use: git clone https://salsa.debian.org/med-team/seqprep.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 37.2 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (dsc) [2260 B] Get:2 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (tar) [37.2 MB] Get:3 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (diff) [12.5 kB] Fetched 37.2 MB in 1s (55.3 MB/s) Download complete and in download only mode Reading package lists... NOTICE: 'seqprep' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/seqprep.git Please use: git clone https://salsa.debian.org/med-team/seqprep.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 37.2 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (dsc) [2260 B] Get:2 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (tar) [37.2 MB] Get:3 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (diff) [12.5 kB] Fetched 37.2 MB in 1s (55.3 MB/s) Download complete and in download only mode ============================================================================= Building seqprep in trixie on amd64 on ionos15-amd64 now. Date: Sun Dec 28 15:27:05 UTC 2025 Date UTC: Sun Dec 28 15:27:05 UTC 2025 ============================================================================= W: /root/.pbuilderrc does not exist I: Logging to b1/build.log I: pbuilder: network access will be disabled during build I: Current time: Sun Dec 28 03:27:05 -12 2025 I: pbuilder-time-stamp: 1766935625 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-9.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-9.debian.tar.xz] I: Extracting source gpgv: Signature made Thu Mar 14 19:39:56 2024 gpgv: using RSA key 8F91B227C7D6F2B1948C8236793CF67E8F0D11DA gpgv: issuer "emollier@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./seqprep_1.3.2-9.dsc: no acceptable signature found dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-9.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch dpkg-source: info: applying fix-declarations.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/1442780/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' DISTRIBUTION='trixie' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='64162369d4f14936931f30fc3c98136b' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='1442780' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/pbuilderrc_TCte --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b1 --logfile b1/build.log seqprep_1.3.2-9.dsc' SUDO_GID='111' SUDO_UID='106' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://213.165.73.152:3128' I: uname -a Linux ionos15-amd64 6.11.5+bpo-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.11.5-1~bpo12+1 (2024-11-11) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Aug 4 2024 /bin -> usr/bin I: user script /srv/workspace/pbuilder/1442780/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), python3, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19969 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libcom-err2{a} libdebhelper-perl{a} libelf1t64{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libgssapi-krb5-2{a} libicu72{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libmagic-mgc{a} libmagic1t64{a} libnsl2{a} libpipeline1{a} libpython3-stdlib{a} libpython3.12-minimal{a} libpython3.12-stdlib{a} libreadline8t64{a} libtirpc-common{a} libtirpc3t64{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} media-types{a} netbase{a} po-debconf{a} python3{a} python3-minimal{a} python3.12{a} python3.12-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl krb5-locales libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 52 newly installed, 0 to remove and 0 not upgraded. Need to get 27.8 MB of archives. After unpacking 106 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main amd64 libpython3.12-minimal amd64 3.12.7-3 [815 kB] Get: 2 http://deb.debian.org/debian trixie/main amd64 libexpat1 amd64 2.6.4-1 [106 kB] Get: 3 http://deb.debian.org/debian trixie/main amd64 python3.12-minimal amd64 3.12.7-3 [2162 kB] Get: 4 http://deb.debian.org/debian trixie/main amd64 python3-minimal amd64 3.12.6-1 [26.7 kB] Get: 5 http://deb.debian.org/debian trixie/main amd64 media-types all 10.1.0 [26.9 kB] Get: 6 http://deb.debian.org/debian trixie/main amd64 netbase all 6.4 [12.8 kB] Get: 7 http://deb.debian.org/debian trixie/main amd64 tzdata all 2024b-3 [255 kB] Get: 8 http://deb.debian.org/debian trixie/main amd64 libkrb5support0 amd64 1.21.3-3 [32.5 kB] Get: 9 http://deb.debian.org/debian trixie/main amd64 libcom-err2 amd64 1.47.1-1+b1 [23.2 kB] Get: 10 http://deb.debian.org/debian trixie/main amd64 libk5crypto3 amd64 1.21.3-3 [79.9 kB] Get: 11 http://deb.debian.org/debian trixie/main amd64 libkeyutils1 amd64 1.6.3-4 [9092 B] Get: 12 http://deb.debian.org/debian trixie/main amd64 libkrb5-3 amd64 1.21.3-3 [324 kB] Get: 13 http://deb.debian.org/debian trixie/main amd64 libgssapi-krb5-2 amd64 1.21.3-3 [136 kB] Get: 14 http://deb.debian.org/debian trixie/main amd64 libtirpc-common all 1.3.4+ds-1.3 [10.9 kB] Get: 15 http://deb.debian.org/debian trixie/main amd64 libtirpc3t64 amd64 1.3.4+ds-1.3+b1 [83.1 kB] Get: 16 http://deb.debian.org/debian trixie/main amd64 libnsl2 amd64 1.3.0-3+b3 [40.6 kB] Get: 17 http://deb.debian.org/debian trixie/main amd64 readline-common all 8.2-5 [69.3 kB] Get: 18 http://deb.debian.org/debian trixie/main amd64 libreadline8t64 amd64 8.2-5 [169 kB] Get: 19 http://deb.debian.org/debian trixie/main amd64 libpython3.12-stdlib amd64 3.12.7-3 [1966 kB] Get: 20 http://deb.debian.org/debian trixie/main amd64 python3.12 amd64 3.12.7-3 [671 kB] Get: 21 http://deb.debian.org/debian trixie/main amd64 libpython3-stdlib amd64 3.12.6-1 [9692 B] Get: 22 http://deb.debian.org/debian trixie/main amd64 python3 amd64 3.12.6-1 [27.8 kB] Get: 23 http://deb.debian.org/debian trixie/main amd64 sensible-utils all 0.0.24 [24.8 kB] Get: 24 http://deb.debian.org/debian trixie/main amd64 libmagic-mgc amd64 1:5.45-3+b1 [314 kB] Get: 25 http://deb.debian.org/debian trixie/main amd64 libmagic1t64 amd64 1:5.45-3+b1 [108 kB] Get: 26 http://deb.debian.org/debian trixie/main amd64 file amd64 1:5.45-3+b1 [43.3 kB] Get: 27 http://deb.debian.org/debian trixie/main amd64 gettext-base amd64 0.22.5-2 [200 kB] Get: 28 http://deb.debian.org/debian trixie/main amd64 libuchardet0 amd64 0.0.8-1+b2 [68.9 kB] Get: 29 http://deb.debian.org/debian trixie/main amd64 groff-base amd64 1.23.0-5 [1181 kB] Get: 30 http://deb.debian.org/debian trixie/main amd64 bsdextrautils amd64 2.40.2-11 [91.5 kB] Get: 31 http://deb.debian.org/debian trixie/main amd64 libpipeline1 amd64 1.5.8-1 [42.0 kB] Get: 32 http://deb.debian.org/debian trixie/main amd64 man-db amd64 2.13.0-1 [1420 kB] Get: 33 http://deb.debian.org/debian trixie/main amd64 m4 amd64 1.4.19-4 [287 kB] Get: 34 http://deb.debian.org/debian trixie/main amd64 autoconf all 2.72-3 [493 kB] Get: 35 http://deb.debian.org/debian trixie/main amd64 autotools-dev all 20220109.1 [51.6 kB] Get: 36 http://deb.debian.org/debian trixie/main amd64 automake all 1:1.16.5-1.3 [823 kB] Get: 37 http://deb.debian.org/debian trixie/main amd64 autopoint all 0.22.5-2 [723 kB] Get: 38 http://deb.debian.org/debian trixie/main amd64 libdebhelper-perl all 13.20 [89.7 kB] Get: 39 http://deb.debian.org/debian trixie/main amd64 libtool all 2.4.7-8 [517 kB] Get: 40 http://deb.debian.org/debian trixie/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 41 http://deb.debian.org/debian trixie/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 42 http://deb.debian.org/debian trixie/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get: 43 http://deb.debian.org/debian trixie/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get: 44 http://deb.debian.org/debian trixie/main amd64 libelf1t64 amd64 0.192-4 [189 kB] Get: 45 http://deb.debian.org/debian trixie/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 46 http://deb.debian.org/debian trixie/main amd64 libicu72 amd64 72.1-5+b1 [9423 kB] Get: 47 http://deb.debian.org/debian trixie/main amd64 libxml2 amd64 2.12.7+dfsg+really2.9.14-0.2+b1 [699 kB] Get: 48 http://deb.debian.org/debian trixie/main amd64 gettext amd64 0.22.5-2 [1601 kB] Get: 49 http://deb.debian.org/debian trixie/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 50 http://deb.debian.org/debian trixie/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 51 http://deb.debian.org/debian trixie/main amd64 debhelper all 13.20 [915 kB] Get: 52 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] Fetched 27.8 MB in 7s (4215 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.12-minimal:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19969 files and directories currently installed.) Preparing to unpack .../libpython3.12-minimal_3.12.7-3_amd64.deb ... Unpacking libpython3.12-minimal:amd64 (3.12.7-3) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.6.4-1_amd64.deb ... Unpacking libexpat1:amd64 (2.6.4-1) ... Selecting previously unselected package python3.12-minimal. Preparing to unpack .../python3.12-minimal_3.12.7-3_amd64.deb ... Unpacking python3.12-minimal (3.12.7-3) ... Setting up libpython3.12-minimal:amd64 (3.12.7-3) ... Setting up libexpat1:amd64 (2.6.4-1) ... Setting up python3.12-minimal (3.12.7-3) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20289 files and directories currently installed.) Preparing to unpack .../00-python3-minimal_3.12.6-1_amd64.deb ... Unpacking python3-minimal (3.12.6-1) ... Selecting previously unselected package media-types. Preparing to unpack .../01-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../02-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../03-tzdata_2024b-3_all.deb ... Unpacking tzdata (2024b-3) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../04-libkrb5support0_1.21.3-3_amd64.deb ... Unpacking libkrb5support0:amd64 (1.21.3-3) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../05-libcom-err2_1.47.1-1+b1_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.1-1+b1) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../06-libk5crypto3_1.21.3-3_amd64.deb ... Unpacking libk5crypto3:amd64 (1.21.3-3) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../07-libkeyutils1_1.6.3-4_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-4) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../08-libkrb5-3_1.21.3-3_amd64.deb ... Unpacking libkrb5-3:amd64 (1.21.3-3) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../09-libgssapi-krb5-2_1.21.3-3_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.21.3-3) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../10-libtirpc-common_1.3.4+ds-1.3_all.deb ... Unpacking libtirpc-common (1.3.4+ds-1.3) ... Selecting previously unselected package libtirpc3t64:amd64. Preparing to unpack .../11-libtirpc3t64_1.3.4+ds-1.3+b1_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3 to /lib/x86_64-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3.0.0 to /lib/x86_64-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:amd64 (1.3.4+ds-1.3+b1) ... Selecting previously unselected package libnsl2:amd64. Preparing to unpack .../12-libnsl2_1.3.0-3+b3_amd64.deb ... Unpacking libnsl2:amd64 (1.3.0-3+b3) ... Selecting previously unselected package readline-common. Preparing to unpack .../13-readline-common_8.2-5_all.deb ... Unpacking readline-common (8.2-5) ... Selecting previously unselected package libreadline8t64:amd64. Preparing to unpack .../14-libreadline8t64_8.2-5_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8 to /lib/x86_64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8.2 to /lib/x86_64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8 to /lib/x86_64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8.2 to /lib/x86_64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:amd64 (8.2-5) ... Selecting previously unselected package libpython3.12-stdlib:amd64. Preparing to unpack .../15-libpython3.12-stdlib_3.12.7-3_amd64.deb ... Unpacking libpython3.12-stdlib:amd64 (3.12.7-3) ... Selecting previously unselected package python3.12. Preparing to unpack .../16-python3.12_3.12.7-3_amd64.deb ... Unpacking python3.12 (3.12.7-3) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../17-libpython3-stdlib_3.12.6-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.12.6-1) ... Setting up python3-minimal (3.12.6-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21351 files and directories currently installed.) Preparing to unpack .../00-python3_3.12.6-1_amd64.deb ... Unpacking python3 (3.12.6-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.24_all.deb ... Unpacking sensible-utils (0.0.24) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.45-3+b1_amd64.deb ... Unpacking libmagic-mgc (1:5.45-3+b1) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../03-libmagic1t64_1%3a5.45-3+b1_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.45-3+b1) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.45-3+b1_amd64.deb ... Unpacking file (1:5.45-3+b1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.22.5-2_amd64.deb ... Unpacking gettext-base (0.22.5-2) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../06-libuchardet0_0.0.8-1+b2_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.23.0-5_amd64.deb ... Unpacking groff-base (1.23.0-5) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.40.2-11_amd64.deb ... Unpacking bsdextrautils (2.40.2-11) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../09-libpipeline1_1.5.8-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.13.0-1_amd64.deb ... Unpacking man-db (2.13.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.72-3_all.deb ... Unpacking autoconf (2.72-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.22.5-2_all.deb ... Unpacking autopoint (0.22.5-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.20_all.deb ... Unpacking libdebhelper-perl (13.20) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.4.7-8_all.deb ... Unpacking libtool (2.4.7-8) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../22-libelf1t64_0.192-4_amd64.deb ... Unpacking libelf1t64:amd64 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../23-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libicu72:amd64. Preparing to unpack .../24-libicu72_72.1-5+b1_amd64.deb ... Unpacking libicu72:amd64 (72.1-5+b1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../25-libxml2_2.12.7+dfsg+really2.9.14-0.2+b1_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.22.5-2_amd64.deb ... Unpacking gettext (0.22.5-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_13.20_all.deb ... Unpacking debhelper (13.20) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../30-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:amd64 (1.5.8-1) ... Setting up libkeyutils1:amd64 (1.6.3-4) ... Setting up libicu72:amd64 (72.1-5+b1) ... Setting up bsdextrautils (2.40.2-11) ... Setting up libmagic-mgc (1:5.45-3+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libtirpc-common (1.3.4+ds-1.3) ... Setting up libdebhelper-perl (13.20) ... Setting up libmagic1t64:amd64 (1:5.45-3+b1) ... Setting up gettext-base (0.22.5-2) ... Setting up m4 (1.4.19-4) ... Setting up libcom-err2:amd64 (1.47.1-1+b1) ... Setting up file (1:5.45-3+b1) ... Setting up libelf1t64:amd64 (0.192-4) ... Setting up libkrb5support0:amd64 (1.21.3-3) ... Setting up tzdata (2024b-3) ... Current default time zone: 'Etc/UTC' Local time is now: Sun Dec 28 15:30:43 UTC 2025. Universal Time is now: Sun Dec 28 15:30:43 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20220109.1) ... Setting up autopoint (0.22.5-2) ... Setting up libk5crypto3:amd64 (1.21.3-3) ... Setting up autoconf (2.72-3) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up dwz (0.15-1+b1) ... Setting up sensible-utils (0.0.24) ... Setting up libuchardet0:amd64 (0.0.8-1+b2) ... Setting up netbase (6.4) ... Setting up libkrb5-3:amd64 (1.21.3-3) ... Setting up readline-common (8.2-5) ... Setting up libxml2:amd64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up gettext (0.22.5-2) ... Setting up libtool (2.4.7-8) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libgssapi-krb5-2:amd64 (1.21.3-3) ... Setting up libreadline8t64:amd64 (8.2-5) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up groff-base (1.23.0-5) ... Setting up libtirpc3t64:amd64 (1.3.4+ds-1.3+b1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.13.0-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libnsl2:amd64 (1.3.0-3+b3) ... Setting up libpython3.12-stdlib:amd64 (3.12.7-3) ... Setting up python3.12 (3.12.7-3) ... Setting up debhelper (13.20) ... Setting up libpython3-stdlib:amd64 (3.12.6-1) ... Setting up python3 (3.12.6-1) ... Processing triggers for libc-bin (2.40-3) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-9_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-9 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Étienne Mollier dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_auto_clean make -j42 clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_auto_build make -j42 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep seqprep mv /build/reproducible-path/seqprep-1.3.2/debian/README.html /build/reproducible-path/seqprep-1.3.2 make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.216741 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.199704 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j42 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep /build/reproducible-path/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/reproducible-path/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-9_all.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-9_amd64.