Running as unit: rb-build-amd64_6-53142.service ==================================================================================== Wed Aug 6 17:03:06 UTC 2025 - running /srv/jenkins/bin/reproducible_build.sh (for job reproducible_builder_amd64_6) on jenkins, called using "ionos5-amd64 ionos11-amd64" as arguments. Wed Aug 6 17:03:06 UTC 2025 - actually running "reproducible_build.sh" (md5sum 44ec6a3142940d5e9a7ab76543d96029) as "/tmp/jenkins-script-Ia6YoScM" $ git clone https://salsa.debian.org/qa/jenkins.debian.net.git ; more CONTRIBUTING Wed Aug 6 17:03:06 UTC 2025 - checking /var/lib/jenkins/offline_nodes if ionos5-amd64.debian.net is marked as down. Wed Aug 6 17:03:06 UTC 2025 - checking via ssh if ionos5-amd64.debian.net is up. removed '/tmp/read-only-fs-test-ptW07j' Wed Aug 6 17:03:07 UTC 2025 - checking /var/lib/jenkins/offline_nodes if ionos11-amd64.debian.net is marked as down. Wed Aug 6 17:03:07 UTC 2025 - checking via ssh if ionos11-amd64.debian.net is up. removed '/tmp/read-only-fs-test-XLoIi0' ok, let's check if libgoby-java is building anywhere yet… ok, libgoby-java is not building anywhere… UPDATE 1 ============================================================================= Initialising reproducibly build of libgoby-java in trixie on amd64 on jenkins now. 1st build will be done on ionos5-amd64.debian.net. 2nd build will be done on ionos11-amd64.debian.net. ============================================================================= Wed Aug 6 17:03:12 UTC 2025 I: starting to build libgoby-java/trixie/amd64 on jenkins on '2025-08-06 17:03' Wed Aug 6 17:03:12 UTC 2025 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/amd64_6/53142/console.log 1754499792 amd64 trixie libgoby-java Wed Aug 6 17:03:12 UTC 2025 I: Downloading source for trixie/libgoby-java=3.3.1+dfsg2-11 --2025-08-06 17:03:12-- http://deb.debian.org/debian/pool/main/libg/libgoby-java/libgoby-java_3.3.1%2bdfsg2-11.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 3008 (2.9K) [text/prs.lines.tag] Saving to: ‘libgoby-java_3.3.1+dfsg2-11.dsc’ 0K .. 100% 363M=0s 2025-08-06 17:03:12 (363 MB/s) - ‘libgoby-java_3.3.1+dfsg2-11.dsc’ saved [3008/3008] --2025-08-06 17:03:12-- http://deb.debian.org/debian/pool/main/libg/libgoby-java/libgoby-java_3.3.1%2bdfsg2-11.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 3008 (2.9K) [text/prs.lines.tag] Saving to: ‘libgoby-java_3.3.1+dfsg2-11.dsc’ 0K .. 100% 363M=0s 2025-08-06 17:03:12 (363 MB/s) - ‘libgoby-java_3.3.1+dfsg2-11.dsc’ saved [3008/3008] Wed Aug 6 17:03:12 UTC 2025 I: libgoby-java_3.3.1+dfsg2-11.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: libgoby-java Binary: libgoby-io-java, goby-java Architecture: all Version: 3.3.1+dfsg2-11 Maintainer: Debian Med Packaging Team Uploaders: Pierre Gruet , Andreas Tille Homepage: https://campagnelab.org/software/goby/ Standards-Version: 4.7.0 Vcs-Browser: https://salsa.debian.org/med-team/libgoby-java/ Vcs-Git: https://salsa.debian.org/med-team/libgoby-java.git Testsuite: autopkgtest Testsuite-Triggers: default-jdk Build-Depends: debhelper-compat (= 13), maven-debian-helper, javahelper, default-jdk Build-Depends-Indep: ant, ant-contrib, libjbzip2-java, libcommons-collections3-java, libcommons-configuration-java, libcommons-exec-java, libcommons-io-java, libcommons-lang-java, libcommons-logging-java, libcommons-math-java, libcommons-cli-java, libdistlib-java, liblog4j1.2-java, libexec-maven-plugin-java, libjaxb-api-java, libmaven-assembly-plugin-java, libmaven-antrun-plugin-java, libbuild-helper-maven-plugin-java, libmaven-dependency-plugin-java, libmaven-source-plugin-java, libmaven-javadoc-plugin-java, libprotobuf-java, libhtsjdk-java, libfastutil-java, protobuf-compiler, libjsap-java, libdsiutils-java, libicb-utils-java, libreflections-java, libpj-java, libprotobuf-dev, pkgconf, r-cran-rjava, libeasymock-java , junit4 , testng , libpicard-java Package-List: goby-java deb science optional arch=all libgoby-io-java deb science optional arch=all Checksums-Sha1: f9f9b6c1f4e76c9c403e1a9881d2c81f4d371d1c 41577532 libgoby-java_3.3.1+dfsg2.orig.tar.xz b26ff390aa68ce3035d8153bb80f2153382882ec 29428 libgoby-java_3.3.1+dfsg2-11.debian.tar.xz Checksums-Sha256: b76b19808f893790e238c91e65680441ff020794cc7708ad6695cf13f0767148 41577532 libgoby-java_3.3.1+dfsg2.orig.tar.xz db2427807fcc6967f7d3d85e656e4b219bd5af8e88faf8c21bdae07b6f74f468 29428 libgoby-java_3.3.1+dfsg2-11.debian.tar.xz Files: 3a8dbf45ef2c54ec3073240850acbc75 41577532 libgoby-java_3.3.1+dfsg2.orig.tar.xz ee077d346354fb548086bf2a9f9f11e5 29428 libgoby-java_3.3.1+dfsg2-11.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQIzBAEBCgAdFiEEM8soQxPpC9J9y0UjYAMWptwndHYFAmZDkf4ACgkQYAMWptwn dHbpoxAArW4ZHQHLR2i3CFyUh7icehts0H7Dw1QPOrrFFMGdEM3NxatGcCXLQr/a oeQbInqiDMzD4nypqLL5AMMSu3JH7nsQ5OvFLfw3dYZnZpKsDzhdorwnOmhpwZ8P rpL+rsNHL+Ond8BysNEHJHQzElxKrpOa39ihu/hgciQ3Spj7BdjE0qUyy9rcHH8D uGF75qN0lTwYntDkdRfUg9JbMfqBXyuqpI7l7aPuQqr9AID9dSA6ilHOEyvFn1v7 67RgMq6gFKztHYK2c2bwWzQ+exmoFglxPa77Nx6NuqZDEyRllzami0iUCI7n+E5m FcpGPLCcHypkhqhTU0kvlKiTYmrgTXRvhfGxfhBB5CF4V3LFYzdsie113QWpaSru qLorRzuMHUJgKbtjy/H9aDQfkqeua7+cnz1wGnOlpBrutfxP5TXUiaeJBW4SSy4T tAYOaxCSkHEEoU0/rNUNDuFc0t4z7L5nsD2OEp1H4sAO7LHSBbuU83NH6Ey4qxJm PBNybPD24etHY0KCFbGaGo+Id0z0lTfU+1QKj6irDrZawnh69V4EwU+mhjVHd86i jCMPZd1SbDQrSJvKF4hHWp2e+D+LjdCaW5If6BaxKQyHEgxAhWpFns20FwzugFIg 63JI+KVPPcxzQ9F7fPbFF8u7txqQsHQEkea1h1PjKRSBTVNbb20= =36L5 -----END PGP SIGNATURE----- Wed Aug 6 17:03:12 UTC 2025 I: Checking whether the package is not for us Wed Aug 6 17:03:12 UTC 2025 I: Starting 1st build on remote node ionos5-amd64.debian.net. Wed Aug 6 17:03:12 UTC 2025 I: Preparing to do remote build '1' on ionos5-amd64.debian.net. Wed Aug 6 17:03:12 UTC 2025 - checking /var/lib/jenkins/offline_nodes if ionos5-amd64.debian.net is marked as down. Wed Aug 6 17:03:12 UTC 2025 - checking via ssh if ionos5-amd64.debian.net is up. removed '/tmp/read-only-fs-test-ERXWrH' ==================================================================================== Tue Sep 8 23:26:13 UTC 2026 - running /srv/jenkins/bin/reproducible_build.sh (for job /srv/jenkins/bin/reproducible_build.sh) on ionos5-amd64, called using "1 libgoby-java trixie /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC 3.3.1+dfsg2-11" as arguments. Tue Sep 8 23:26:13 UTC 2026 - actually running "reproducible_build.sh" (md5sum 44ec6a3142940d5e9a7ab76543d96029) as "/tmp/jenkins-script-rPDQ7M4C" $ git clone https://salsa.debian.org/qa/jenkins.debian.net.git ; more CONTRIBUTING Tue Sep 8 23:26:13 UTC 2026 I: Downloading source for trixie/libgoby-java=3.3.1+dfsg2-11 Reading package lists... NOTICE: 'libgoby-java' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/libgoby-java.git Please use: git clone https://salsa.debian.org/med-team/libgoby-java.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 41.6 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (dsc) [3008 B] Get:2 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (tar) [41.6 MB] Get:3 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (diff) [29.4 kB] Fetched 41.6 MB in 1s (80.6 MB/s) Download complete and in download only mode Reading package lists... NOTICE: 'libgoby-java' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/libgoby-java.git Please use: git clone https://salsa.debian.org/med-team/libgoby-java.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 41.6 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (dsc) [3008 B] Get:2 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (tar) [41.6 MB] Get:3 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (diff) [29.4 kB] Fetched 41.6 MB in 1s (80.6 MB/s) Download complete and in download only mode ============================================================================= Building libgoby-java in trixie on amd64 on ionos5-amd64 now. Date: Tue Sep 8 23:26:14 UTC 2026 Date UTC: Tue Sep 8 23:26:14 UTC 2026 ============================================================================= W: /root/.pbuilderrc does not exist I: Logging to b1/build.log I: pbuilder: network access will be disabled during build I: Current time: Tue Sep 8 11:26:14 -12 2026 I: pbuilder-time-stamp: 1788909974 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [libgoby-java_3.3.1+dfsg2-11.dsc] I: copying [./libgoby-java_3.3.1+dfsg2.orig.tar.xz] I: copying [./libgoby-java_3.3.1+dfsg2-11.debian.tar.xz] I: Extracting source dpkg-source: warning: cannot verify inline signature for ./libgoby-java_3.3.1+dfsg2-11.dsc: no acceptable signature found dpkg-source: info: extracting libgoby-java in libgoby-java-3.3.1+dfsg2 dpkg-source: info: unpacking libgoby-java_3.3.1+dfsg2.orig.tar.xz dpkg-source: info: unpacking libgoby-java_3.3.1+dfsg2-11.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying protoc.patch dpkg-source: info: applying adding_dependencies.patch dpkg-source: info: applying using_jbzip2.patch dpkg-source: info: applying adapting_to_old_fastutil.patch dpkg-source: info: applying using_GeneratedMessageV3.patch dpkg-source: info: applying using_commons-cli.patch dpkg-source: info: applying using_correct_SamReader_api.patch dpkg-source: info: applying inclusions_in_SplitTranscriptsMode.patch dpkg-source: info: applying catch_IOException_LineIterator.patch dpkg-source: info: applying computing_fisher_pvalue_hypergeom.patch dpkg-source: info: applying exclude_not_runnable_tests.patch dpkg-source: info: applying goby_script.patch dpkg-source: info: applying path_of_goby_jar_for_Debian.patch dpkg-source: info: applying jaxb_dependency.patch dpkg-source: info: applying using_pcre2.patch dpkg-source: info: applying omit_test_failing_randomly.patch dpkg-source: info: applying adding_opens_arg_for_tests.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/148101/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' DISTRIBUTION='trixie' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='bc99d0441e3e4105aeab9c12f7429242' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='148101' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/pbuilderrc_6g3v --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b1 --logfile b1/build.log libgoby-java_3.3.1+dfsg2-11.dsc' SUDO_GID='110' SUDO_UID='105' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://213.165.73.152:3128' I: uname -a Linux ionos5-amd64 6.12.33+deb12-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.12.33-1~bpo12+1 (2025-07-09) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 May 12 2025 /bin -> usr/bin I: user script /srv/workspace/pbuilder/148101/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), maven-debian-helper, javahelper, default-jdk, ant, ant-contrib, libjbzip2-java, libcommons-collections3-java, libcommons-configuration-java, libcommons-exec-java, libcommons-io-java, libcommons-lang-java, libcommons-logging-java, libcommons-math-java, libcommons-cli-java, libdistlib-java, liblog4j1.2-java, libexec-maven-plugin-java, libjaxb-api-java, libmaven-assembly-plugin-java, libmaven-antrun-plugin-java, libbuild-helper-maven-plugin-java, libmaven-dependency-plugin-java, libmaven-source-plugin-java, libmaven-javadoc-plugin-java, libprotobuf-java, libhtsjdk-java, libfastutil-java, protobuf-compiler, libjsap-java, libdsiutils-java, libicb-utils-java, libreflections-java, libpj-java, libprotobuf-dev, pkgconf, r-cran-rjava, libeasymock-java, junit4, testng, libpicard-java dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19851 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on maven-debian-helper; however: Package maven-debian-helper is not installed. pbuilder-satisfydepends-dummy depends on javahelper; however: Package javahelper is not installed. pbuilder-satisfydepends-dummy depends on default-jdk; however: Package default-jdk is not installed. pbuilder-satisfydepends-dummy depends on ant; however: Package ant is not installed. pbuilder-satisfydepends-dummy depends on ant-contrib; however: Package ant-contrib is not installed. pbuilder-satisfydepends-dummy depends on libjbzip2-java; however: Package libjbzip2-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-collections3-java; however: Package libcommons-collections3-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-configuration-java; however: Package libcommons-configuration-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-exec-java; however: Package libcommons-exec-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-io-java; however: Package libcommons-io-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-lang-java; however: Package libcommons-lang-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-logging-java; however: Package libcommons-logging-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-math-java; however: Package libcommons-math-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-cli-java; however: Package libcommons-cli-java is not installed. pbuilder-satisfydepends-dummy depends on libdistlib-java; however: Package libdistlib-java is not installed. pbuilder-satisfydepends-dummy depends on liblog4j1.2-java; however: Package liblog4j1.2-java is not installed. pbuilder-satisfydepends-dummy depends on libexec-maven-plugin-java; however: Package libexec-maven-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libjaxb-api-java; however: Package libjaxb-api-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-assembly-plugin-java; however: Package libmaven-assembly-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-antrun-plugin-java; however: Package libmaven-antrun-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libbuild-helper-maven-plugin-java; however: Package libbuild-helper-maven-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-dependency-plugin-java; however: Package libmaven-dependency-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-source-plugin-java; however: Package libmaven-source-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-javadoc-plugin-java; however: Package libmaven-javadoc-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libprotobuf-java; however: Package libprotobuf-java is not installed. pbuilder-satisfydepends-dummy depends on libhtsjdk-java; however: Package libhtsjdk-java is not installed. pbuilder-satisfydepends-dummy depends on libfastutil-java; however: Package