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-9_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/1442780 and its subdirectories I: Current time: Sun Dec 28 03:32:04 -12 2025 I: pbuilder-time-stamp: 1766935924 Sun Dec 28 15:32:04 UTC 2025 I: Signing ./b1/seqprep_1.3.2-9_amd64.buildinfo as seqprep_1.3.2-9_amd64.buildinfo.asc Sun Dec 28 15:32:04 UTC 2025 I: Signed ./b1/seqprep_1.3.2-9_amd64.buildinfo as ./b1/seqprep_1.3.2-9_amd64.buildinfo.asc Sun Dec 28 15:32:04 UTC 2025 - build #1 for seqprep/trixie/amd64 on ionos15-amd64 done. Starting cleanup. All cleanup done. Sun Dec 28 15:32:04 UTC 2025 - reproducible_build.sh stopped running as /tmp/jenkins-script-06nztD1o, removing. /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke: total 16 drwxr-xr-x 2 jenkins jenkins 4096 Nov 25 09:09 b1 drwxr-xr-x 2 jenkins jenkins 4096 Nov 25 09:04 b2 -rw------- 1 jenkins jenkins 3357 Nov 25 09:04 rbuildlog.CtoL8k8 -rw-r--r-- 1 jenkins jenkins 2260 Mar 14 2024 seqprep_1.3.2-9.dsc /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b1: total 35144 -rw-r--r-- 1 jenkins jenkins 31967 Nov 25 09:09 build.log -rw-r--r-- 1 jenkins jenkins 35859764 Nov 25 09:09 seqprep-data_1.3.2-9_all.deb -rw-r--r-- 1 jenkins jenkins 18848 Nov 25 09:09 seqprep-dbgsym_1.3.2-9_amd64.deb -rw-r--r-- 1 jenkins jenkins 12468 Nov 25 09:09 seqprep_1.3.2-9.debian.tar.xz -rw-r--r-- 1 jenkins jenkins 2260 Nov 25 09:09 seqprep_1.3.2-9.dsc -rw-r--r-- 1 jenkins jenkins 5976 Nov 25 09:09 seqprep_1.3.2-9_amd64.buildinfo -rw-r--r-- 1 jenkins jenkins 6858 Nov 25 09:09 seqprep_1.3.2-9_amd64.buildinfo.asc -rw-r--r-- 1 jenkins jenkins 1866 Nov 25 09:09 seqprep_1.3.2-9_amd64.changes -rw-r--r-- 1 jenkins jenkins 28192 Nov 25 09:09 seqprep_1.3.2-9_amd64.deb -rw-r--r-- 1 jenkins jenkins 1356 Nov 25 09:09 seqprep_1.3.2-9_source.changes /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b2: total 0 Mon Nov 25 09:09:05 UTC 2024 I: Deleting $TMPDIR on ionos15-amd64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Sun Dec 28 03:27:05 -12 2025 I: pbuilder-time-stamp: 1766935625 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-9.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-9.debian.tar.xz] I: Extracting source gpgv: Signature made Thu Mar 14 19:39:56 2024 gpgv: using RSA key 8F91B227C7D6F2B1948C8236793CF67E8F0D11DA gpgv: issuer "emollier@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./seqprep_1.3.2-9.dsc: no acceptable signature found dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-9.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch dpkg-source: info: applying fix-declarations.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/1442780/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' DISTRIBUTION='trixie' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='64162369d4f14936931f30fc3c98136b' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='1442780' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/pbuilderrc_TCte --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b1 --logfile b1/build.log seqprep_1.3.2-9.dsc' SUDO_GID='111' SUDO_UID='106' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://213.165.73.152:3128' I: uname -a Linux ionos15-amd64 6.11.5+bpo-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.11.5-1~bpo12+1 (2024-11-11) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Aug 4 2024 /bin -> usr/bin I: user script /srv/workspace/pbuilder/1442780/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), python3, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19969 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libcom-err2{a} libdebhelper-perl{a} libelf1t64{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libgssapi-krb5-2{a} libicu72{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libmagic-mgc{a} libmagic1t64{a} libnsl2{a} libpipeline1{a} libpython3-stdlib{a} libpython3.12-minimal{a} libpython3.12-stdlib{a} libreadline8t64{a} libtirpc-common{a} libtirpc3t64{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} media-types{a} netbase{a} po-debconf{a} python3{a} python3-minimal{a} python3.12{a} python3.12-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl krb5-locales libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 52 newly installed, 0 to remove and 0 not upgraded. Need to get 27.8 MB of archives. After unpacking 106 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main amd64 libpython3.12-minimal amd64 3.12.7-3 [815 kB] Get: 2 http://deb.debian.org/debian trixie/main amd64 libexpat1 amd64 2.6.4-1 [106 kB] Get: 3 http://deb.debian.org/debian trixie/main amd64 python3.12-minimal amd64 3.12.7-3 [2162 kB] Get: 4 http://deb.debian.org/debian trixie/main amd64 python3-minimal amd64 3.12.6-1 [26.7 kB] Get: 5 http://deb.debian.org/debian trixie/main amd64 media-types all 10.1.0 [26.9 kB] Get: 6 http://deb.debian.org/debian trixie/main amd64 netbase all 6.4 [12.8 kB] Get: 7 http://deb.debian.org/debian trixie/main amd64 tzdata all 2024b-3 [255 kB] Get: 8 http://deb.debian.org/debian trixie/main amd64 libkrb5support0 amd64 1.21.3-3 [32.5 kB] Get: 9 http://deb.debian.org/debian trixie/main amd64 libcom-err2 amd64 1.47.1-1+b1 [23.2 kB] Get: 10 http://deb.debian.org/debian trixie/main amd64 libk5crypto3 amd64 1.21.3-3 [79.9 kB] Get: 11 http://deb.debian.org/debian trixie/main amd64 libkeyutils1 amd64 1.6.3-4 [9092 B] Get: 12 http://deb.debian.org/debian trixie/main amd64 libkrb5-3 amd64 1.21.3-3 [324 kB] Get: 13 http://deb.debian.org/debian trixie/main amd64 libgssapi-krb5-2 amd64 1.21.3-3 [136 kB] Get: 14 http://deb.debian.org/debian trixie/main amd64 libtirpc-common all 1.3.4+ds-1.3 [10.9 kB] Get: 15 http://deb.debian.org/debian trixie/main amd64 libtirpc3t64 amd64 1.3.4+ds-1.3+b1 [83.1 kB] Get: 16 http://deb.debian.org/debian trixie/main amd64 libnsl2 amd64 1.3.0-3+b3 [40.6 kB] Get: 17 http://deb.debian.org/debian trixie/main amd64 readline-common all 8.2-5 [69.3 kB] Get: 18 http://deb.debian.org/debian trixie/main amd64 libreadline8t64 amd64 8.2-5 [169 kB] Get: 19 http://deb.debian.org/debian trixie/main amd64 libpython3.12-stdlib amd64 3.12.7-3 [1966 kB] Get: 20 http://deb.debian.org/debian trixie/main amd64 python3.12 amd64 3.12.7-3 [671 kB] Get: 21 http://deb.debian.org/debian trixie/main amd64 libpython3-stdlib amd64 3.12.6-1 [9692 B] Get: 22 http://deb.debian.org/debian trixie/main amd64 python3 amd64 3.12.6-1 [27.8 kB] Get: 23 http://deb.debian.org/debian trixie/main amd64 sensible-utils all 0.0.24 [24.8 kB] Get: 24 http://deb.debian.org/debian trixie/main amd64 libmagic-mgc amd64 1:5.45-3+b1 [314 kB] Get: 25 http://deb.debian.org/debian trixie/main amd64 libmagic1t64 amd64 1:5.45-3+b1 [108 kB] Get: 26 http://deb.debian.org/debian trixie/main amd64 file amd64 1:5.45-3+b1 [43.3 kB] Get: 27 http://deb.debian.org/debian trixie/main amd64 gettext-base amd64 0.22.5-2 [200 kB] Get: 28 http://deb.debian.org/debian trixie/main amd64 libuchardet0 amd64 0.0.8-1+b2 [68.9 kB] Get: 29 http://deb.debian.org/debian trixie/main amd64 groff-base amd64 1.23.0-5 [1181 kB] Get: 30 http://deb.debian.org/debian trixie/main amd64 bsdextrautils amd64 2.40.2-11 [91.5 kB] Get: 31 http://deb.debian.org/debian trixie/main amd64 libpipeline1 amd64 1.5.8-1 [42.0 kB] Get: 32 http://deb.debian.org/debian trixie/main amd64 man-db amd64 2.13.0-1 [1420 kB] Get: 33 http://deb.debian.org/debian trixie/main amd64 m4 amd64 1.4.19-4 [287 kB] Get: 34 http://deb.debian.org/debian trixie/main amd64 autoconf all 2.72-3 [493 kB] Get: 35 http://deb.debian.org/debian trixie/main amd64 autotools-dev all 20220109.1 [51.6 kB] Get: 36 http://deb.debian.org/debian trixie/main amd64 automake all 1:1.16.5-1.3 [823 kB] Get: 37 http://deb.debian.org/debian trixie/main amd64 autopoint all 0.22.5-2 [723 kB] Get: 38 http://deb.debian.org/debian trixie/main amd64 libdebhelper-perl all 13.20 [89.7 kB] Get: 39 http://deb.debian.org/debian trixie/main amd64 libtool all 2.4.7-8 [517 kB] Get: 40 http://deb.debian.org/debian trixie/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 41 http://deb.debian.org/debian trixie/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 42 http://deb.debian.org/debian trixie/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get: 43 http://deb.debian.org/debian trixie/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get: 44 http://deb.debian.org/debian trixie/main amd64 libelf1t64 amd64 0.192-4 [189 kB] Get: 45 http://deb.debian.org/debian trixie/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 46 http://deb.debian.org/debian trixie/main amd64 libicu72 amd64 72.1-5+b1 [9423 kB] Get: 47 http://deb.debian.org/debian trixie/main amd64 libxml2 amd64 2.12.7+dfsg+really2.9.14-0.2+b1 [699 kB] Get: 48 http://deb.debian.org/debian trixie/main amd64 gettext amd64 0.22.5-2 [1601 kB] Get: 49 http://deb.debian.org/debian trixie/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 50 http://deb.debian.org/debian trixie/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 51 http://deb.debian.org/debian trixie/main amd64 debhelper all 13.20 [915 kB] Get: 52 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] Fetched 27.8 MB in 7s (4215 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.12-minimal:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19969 files and directories currently installed.) Preparing to unpack .../libpython3.12-minimal_3.12.7-3_amd64.deb ... Unpacking libpython3.12-minimal:amd64 (3.12.7-3) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.6.4-1_amd64.deb ... Unpacking libexpat1:amd64 (2.6.4-1) ... Selecting previously unselected package python3.12-minimal. Preparing to unpack .../python3.12-minimal_3.12.7-3_amd64.deb ... Unpacking python3.12-minimal (3.12.7-3) ... Setting up libpython3.12-minimal:amd64 (3.12.7-3) ... Setting up libexpat1:amd64 (2.6.4-1) ... Setting up python3.12-minimal (3.12.7-3) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20289 files and directories currently installed.) Preparing to unpack .../00-python3-minimal_3.12.6-1_amd64.deb ... Unpacking python3-minimal (3.12.6-1) ... Selecting previously unselected package media-types. Preparing to unpack .../01-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../02-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../03-tzdata_2024b-3_all.deb ... Unpacking tzdata (2024b-3) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../04-libkrb5support0_1.21.3-3_amd64.deb ... Unpacking libkrb5support0:amd64 (1.21.3-3) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../05-libcom-err2_1.47.1-1+b1_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.1-1+b1) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../06-libk5crypto3_1.21.3-3_amd64.deb ... Unpacking libk5crypto3:amd64 (1.21.3-3) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../07-libkeyutils1_1.6.3-4_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-4) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../08-libkrb5-3_1.21.3-3_amd64.deb ... Unpacking libkrb5-3:amd64 (1.21.3-3) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../09-libgssapi-krb5-2_1.21.3-3_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.21.3-3) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../10-libtirpc-common_1.3.4+ds-1.3_all.deb ... Unpacking libtirpc-common (1.3.4+ds-1.3) ... Selecting previously unselected package libtirpc3t64:amd64. Preparing to unpack .../11-libtirpc3t64_1.3.4+ds-1.3+b1_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3 to /lib/x86_64-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3.0.0 to /lib/x86_64-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:amd64 (1.3.4+ds-1.3+b1) ... Selecting previously unselected package libnsl2:amd64. Preparing to unpack .../12-libnsl2_1.3.0-3+b3_amd64.deb ... Unpacking libnsl2:amd64 (1.3.0-3+b3) ... Selecting previously unselected package readline-common. Preparing to unpack .../13-readline-common_8.2-5_all.deb ... Unpacking readline-common (8.2-5) ... Selecting previously unselected package libreadline8t64:amd64. Preparing to unpack .../14-libreadline8t64_8.2-5_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8 to /lib/x86_64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8.2 to /lib/x86_64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8 to /lib/x86_64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8.2 to /lib/x86_64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:amd64 (8.2-5) ... Selecting previously unselected package libpython3.12-stdlib:amd64. Preparing to unpack .../15-libpython3.12-stdlib_3.12.7-3_amd64.deb ... Unpacking libpython3.12-stdlib:amd64 (3.12.7-3) ... Selecting previously unselected package python3.12. Preparing to unpack .../16-python3.12_3.12.7-3_amd64.deb ... Unpacking python3.12 (3.12.7-3) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../17-libpython3-stdlib_3.12.6-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.12.6-1) ... Setting up python3-minimal (3.12.6-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21351 files and directories currently installed.) Preparing to unpack .../00-python3_3.12.6-1_amd64.deb ... Unpacking python3 (3.12.6-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.24_all.deb ... Unpacking sensible-utils (0.0.24) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.45-3+b1_amd64.deb ... Unpacking libmagic-mgc (1:5.45-3+b1) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../03-libmagic1t64_1%3a5.45-3+b1_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.45-3+b1) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.45-3+b1_amd64.deb ... Unpacking file (1:5.45-3+b1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.22.5-2_amd64.deb ... Unpacking gettext-base (0.22.5-2) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../06-libuchardet0_0.0.8-1+b2_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.23.0-5_amd64.deb ... Unpacking groff-base (1.23.0-5) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.40.2-11_amd64.deb ... Unpacking bsdextrautils (2.40.2-11) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../09-libpipeline1_1.5.8-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.13.0-1_amd64.deb ... Unpacking man-db (2.13.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.72-3_all.deb ... Unpacking autoconf (2.72-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.22.5-2_all.deb ... Unpacking autopoint (0.22.5-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.20_all.deb ... Unpacking libdebhelper-perl (13.20) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.4.7-8_all.deb ... Unpacking libtool (2.4.7-8) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../22-libelf1t64_0.192-4_amd64.deb ... Unpacking libelf1t64:amd64 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../23-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libicu72:amd64. Preparing to unpack .../24-libicu72_72.1-5+b1_amd64.deb ... Unpacking libicu72:amd64 (72.1-5+b1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../25-libxml2_2.12.7+dfsg+really2.9.14-0.2+b1_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.22.5-2_amd64.deb ... Unpacking gettext (0.22.5-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_13.20_all.deb ... Unpacking debhelper (13.20) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../30-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:amd64 (1.5.8-1) ... Setting up libkeyutils1:amd64 (1.6.3-4) ... Setting up libicu72:amd64 (72.1-5+b1) ... Setting up bsdextrautils (2.40.2-11) ... Setting up libmagic-mgc (1:5.45-3+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libtirpc-common (1.3.4+ds-1.3) ... Setting up libdebhelper-perl (13.20) ... Setting up libmagic1t64:amd64 (1:5.45-3+b1) ... Setting up gettext-base (0.22.5-2) ... Setting up m4 (1.4.19-4) ... Setting up libcom-err2:amd64 (1.47.1-1+b1) ... Setting up file (1:5.45-3+b1) ... Setting up libelf1t64:amd64 (0.192-4) ... Setting up libkrb5support0:amd64 (1.21.3-3) ... Setting up tzdata (2024b-3) ... Current default time zone: 'Etc/UTC' Local time is now: Sun Dec 28 15:30:43 UTC 2025. Universal Time is now: Sun Dec 28 15:30:43 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20220109.1) ... Setting up autopoint (0.22.5-2) ... Setting up libk5crypto3:amd64 (1.21.3-3) ... Setting up autoconf (2.72-3) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up dwz (0.15-1+b1) ... Setting up sensible-utils (0.0.24) ... Setting up libuchardet0:amd64 (0.0.8-1+b2) ... Setting up netbase (6.4) ... Setting up libkrb5-3:amd64 (1.21.3-3) ... Setting up readline-common (8.2-5) ... Setting up libxml2:amd64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up gettext (0.22.5-2) ... Setting up libtool (2.4.7-8) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libgssapi-krb5-2:amd64 (1.21.3-3) ... Setting up libreadline8t64:amd64 (8.2-5) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up groff-base (1.23.0-5) ... Setting up libtirpc3t64:amd64 (1.3.4+ds-1.3+b1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.13.0-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libnsl2:amd64 (1.3.0-3+b3) ... Setting up libpython3.12-stdlib:amd64 (3.12.7-3) ... Setting up python3.12 (3.12.7-3) ... Setting up debhelper (13.20) ... Setting up libpython3-stdlib:amd64 (3.12.6-1) ... Setting up python3 (3.12.6-1) ... Processing triggers for libc-bin (2.40-3) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-9_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-9 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Étienne Mollier dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_auto_clean make -j42 clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_auto_build make -j42 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep seqprep mv /build/reproducible-path/seqprep-1.3.2/debian/README.html /build/reproducible-path/seqprep-1.3.2 make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.216741 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.199704 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j42 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep /build/reproducible-path/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/reproducible-path/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-9_all.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-9_amd64.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-9_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/1442780 and its subdirectories I: Current time: Sun Dec 28 03:32:04 -12 2025 I: pbuilder-time-stamp: 1766935924 Mon Nov 25 09:09:06 UTC 2024 I: 1st build successful. Starting 2nd build on remote node ionos1-amd64.debian.net. Mon Nov 25 09:09:06 UTC 2024 I: Preparing to do remote build '2' on ionos1-amd64.debian.net. Mon Nov 25 09:09:06 UTC 2024 - checking /var/lib/jenkins/offline_nodes if ionos1-amd64.debian.net is marked as down. Mon Nov 25 09:09:06 UTC 2024 - checking via ssh if ionos1-amd64.debian.net is up. removed '/tmp/read-only-fs-test-ZSz527' ==================================================================================== Mon Nov 25 09:09:07 UTC 2024 - running /srv/jenkins/bin/reproducible_build.sh (for job /srv/jenkins/bin/reproducible_build.sh) on ionos1-amd64, called using "2 seqprep trixie /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke 1.3.2-9" as arguments. Mon Nov 25 09:09:07 UTC 2024 - actually running "reproducible_build.sh" (md5sum 68e686e434c9ab7bc3ec047d8b309cbc) as "/tmp/jenkins-script-Kq35Dq4M" $ git clone https://salsa.debian.org/qa/jenkins.debian.net.git ; more CONTRIBUTING Mon Nov 25 09:09:07 UTC 2024 I: Downloading source for trixie/seqprep=1.3.2-9 Reading package lists... NOTICE: 'seqprep' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/seqprep.git Please use: git clone https://salsa.debian.org/med-team/seqprep.