libfastutil-java is not installed. pbuilder-satisfydepends-dummy depends on protobuf-compiler; however: Package protobuf-compiler is not installed. pbuilder-satisfydepends-dummy depends on libjsap-java; however: Package libjsap-java is not installed. pbuilder-satisfydepends-dummy depends on libdsiutils-java; however: Package libdsiutils-java is not installed. pbuilder-satisfydepends-dummy depends on libicb-utils-java; however: Package libicb-utils-java is not installed. pbuilder-satisfydepends-dummy depends on libreflections-java; however: Package libreflections-java is not installed. pbuilder-satisfydepends-dummy depends on libpj-java; however: Package libpj-java is not installed. pbuilder-satisfydepends-dummy depends on libprotobuf-dev; however: Package libprotobuf-dev is not installed. pbuilder-satisfydepends-dummy depends on pkgconf; however: Package pkgconf is not installed. pbuilder-satisfydepends-dummy depends on r-cran-rjava; however: Package r-cran-rjava is not installed. pbuilder-satisfydepends-dummy depends on libeasymock-java; however: Package libeasymock-java is not installed. pbuilder-satisfydepends-dummy depends on junit4; however: Package junit4 is not installed. pbuilder-satisfydepends-dummy depends on testng; however: Package testng is not installed. pbuilder-satisfydepends-dummy depends on libpicard-java; however: Package libpicard-java is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: adwaita-icon-theme{a} ant{a} ant-contrib{a} at-spi2-common{a} autoconf{a} automake{a} autopoint{a} autotools-dev{a} binfmt-support{a} bsdextrautils{a} ca-certificates{a} ca-certificates-java{a} dbus{a} dbus-bin{a} dbus-daemon{a} dbus-session-bus-common{a} dbus-system-bus-common{a} dbus-user-session{a} dconf-gsettings-backend{a} dconf-service{a} dctrl-tools{a} debhelper{a} default-jdk{a} default-jdk-headless{a} default-jre{a} default-jre-headless{a} devscripts{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} fastjar{a} file{a} fontconfig{a} fontconfig-config{a} fonts-dejavu-core{a} fonts-dejavu-mono{a} gettext{a} gettext-base{a} gpg{a} gpg-agent{a} gpgconf{a} gpgv{a} groff-base{a} gtk-update-icon-cache{a} hicolor-icon-theme{a} intltool-debian{a} jarwrapper{a} java-common{a} javahelper{a} junit4{a} junit5{a} libactivation-java{a} libaopalliance-java{a} libapache-pom-java{a} libapiguardian-java{a} libapparmor1{a} libarchive-zip-perl{a} libasm-java{a} libasound2-data{a} libasound2t64{a} libassuan9{a} libatinject-jsr330-api-java{a} libatk-bridge2.0-0t64{a} libatk1.0-0t64{a} libatspi2.0-0t64{a} libavahi-client3{a} libavahi-common-data{a} libavahi-common3{a} libb-hooks-op-check-perl{a} libbarclay-java{a} libblas3{a} libbrotli1{a} libbsh-java{a} libbuild-helper-maven-plugin-java{a} libbyte-buddy-java{a} libcairo-gobject2{a} libcairo2{a} libcdi-api-java{a} libclass-method-modifiers-perl{a} libclass-xsaccessor-perl{a} libclone-perl{a} libcloudproviders0{a} libcolord2{a} libcolt-free-java{a} libcom-err2{a} libcommons-beanutils-java{a} libcommons-cli-java{a} libcommons-codec-java{a} libcommons-collections3-java{a} libcommons-collections4-java{a} libcommons-compress-java{a} libcommons-configuration-java{a} libcommons-digester-java{a} libcommons-exec-java{a} libcommons-io-java{a} libcommons-jexl2-java{a} libcommons-lang-java{a} libcommons-lang3-java{a} libcommons-logging-java{a} libcommons-math-java{a} libcommons-math3-java{a} libcommons-parent-java{a} libcommons-text-java{a} libcommons-validator-java{a} libcups2t64{a} libcurl4t64{a} libdatrie1{a} libdbus-1-3{a} libdconf1{a} libdebhelper-perl{a} libdeflate0{a} libdevel-callchecker-perl{a} libdistlib-java{a} libdom4j-java{a} libdoxia-core-java{a} libdoxia-java{a} libdoxia-sitetools-java{a} libdrm-amdgpu1{a} libdrm-common{a} libdrm-intel1{a} libdrm2{a} libdsiutils-java{a} libdynaloader-functions-perl{a} libeasymock-java{a} libedit2{a} libel-api-java{a} libelf1t64{a} libencode-locale-perl{a} libepoxy0{a} liberror-prone-java{a} libexec-maven-plugin-java{a} libexpat1{a} libezmorph-java{a} libfastutil-java{a} libffi8{a} libfile-dirlist-perl{a} libfile-homedir-perl{a} libfile-listing-perl{a} libfile-stripnondeterminism-perl{a} libfile-touch-perl{a} libfile-which-perl{a} libfontconfig1{a} libfreemarker-java{a} libfreetype6{a} libfribidi0{a} libgatk-native-bindings-java{a} libgbm1{a} libgcrypt20{a} libgdk-pixbuf-2.0-0{a} libgdk-pixbuf2.0-common{a} libgeronimo-annotation-1.3-spec-java{a} libgeronimo-interceptor-3.0-spec-java{a} libgfortran5{a} libgif7{a} libgkl-java{a} libgl1{a} libgl1-mesa-dri{a} libglib2.0-0t64{a} libglvnd0{a} libglx-mesa0{a} libglx0{a} libgnutls30t64{a} libgoogle-gson-java{a} libgpg-error0{a} libgraphite2-3{a} libgssapi-krb5-2{a} libgtk-3-0t64{a} libgtk-3-common{a} libguava-java{a} libguice-java{a} libhamcrest-java{a} libharfbuzz0b{a} libhtml-parser-perl{a} libhtml-tagset-perl{a} libhtml-tree-perl{a} libhtsjdk-java{a} libhttp-cookies-perl{a} libhttp-date-perl{a} libhttp-message-perl{a} libhttp-negotiate-perl{a} libhttpclient-java{a} libhttpcore-java{a} libicb-utils-java{a} libice6{a} libicu4j-java{a} libicu76{a} libidn2-0{a} libimport-into-perl{a} libio-html-perl{a} libio-socket-ssl-perl{a} libjansi-java{a} libjavassist-java{a} libjaxb-api-java{a} libjaxen-java{a} libjbig0{a} libjboss-logging-java{a} libjboss-vfs-java{a} libjbzip2-java{a} libjcommander-java{a} libjetty9-java{a} libjoptsimple-java{a} libjpeg62-turbo{a} libjsap-java{a} libjson-java{a} libjsoup-java{a} libjsp-api-java{a} libjsr305-java{a} libjtidy-java{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libksba8{a} liblapack3{a} liblcms2-2{a} libldap2{a} liblerc4{a} liblightcouch-java{a} libllvm19{a} liblog4j1.2-java{a} liblog4j2-java{a} liblogback-java{a} liblwp-mediatypes-perl{a} liblwp-protocol-https-perl{a} libmagic-mgc{a} libmagic1t64{a} libmaven-antrun-plugin-java{a} libmaven-archiver-java{a} libmaven-artifact-transfer-java{a} libmaven-assembly-plugin-java{a} libmaven-clean-plugin-java{a} libmaven-common-artifact-filters-java{a} libmaven-compiler-plugin-java{a} libmaven-dependency-analyzer-java{a} libmaven-dependency-plugin-java{a} libmaven-dependency-tree-java{a} libmaven-file-management-java{a} libmaven-filtering-java{a} libmaven-invoker-java{a} libmaven-jar-plugin-java{a} libmaven-javadoc-plugin-java{a} libmaven-parent-java{a} libmaven-plugin-tools-java{a} libmaven-reporting-api-java{a} libmaven-reporting-exec-java{a} libmaven-reporting-impl-java{a} libmaven-resolver-java{a} libmaven-resources-plugin-java{a} libmaven-shared-incremental-java{a} libmaven-shared-io-java{a} libmaven-shared-utils-java{a} libmaven-site-plugin-java{a} libmaven-source-plugin-java{a} libmaven3-core-java{a} libmbedcrypto16{a} libmbedtls21{a} libmbedx509-7{a} libmodule-runtime-perl{a} libmongodb-java{a} libmoo-perl{a} libncbi-ngs3{a} libncbi-vdb3{a} libnet-http-perl{a} libnet-ssleay-perl{a} libnghttp2-14{a} libnghttp3-9{a} libngs-java{a} libngs-jni{a} libnpth0t64{a} libnspr4{a} libnss3{a} libobjenesis-java{a} libopentest4j-java{a} libopentest4j-reporting-java{a} liboro-java{a} libp11-kit0{a} libpam-systemd{a} libpango-1.0-0{a} libpangocairo-1.0-0{a} libpangoft2-1.0-0{a} libpaper-utils{a} libpaper2{