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 37.2 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (dsc) [2260 B] Get:2 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (tar) [37.2 MB] Get:3 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (diff) [12.5 kB] Fetched 37.2 MB in 1s (48.9 MB/s) Download complete and in download only mode Reading package lists... NOTICE: 'seqprep' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/seqprep.git Please use: git clone https://salsa.debian.org/med-team/seqprep.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 37.2 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (dsc) [2260 B] Get:2 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (tar) [37.2 MB] Get:3 http://deb.debian.org/debian trixie/main seqprep 1.3.2-9 (diff) [12.5 kB] Fetched 37.2 MB in 1s (48.9 MB/s) Download complete and in download only mode ============================================================================= Re-Building seqprep in trixie on amd64 on ionos1-amd64 now. Date: Mon Nov 25 09:09:09 UTC 2024 Date UTC: Mon Nov 25 09:09:09 UTC 2024 ============================================================================= ++ mktemp -t pbuilderrc_XXXX --tmpdir=/srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke + local TMPCFG=/srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/pbuilderrc_fTlF + case ${ARCH} in + case $ARCH in + locale=et_EE + language=et + case "${SUITE}" in + reproducible_buildflags=+all + extra_deb_build_options= + case "${SRCPACKAGE}" in + cat + echo BUILDDIR=/build/reproducible-path + '[' seqprep = debian-installer -o seqprep = debian-installer-netboot-images ']' + pbuilder_options=() + local pbuilder_options + DEBBUILDOPTS=-b + BINARYTARGET= + '[' seqprep = u-boot ']' + case "${SRCPACKAGE}" in + PBUILDERTIMEOUT=24 + local PRESULT=0 + sudo timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/pbuilderrc_fTlF --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b2 --logfile b2/build.log seqprep_1.3.2-9.dsc W: /root/.pbuilderrc does not exist I: Logging to b2/build.log I: pbuilder: network access will be disabled during build I: Current time: Mon Nov 25 23:09:10 +14 2024 I: pbuilder-time-stamp: 1732525750 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-9.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-9.debian.tar.xz] I: Extracting source gpgv: Signature made Thu Mar 14 19:39:56 2024 gpgv: using RSA key 8F91B227C7D6F2B1948C8236793CF67E8F0D11DA gpgv: issuer "emollier@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./seqprep_1.3.2-9.dsc: no acceptable signature found dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-9.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch dpkg-source: info: applying fix-declarations.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D01_modify_environment starting debug: Running on ionos1-amd64. I: Changing host+domainname to test build reproducibility I: Adding a custom variable just for the fun of it... I: Changing /bin/sh to bash '/bin/sh' -> '/bin/bash' lrwxrwxrwx 1 root root 9 Nov 25 09:09 /bin/sh -> /bin/bash I: Setting pbuilder2's login shell to /bin/bash I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D01_modify_environment finished I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D02_print_environment starting I: set BASH=/bin/sh BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath BASH_ALIASES=() BASH_ARGC=() BASH_ARGV=() BASH_CMDS=() BASH_LINENO=([0]="12" [1]="0") BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") BASH_VERSINFO=([0]="5" [1]="2" [2]="32" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu") BASH_VERSION='5.2.32(1)-release' BUILDDIR=/build/reproducible-path BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' BUILDUSERNAME=pbuilder2 BUILD_ARCH=amd64 DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=20 ' DIRSTACK=() DISTRIBUTION=trixie EUID=0 FUNCNAME=([0]="Echo" [1]="main") GROUPS=() HOME=/root HOSTNAME=i-capture-the-hostname HOSTTYPE=x86_64 HOST_ARCH=amd64 IFS=' ' INVOCATION_ID=066dc3f2739c4d67bfb1e6a7b5f313f4 LANG=C LANGUAGE=et_EE:et LC_ALL=C MACHTYPE=x86_64-pc-linux-gnu MAIL=/var/mail/root OPTERR=1 OPTIND=1 OSTYPE=linux-gnu PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path PBCURRENTCOMMANDLINEOPERATION=build PBUILDER_OPERATION=build PBUILDER_PKGDATADIR=/usr/share/pbuilder PBUILDER_PKGLIBDIR=/usr/lib/pbuilder PBUILDER_SYSCONFDIR=/etc PIPESTATUS=([0]="0") POSIXLY_CORRECT=y PPID=316766 PS4='+ ' PWD=/ SHELL=/bin/bash SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix SHLVL=3 SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/pbuilderrc_fTlF --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b2 --logfile b2/build.log seqprep_1.3.2-9.dsc' SUDO_GID=110 SUDO_UID=105 SUDO_USER=jenkins TERM=unknown TZ=/usr/share/zoneinfo/Etc/GMT-14 UID=0 USER=root _='I: set' http_proxy=http://46.16.76.132:3128 I: uname -a Linux i-capture-the-hostname 6.1.0-28-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.119-1 (2024-11-22) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Aug 4 21:30 /bin -> usr/bin I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), python3, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19969 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libcom-err2{a} libdebhelper-perl{a} libelf1t64{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libgssapi-krb5-2{a} libicu72{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libmagic-mgc{a} libmagic1t64{a} libnsl2{a} libpipeline1{a} libpython3-stdlib{a} libpython3.12-minimal{a} libpython3.12-stdlib{a} libreadline8t64{a} libtirpc-common{a} libtirpc3t64{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} media-types{a} netbase{a} po-debconf{a} python3{a} python3-minimal{a} python3.12{a} python3.12-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl krb5-locales libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 52 newly installed, 0 to remove and 0 not upgraded. Need to get 27.8 MB of archives. After unpacking 106 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main amd64 libpython3.12-minimal amd64 3.12.7-3 [815 kB] Get: 2 http://deb.debian.org/debian trixie/main amd64 libexpat1 amd64 2.6.4-1 [106 kB] Get: 3 http://deb.debian.org/debian trixie/main amd64 python3.12-minimal amd64 3.12.7-3 [2162 kB] Get: 4 http://deb.debian.org/debian trixie/main amd64 python3-minimal amd64 3.12.6-1 [26.7 kB] Get: 5 http://deb.debian.org/debian trixie/main amd64 media-types all 10.1.0 [26.9 kB] Get: 6 http://deb.debian.org/debian trixie/main amd64 netbase all 6.4 [12.8 kB] Get: 7 http://deb.debian.org/debian trixie/main amd64 tzdata all 2024b-3 [255 kB] Get: 8 http://deb.debian.org/debian trixie/main amd64 libkrb5support0 amd64 1.21.3-3 [32.5 kB] Get: 9 http://deb.debian.org/debian trixie/main amd64 libcom-err2 amd64 1.47.1-1+b1 [23.2 kB] Get: 10 http://deb.debian.org/debian trixie/main amd64 libk5crypto3 amd64 1.21.3-3 [79.9 kB] Get: 11 http://deb.debian.org/debian trixie/main amd64 libkeyutils1 amd64 1.6.3-4 [9092 B] Get: 12 http://deb.debian.org/debian trixie/main amd64 libkrb5-3 amd64 1.21.3-3 [324 kB] Get: 13 http://deb.debian.org/debian trixie/main amd64 libgssapi-krb5-2 amd64 1.21.3-3 [136 kB] Get: 14 http://deb.debian.org/debian trixie/main amd64 libtirpc-common all 1.3.4+ds-1.3 [10.9 kB] Get: 15 http://deb.debian.org/debian trixie/main amd64 libtirpc3t64 amd64 1.3.4+ds-1.3+b1 [83.1 kB] Get: 16 http://deb.debian.org/debian trixie/main amd64 libnsl2 amd64 1.3.0-3+b3 [40.6 kB] Get: 17 http://deb.debian.org/debian trixie/main amd64 readline-common all 8.2-5 [69.3 kB] Get: 18 http://deb.debian.org/debian trixie/main amd64 libreadline8t64 amd64 8.2-5 [169 kB] Get: 19 http://deb.debian.org/debian trixie/main amd64 libpython3.12-stdlib amd64 3.12.7-3 [1966 kB] Get: 20 http://deb.debian.org/debian trixie/main amd64 python3.12 amd64 3.12.7-3 [671 kB] Get: 21 http://deb.debian.org/debian trixie/main amd64 libpython3-stdlib amd64 3.12.6-1 [9692 B] Get: 22 http://deb.debian.org/debian trixie/main amd64 python3 amd64 3.12.6-1 [27.8 kB] Get: 23 http://deb.debian.org/debian trixie/main amd64 sensible-utils all 0.0.24 [24.8 kB] Get: 24 http://deb.debian.org/debian trixie/main amd64 libmagic-mgc amd64 1:5.45-3+b1 [314 kB] Get: 25 http://deb.debian.org/debian trixie/main amd64 libmagic1t64 amd64 1:5.45-3+b1 [108 kB] Get: 26 http://deb.debian.org/debian trixie/main amd64 file amd64 1:5.45-3+b1 [43.3 kB] Get: 27 http://deb.debian.org/debian trixie/main amd64 gettext-base amd64 0.22.5-2 [200 kB] Get: 28 http://deb.debian.org/debian trixie/main amd64 libuchardet0 amd64 0.0.8-1+b2 [68.9 kB] Get: 29 http://deb.debian.org/debian trixie/main amd64 groff-base amd64 1.23.0-5 [1181 kB] Get: 30 http://deb.debian.org/debian trixie/main amd64 bsdextrautils amd64 2.40.2-11 [91.5 kB] Get: 31 http://deb.debian.org/debian trixie/main amd64 libpipeline1 amd64 1.5.8-1 [42.0 kB] Get: 32 http://deb.debian.org/debian trixie/main amd64 man-db amd64 2.13.0-1 [1420 kB] Get: 33 http://deb.debian.org/debian trixie/main amd64 m4 amd64 1.4.19-4 [287 kB] Get: 34 http://deb.debian.org/debian trixie/main amd64 autoconf all 2.72-3 [493 kB] Get: 35 http://deb.debian.org/debian trixie/main amd64 autotools-dev all 20220109.1 [51.6 kB] Get: 36 http://deb.debian.org/debian trixie/main amd64 automake all 1:1.16.5-1.3 [823 kB] Get: 37 http://deb.debian.org/debian trixie/main amd64 autopoint all 0.22.5-2 [723 kB] Get: 38 http://deb.debian.org/debian trixie/main amd64 libdebhelper-perl all 13.20 [89.7 kB] Get: 39 http://deb.debian.org/debian trixie/main amd64 libtool all 2.4.7-8 [517 kB] Get: 40 http://deb.debian.org/debian trixie/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 41 http://deb.debian.org/debian trixie/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 42 http://deb.debian.org/debian trixie/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB] Get: 43 http://deb.debian.org/debian trixie/main amd64 dh-strip-nondeterminism all 1.14.0-1 [8448 B] Get: 44 http://deb.debian.org/debian trixie/main amd64 libelf1t64 amd64 0.192-4 [189 kB] Get: 45 http://deb.debian.org/debian trixie/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 46 http://deb.debian.org/debian trixie/main amd64 libicu72 amd64 72.1-5+b1 [9423 kB] Get: 47 http://deb.debian.org/debian trixie/main amd64 libxml2 amd64 2.12.7+dfsg+really2.9.14-0.2+b1 [699 kB] Get: 48 http://deb.debian.org/debian trixie/main amd64 gettext amd64 0.22.5-2 [1601 kB] Get: 49 http://deb.debian.org/debian trixie/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 50 http://deb.debian.org/debian trixie/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 51 http://deb.debian.org/debian trixie/main amd64 debhelper all 13.20 [915 kB] Get: 52 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] Fetched 27.8 MB in 12s (2394 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.12-minimal:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19969 files and directories currently installed.) Preparing to unpack .../libpython3.12-minimal_3.12.7-3_amd64.deb ... Unpacking libpython3.12-minimal:amd64 (3.12.7-3) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.6.4-1_amd64.deb ... Unpacking libexpat1:amd64 (2.6.4-1) ... Selecting previously unselected package python3.12-minimal. Preparing to unpack .../python3.12-minimal_3.12.7-3_amd64.deb ... Unpacking python3.12-minimal (3.12.7-3) ... Setting up libpython3.12-minimal:amd64 (3.12.7-3) ... Setting up libexpat1:amd64 (2.6.4-1) ... Setting up python3.12-minimal (3.12.7-3) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20289 files and directories currently installed.) Preparing to unpack .../00-python3-minimal_3.12.6-1_amd64.deb ... Unpacking python3-minimal (3.12.6-1) ... Selecting previously unselected package media-types. Preparing to unpack .../01-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../02-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../03-tzdata_2024b-3_all.deb ... Unpacking tzdata (2024b-3) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../04-libkrb5support0_1.21.3-3_amd64.deb ... Unpacking libkrb5support0:amd64 (1.21.3-3) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../05-libcom-err2_1.47.1-1+b1_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.1-1+b1) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../06-libk5crypto3_1.21.3-3_amd64.deb ... Unpacking libk5crypto3:amd64 (1.21.3-3) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../07-libkeyutils1_1.6.3-4_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-4) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../08-libkrb5-3_1.21.3-3_amd64.deb ... Unpacking libkrb5-3:amd64 (1.21.3-3) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../09-libgssapi-krb5-2_1.21.3-3_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.21.3-3) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../10-libtirpc-common_1.3.4+ds-1.3_all.deb ... Unpacking libtirpc-common (1.3.4+ds-1.3) ... Selecting previously unselected package libtirpc3t64:amd64. Preparing to unpack .../11-libtirpc3t64_1.3.4+ds-1.3+b1_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3 to /lib/x86_64-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3.0.0 to /lib/x86_64-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:amd64 (1.3.4+ds-1.3+b1) ... Selecting previously unselected package libnsl2:amd64. Preparing to unpack .../12-libnsl2_1.3.0-3+b3_amd64.deb ... Unpacking libnsl2:amd64 (1.3.0-3+b3) ... Selecting previously unselected package readline-common. Preparing to unpack .../13-readline-common_8.2-5_all.deb ... Unpacking readline-common (8.2-5) ... Selecting previously unselected package libreadline8t64:amd64. Preparing to unpack .../14-libreadline8t64_8.2-5_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8 to /lib/x86_64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8.2 to /lib/x86_64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8 to /lib/x86_64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8.2 to /lib/x86_64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:amd64 (8.2-5) ... Selecting previously unselected package libpython3.12-stdlib:amd64. Preparing to unpack .../15-libpython3.12-stdlib_3.12.7-3_amd64.deb ... Unpacking libpython3.12-stdlib:amd64 (3.12.7-3) ... Selecting previously unselected package python3.12. Preparing to unpack .../16-python3.12_3.12.7-3_amd64.deb ... Unpacking python3.12 (3.12.7-3) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../17-libpython3-stdlib_3.12.6-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.12.6-1) ... Setting up python3-minimal (3.12.6-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21351 files and directories currently installed.) Preparing to unpack .../00-python3_3.12.6-1_amd64.deb ... Unpacking python3 (3.12.6-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.24_all.deb ... Unpacking sensible-utils (0.0.24) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.45-3+b1_amd64.deb ... Unpacking libmagic-mgc (1:5.45-3+b1) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../03-libmagic1t64_1%3a5.45-3+b1_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.45-3+b1) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.45-3+b1_amd64.deb ... Unpacking file (1:5.45-3+b1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.22.5-2_amd64.deb ... Unpacking gettext-base (0.22.5-2) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../06-libuchardet0_0.0.8-1+b2_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.23.0-5_amd64.deb ... Unpacking groff-base (1.23.0-5) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.40.2-11_amd64.deb ... Unpacking bsdextrautils (2.40.2-11) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../09-libpipeline1_1.5.8-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.13.0-1_amd64.deb ... Unpacking man-db (2.13.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.72-3_all.deb ... Unpacking autoconf (2.72-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.22.5-2_all.deb ... Unpacking autopoint (0.22.5-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.20_all.deb ... Unpacking libdebhelper-perl (13.20) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.4.7-8_all.deb ... Unpacking libtool (2.4.7-8) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_1.14.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.0-1) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../22-libelf1t64_0.192-4_amd64.deb ... Unpacking libelf1t64:amd64 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../23-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libicu72:amd64. Preparing to unpack .../24-libicu72_72.1-5+b1_amd64.deb ... Unpacking libicu72:amd64 (72.1-5+b1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../25-libxml2_2.12.7+dfsg+really2.9.14-0.2+b1_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.22.5-2_amd64.deb ... Unpacking gettext (0.22.5-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_13.20_all.deb ... Unpacking debhelper (13.20) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../30-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:amd64 (1.5.8-1) ... Setting up libkeyutils1:amd64 (1.6.3-4) ... Setting up libicu72:amd64 (72.1-5+b1) ... Setting up bsdextrautils (2.40.2-11) ... Setting up libmagic-mgc (1:5.45-3+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libtirpc-common (1.3.4+ds-1.3) ... Setting up libdebhelper-perl (13.20) ... Setting up libmagic1t64:amd64 (1:5.45-3+b1) ... Setting up gettext-base (0.22.5-2) ... Setting up m4 (1.4.19-4) ... Setting up libcom-err2:amd64 (1.47.1-1+b1) ... Setting up file (1:5.45-3+b1) ... Setting up libelf1t64:amd64 (0.192-4) ... Setting up libkrb5support0:amd64 (1.21.3-3) ... Setting up tzdata (2024b-3) ... Current default time zone: 'Etc/UTC' Local time is now: Mon Nov 25 09:11:12 UTC 2024. Universal Time is now: Mon Nov 25 09:11:12 UTC 2024. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20220109.1) ... Setting up autopoint (0.22.5-2) ... Setting up libk5crypto3:amd64 (1.21.3-3) ... Setting up autoconf (2.72-3) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up dwz (0.15-1+b1) ... Setting up sensible-utils (0.0.24) ... Setting up libuchardet0:amd64 (0.0.8-1+b2) ... Setting up netbase (6.4) ... Setting up libkrb5-3:amd64 (1.21.3-3) ... Setting up readline-common (8.2-5) ... Setting up libxml2:amd64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... Setting up gettext (0.22.5-2) ... Setting up libtool (2.4.7-8) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libgssapi-krb5-2:amd64 (1.21.3-3) ... Setting up libreadline8t64:amd64 (8.2-5) ... Setting up dh-strip-nondeterminism (1.14.0-1) ... Setting up groff-base (1.23.0-5) ... Setting up libtirpc3t64:amd64 (1.3.4+ds-1.3+b1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.13.0-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libnsl2:amd64 (1.3.0-3+b3) ... Setting up libpython3.12-stdlib:amd64 (3.12.7-3) ... Setting up python3.12 (3.12.7-3) ... Setting up debhelper (13.20) ... Setting up libpython3-stdlib:amd64 (3.12.6-1) ... Setting up python3 (3.12.6-1) ... Processing triggers for libc-bin (2.40-3) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: user script /srv/workspace/pbuilder/316766/tmp/hooks/A99_set_merged_usr starting Not re-configuring usrmerge for trixie I: user script /srv/workspace/pbuilder/316766/tmp/hooks/A99_set_merged_usr finished hostname: Name or service not known I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../seqprep_1.3.2-9_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-9 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Étienne Mollier dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_auto_clean make -j20 clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_auto_build make -j20 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep seqprep mv /build/reproducible-path/seqprep-1.3.2/debian/README.html /build/reproducible-path/seqprep-1.3.2 make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.324541 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.286467 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j20 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep /build/reproducible-path/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/reproducible-path/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-9_all.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-9_amd64.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-9_amd64.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-9_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: user script /srv/workspace/pbuilder/316766/tmp/hooks/B01_cleanup starting I: user script /srv/workspace/pbuilder/316766/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/316766 and its subdirectories I: Current time: Mon Nov 25 23:13:23 +14 2024 I: pbuilder-time-stamp: 1732526003 + false + set +x Mon Nov 25 09:13:23 UTC 2024 I: Signing ./b2/seqprep_1.3.2-9_amd64.buildinfo as seqprep_1.3.2-9_amd64.buildinfo.asc Mon Nov 25 09:13:23 UTC 2024 I: Signed ./b2/seqprep_1.3.2-9_amd64.buildinfo as ./b2/seqprep_1.3.2-9_amd64.buildinfo.asc Mon Nov 25 09:13:23 UTC 2024 - build #2 for seqprep/trixie/amd64 on ionos1-amd64 done. Starting cleanup. All cleanup done. Mon Nov 25 09:13:23 UTC 2024 - reproducible_build.sh stopped running as /tmp/jenkins-script-Kq35Dq4M, removing. /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke: total 48 drwxr-xr-x 2 jenkins jenkins 4096 Nov 25 09:09 b1 drwxr-xr-x 2 jenkins jenkins 4096 Nov 25 09:13 b2 -rw------- 1 jenkins jenkins 35611 Nov 25 09:09 rbuildlog.CtoL8k8 -rw-r--r-- 1 jenkins jenkins 2260 Mar 14 2024 seqprep_1.3.2-9.dsc /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b1: total 35184 -rw-r--r-- 1 jenkins jenkins 31967 Nov 25 09:09 build.log -rw-r--r-- 1 jenkins jenkins 35859764 Nov 25 09:09 seqprep-data_1.3.2-9_all.deb -rw-r--r-- 1 jenkins jenkins 18848 Nov 25 09:09 seqprep-dbgsym_1.3.2-9_amd64.deb -rw-r--r-- 1 jenkins jenkins 12468 Nov 25 09:09 seqprep_1.3.2-9.debian.tar.xz -rw-r--r-- 1 jenkins jenkins 2260 Nov 25 09:09 seqprep_1.3.2-9.dsc -rw-r--r-- 1 jenkins jenkins 5976 Nov 25 09:09 seqprep_1.3.2-9_amd64.buildinfo -rw-r--r-- 1 jenkins jenkins 6858 Nov 25 09:09 seqprep_1.3.2-9_amd64.buildinfo.asc -rw-r--r-- 1 jenkins jenkins 1866 Nov 25 09:09 seqprep_1.3.2-9_amd64.changes -rw-r--r-- 1 jenkins jenkins 28192 Nov 25 09:09 seqprep_1.3.2-9_amd64.deb -rw-r--r-- 1 jenkins jenkins 1356 Nov 25 09:09 seqprep_1.3.2-9_source.changes /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b2: total 35148 -rw-r--r-- 1 jenkins jenkins 33876 Nov 25 09:13 build.log -rw-r--r-- 1 jenkins jenkins 35859764 Nov 25 09:13 seqprep-data_1.3.2-9_all.deb -rw-r--r-- 1 jenkins jenkins 18848 Nov 25 09:13 seqprep-dbgsym_1.3.2-9_amd64.deb -rw-r--r-- 1 jenkins jenkins 12468 Nov 25 09:13 seqprep_1.3.2-9.debian.tar.xz -rw-r--r-- 1 jenkins jenkins 2260 Nov 25 09:13 seqprep_1.3.2-9.dsc -rw-r--r-- 1 jenkins jenkins 5967 Nov 25 09:13 seqprep_1.3.2-9_amd64.buildinfo -rw-r--r-- 1 jenkins jenkins 6849 Nov 25 09:13 seqprep_1.3.2-9_amd64.buildinfo.asc -rw-r--r-- 1 jenkins jenkins 1866 Nov 25 09:13 seqprep_1.3.2-9_amd64.changes -rw-r--r-- 1 jenkins jenkins 28192 Nov 25 09:13 seqprep_1.3.2-9_amd64.deb -rw-r--r-- 1 jenkins jenkins 1356 Nov 25 09:13 seqprep_1.3.2-9_source.changes Mon Nov 25 09:13:24 UTC 2024 I: Deleting $TMPDIR on ionos1-amd64.debian.net. Mon Nov 25 09:13:25 UTC 2024 I: seqprep_1.3.2-9_amd64.changes: Format: 1.8 Date: Thu, 14 Mar 2024 20:32:47 +0100 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all amd64 Version: 1.3.2-9 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Étienne Mollier Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 1066363 Changes: seqprep (1.3.2-9) unstable; urgency=medium . * Team upload. * fix-declarations.patch: new: fix ftbfs. (Closes: #1066363) * Add ITP bug in seqprep version 1.1-0biolinux1. * Update standards version to 4.6.2, no changes needed. Checksums-Sha1: 1f319e8808fc74a8cfed97c4b97e56e613adfe1c 35859764 seqprep-data_1.3.2-9_all.deb 314ccf055787a7864460e617b58ce987c5656cdd 18848 seqprep-dbgsym_1.3.2-9_amd64.deb 3065d90d69c00e9e4b98bc1c49b0b6f82e39ea1d 5976 seqprep_1.3.2-9_amd64.buildinfo ea1b306151344714d6cda79c21b6f213a96033ca 28192 seqprep_1.3.2-9_amd64.deb Checksums-Sha256: c5a6aa05a249fce176d25a4440f2776a80000898228690af4411a04b42811a0f 35859764 seqprep-data_1.3.2-9_all.deb 0e258c8e02233e0a49407983e288849b9d0b660bae2c003cf4b86759080fa1ca 18848 seqprep-dbgsym_1.3.2-9_amd64.deb 0e70b9573d34bbe5bde85c63d7b9d83115c37da4bd2a5d2eb7b8d5279cc8e351 5976 seqprep_1.3.2-9_amd64.buildinfo 16144fe2ee01e531388ae58d4f86e37d4a9590840327c8bbcc56a978dbfc0ff8 28192 seqprep_1.3.2-9_amd64.deb Files: 16758c6a3e66a4da223e5e7120b8b308 35859764 science optional seqprep-data_1.3.2-9_all.deb 7c9a5391a50e32d55d54062cd7405698 18848 debug optional seqprep-dbgsym_1.3.2-9_amd64.deb 3938cf180b981b2b8f04dba05a64b476 5976 science optional seqprep_1.3.2-9_amd64.buildinfo 5852f3baf7446b00654d1e7c265afe53 28192 science optional seqprep_1.3.2-9_amd64.deb removed '/var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/seqprep_1.3.2-9.rbuild.log' removed '/var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/seqprep_1.3.2-9.rbuild.log.gz' removed '/var/lib/jenkins/userContent/reproducible/debian/logs/trixie/amd64/seqprep_1.3.2-9.build1.log.gz' removed '/var/lib/jenkins/userContent/reproducible/debian/logs/trixie/amd64/seqprep_1.3.2-9.build2.log.gz' removed '/var/lib/jenkins/userContent/reproducible/debian/buildinfo/trixie/amd64/seqprep_1.3.2-9_amd64.buildinfo' removed '/var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/amd64/seqprep_1.3.2-9.diff.gz' Diff of the two buildlogs: -- --- b1/build.log 2024-11-25 09:09:05.613436515 +0000 +++ b2/build.log 2024-11-25 09:13:23.965808224 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Sun Dec 28 03:27:05 -12 2025 -I: pbuilder-time-stamp: 1766935625 +I: Current time: Mon Nov 25 23:09:10 +14 2024 +I: pbuilder-time-stamp: 1732525750 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration @@ -32,52 +32,84 @@ dpkg-source: info: applying fix-declarations.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/1442780/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D01_modify_environment starting +debug: Running on ionos1-amd64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Nov 25 09:09 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='amd64' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' - DISTRIBUTION='trixie' - HOME='/root' - HOST_ARCH='amd64' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="32" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu") + BASH_VERSION='5.2.32(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=amd64 + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=20 ' + DIRSTACK=() + DISTRIBUTION=trixie + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=x86_64 + HOST_ARCH=amd64 IFS=' ' - INVOCATION_ID='64162369d4f14936931f30fc3c98136b' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='1442780' - PS1='# ' - PS2='> ' + INVOCATION_ID=066dc3f2739c4d67bfb1e6a7b5f313f4 + LANG=C + LANGUAGE=et_EE:et + LC_ALL=C + MACHTYPE=x86_64-pc-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=316766 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/pbuilderrc_TCte --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b1 --logfile b1/build.log seqprep_1.3.2-9.dsc' - SUDO_GID='111' - SUDO_UID='106' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://213.165.73.152:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/pbuilderrc_fTlF --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b2 --logfile b2/build.log seqprep_1.3.2-9.dsc' + SUDO_GID=110 + SUDO_UID=105 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://46.16.76.132:3128 I: uname -a - Linux ionos15-amd64 6.11.5+bpo-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.11.5-1~bpo12+1 (2024-11-11) x86_64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-28-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.119-1 (2024-11-22) x86_64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 Aug 4 2024 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/1442780/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 Aug 4 21:30 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -169,7 +201,7 @@ Get: 50 http://deb.debian.org/debian trixie/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 51 http://deb.debian.org/debian trixie/main amd64 debhelper all 13.20 [915 kB] Get: 52 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] -Fetched 27.8 MB in 7s (4215 kB/s) +Fetched 27.8 MB in 12s (2394 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libpython3.12-minimal:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19969 files and directories currently installed.) @@ -359,8 +391,8 @@ Setting up tzdata (2024b-3) ... Current default time zone: 'Etc/UTC' -Local time is now: Sun Dec 28 15:30:43 UTC 2025. -Universal Time is now: Sun Dec 28 15:30:43 UTC 2025. +Local time is now: Mon Nov 25 09:11:12 UTC 2024. +Universal Time is now: Mon Nov 25 09:11:12 UTC 2024. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20220109.1) ... @@ -406,7 +438,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-9_source.changes +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for trixie +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../seqprep_1.3.2-9_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-9 dpkg-buildpackage: info: source distribution unstable @@ -416,7 +452,7 @@ debian/rules clean dh clean dh_auto_clean - make -j42 clean + make -j20 clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' @@ -434,7 +470,7 @@ debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_auto_build - make -j42 "INSTALL=install --strip-program=true" + make -j20 "INSTALL=install --strip-program=true" make[2]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o @@ -456,21 +492,21 @@ Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 -CPU Time Used (Minutes): 0.216741 +CPU Time Used (Minutes): 0.324541 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 -CPU Time Used (Minutes): 0.199704 +CPU Time Used (Minutes): 0.286467 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz -++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py +++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python3 seqlens.py @@ -488,7 +524,7 @@ create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install - make -j42 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" + make -j20 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep /build/reproducible-path/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' @@ -515,9 +551,9 @@ dh_gencontrol dh_md5sums dh_builddeb -dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-9_amd64.deb'. -dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-9_amd64.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-9_all.deb'. +dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-9_amd64.deb'. +dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-9_amd64.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-9_amd64.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-9_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) @@ -525,12 +561,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/316766/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/1442780 and its subdirectories -I: Current time: Sun Dec 28 03:32:04 -12 2025 -I: pbuilder-time-stamp: 1766935924 +I: removing directory /srv/workspace/pbuilder/316766 and its subdirectories +I: Current time: Mon Nov 25 23:13:23 +14 2024 +I: pbuilder-time-stamp: 1732526003 Compressing the 2nd log... /var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/amd64/seqprep_1.3.2-9.diff: 68.5% -- replaced with /var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/amd64/seqprep_1.3.2-9.diff.gz b2/build.log: 77.3% -- replaced with stdout Compressing the 1st log... b1/build.log: 78.2% -- replaced with stdout Mon Nov 25 09:13:26 UTC 2024 I: diffoscope 283 will be used to compare the two builds: ++ date -u +%s + DIFFOSCOPE_STAMP=/var/log/reproducible-builds/diffoscope_stamp_seqprep_trixie_amd64_1732526006 + touch /var/log/reproducible-builds/diffoscope_stamp_seqprep_trixie_amd64_1732526006 + RESULT=0 + systemd-run '--description=diffoscope on seqprep/1.3.2-9 in trixie/amd64' --slice=rb-build-diffoscope.slice -u rb-diffoscope-amd64_4-38108 '--property=SuccessExitStatus=1 124' --user --send-sighup --pipe --wait -E TMPDIR timeout 155m nice schroot --directory /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke --run-session -c jenkins-reproducible-trixie-diffoscope-bf84c426-53a8-47a3-a61d-8ded113ddad9 -- sh -c 'export TMPDIR=/srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/dbd-tmp-z46IgGr ; timeout 150m diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/seqprep_1.3.2-9.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/seqprep_1.3.2-9.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/seqprep_1.3.2-9.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b1/seqprep_1.3.2-9_amd64.changes /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b2/seqprep_1.3.2-9_amd64.changes' + false + set +x Running as unit: rb-diffoscope-amd64_4-38108.service # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/seqprep_1.3.2-9.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/seqprep_1.3.2-9.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/seqprep_1.3.2-9.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b1/seqprep_1.3.2-9_amd64.changes /srv/reproducible-results/rbuild-debian/r-b-build.YmCoQBke/b2/seqprep_1.3.2-9_amd64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.866s) 0.866s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.481s) 0.481s 12 calls diffoscope.comparators.binary.FilesystemFile ## specialize (total time: 0.000s) 0.000s 1 call specialize Finished with result: success Main processes terminated with: code=exited/status=0 Service runtime: 1.231s CPU time consumed: 1.225s ___ ___ __ _ _ __ _ __ ___ _ __ / __|/ _ \/ _` | '_ \| '__/ _ \ '_ \ \__ \ __/ (_| | |_) | | | __/ |_) | |___/\___|\__, | .__/|_| \___| .__/ |_|_| |_| Mon Nov 25 09:13:27 UTC 2024 I: diffoscope 283 found no differences in the changes files, and a .buildinfo file also exists. Mon Nov 25 09:13:27 UTC 2024 I: seqprep from trixie built successfully and reproducibly on amd64. INSERT 0 1 INSERT 0 1 DELETE 1 [2024-11-25 09:13:28] INFO: Starting at 2024-11-25 09:13:28.436320 [2024-11-25 09:13:28] INFO: Generating the pages of 1 package(s) [2024-11-25 09:13:28] CRITICAL: https://tests.reproducible-builds.org/debian/trixie/amd64/seqprep didn't produce a buildlog, even though it has been built. [2024-11-25 09:13:29] INFO: Finished at 2024-11-25 09:13:29.041036, took: 0:00:00.604723 Mon Nov 25 09:13:29 UTC 2024 - successfully updated the database and updated https://tests.reproducible-builds.org/debian/rb-pkg/trixie/amd64/seqprep.html Mon Nov 25 09:13:29 UTC 2024 I: Submitting .buildinfo files to external archives: Mon Nov 25 09:13:29 UTC 2024 I: Submitting 8.0K b1/seqprep_1.3.2-9_amd64.buildinfo.asc https://buildinfo.debian.net/3065d90d69c00e9e4b98bc1c49b0b6f82e39ea1d/seqprep_1.3.2-9_all Mon Nov 25 09:13:31 UTC 2024 I: Submitting 8.0K b2/seqprep_1.3.2-9_amd64.buildinfo.asc https://buildinfo.debian.net/6ed7bce4b8db78291d550d479955fdaaca3824a8/seqprep_1.3.2-9_all Mon Nov 25 09:13:33 UTC 2024 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Mon Nov 25 09:13:33 UTC 2024 I: Done submitting .buildinfo files. Mon Nov 25 09:13:33 UTC 2024 I: Removing signed seqprep_1.3.2-9_amd64.buildinfo.asc files: removed './b1/seqprep_1.3.2-9_amd64.buildinfo.asc' removed './b2/seqprep_1.3.2-9_amd64.buildinfo.asc' 1732526013 amd64 trixie seqprep Starting cleanup. /var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/seqprep_1.3.2-9.rbuild.log: 74.3% -- replaced with /var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/seqprep_1.3.2-9.rbuild.log.gz [2024-11-25 09:13:34] INFO: Starting at 2024-11-25 09:13:34.071808 [2024-11-25 09:13:34] INFO: Generating the pages of 1 package(s) [2024-11-25 09:13:34] INFO: Finished at 2024-11-25 09:13:34.728208, took: 0:00:00.656406 All cleanup done. Mon Nov 25 09:13:34 UTC 2024 - total duration: 0h 9m 48s. Mon Nov 25 09:13:34 UTC 2024 - reproducible_build.sh stopped running as /tmp/jenkins-script-IwgIi7Lx, removing. Finished with result: success Main processes terminated with: code=exited/status=0 Service runtime: 9min 55.012s CPU time consumed: 8.454s