a} libparams-classify-perl{a} libpciaccess0{a} libpcsclite1{a} libpicard-java{a} libpicocli-java{a} libpipeline1{a} libpixman-1-0{a} libpj-java{a} libpkgconf3{a} libplexus-ant-factory-java{a} libplexus-archiver-java{a} libplexus-bsh-factory-java{a} libplexus-build-api-java{a} libplexus-cipher-java{a} libplexus-classworlds-java{a} libplexus-compiler-java{a} libplexus-component-annotations-java{a} libplexus-container-default-java{a} libplexus-container-default1.5-java{a} libplexus-i18n-java{a} libplexus-interactivity-api-java{a} libplexus-interpolation-java{a} libplexus-io-java{a} libplexus-languages-java{a} libplexus-sec-dispatcher-java{a} libplexus-utils2-java{a} libplexus-velocity-java{a} libplexus-xml-java{a} libpng16-16t64{a} libproc2-0{a} libprotobuf-dev{a} libprotobuf-java{a} libprotobuf-lite32t64{a} libprotobuf32t64{a} libprotoc32t64{a} libpsl5t64{a} libpython3-stdlib{a} libpython3.13-minimal{a} libpython3.13-stdlib{a} libqdox2-java{a} libreadline8t64{a} libreflections-java{a} librhino-java{a} librole-tiny-perl{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libsensors-config{a} libsensors5{a} libservlet-api-java{a} libsharpyuv0{a} libsisu-inject-java{a} libsisu-plexus-java{a} libslf4j-java{a} libsm6{a} libsnappy-java{a} libsnappy-jni{a} libsnappy1v5{a} libssh2-1t64{a} libsub-quote-perl{a} libsurefire-java{a} libsystemd-shared{a} libtasn1-6{a} libtcl8.6{a} libtext-charwidth-perl{a} libtext-wrapi18n-perl{a} libthai-data{a} libthai0{a} libtiff6{a} libtimedate-perl{a} libtirpc-common{a} libtirpc3t64{a} libtk8.6{a} libtool{a} libtry-tiny-perl{a} libuchardet0{a} libunistring5{a} libunivocity-parsers-java{a} liburi-perl{a} libvelocity-tools-java{a} libvulkan1{a} libwagon-file-java{a} libwagon-http-java{a} libwagon-provider-api-java{a} libwayland-client0{a} libwayland-cursor0{a} libwayland-egl1{a} libwayland-server0{a} libwebp7{a} libwebsocket-api-java{a} libwww-perl{a} libwww-robotrules-perl{a} libx11-6{a} libx11-data{a} libx11-xcb1{a} libxau6{a} libxbean-reflect-java{a} libxcb-dri3-0{a} libxcb-glx0{a} libxcb-present0{a} libxcb-randr0{a} libxcb-render0{a} libxcb-shm0{a} libxcb-sync1{a} libxcb-xfixes0{a} libxcb1{a} libxcomposite1{a} libxcursor1{a} libxdamage1{a} libxdmcp6{a} libxerces2-java{a} libxext6{a} libxfixes3{a} libxft2{a} libxi6{a} libxinerama1{a} libxkbcommon0{a} libxml-commons-external-java{a} libxml-commons-resolver1.1-java{a} libxml2{a} libxml2-utils{a} libxom-java{a} libxpp3-java{a} libxrandr2{a} libxrender1{a} libxshmfence1{a} libxss1{a} libxstream-java{a} libxt6t64{a} libxtst6{a} libxxf86vm1{a} libxz-java{a} libz3-4{a} m4{a} man-db{a} maven{a} maven-debian-helper{a} maven-repo-helper{a} media-types{a} mesa-libgallium{a} ncbi-vdb-data{a} netbase{a} openjdk-21-jdk{a} openjdk-21-jdk-headless{a} openjdk-21-jre{a} openjdk-21-jre-headless{a} openssl{a} patchutils{a} perl-openssl-defaults{a} pinentry-curses{a} pkgconf{a} pkgconf-bin{a} po-debconf{a} procps{a} protobuf-compiler{a} python3{a} python3-minimal{a} python3.13{a} python3.13-minimal{a} r-base-core{a} r-cran-rjava{a} readline-common{a} sensible-utils{a} sgml-base{a} shared-mime-info{a} sopv-gpgv{a} systemd{a} systemd-sysv{a} testng{a} tzdata{a} ucf{a} unzip{a} velocity{a} wdiff{a} x11-common{a} xdg-utils{a} xkb-data{a} zip{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: alsa-topology-conf alsa-ucm-conf ant-optional at-spi2-core chrony curl debian-keyring debian-tag2upload-keyring dput dput-ng dupload equivs fonts-dejavu-extra gnupg krb5-locales libarchive-cpio-perl libatk-wrapper-java-jni libdata-dump-perl libdistro-info-perl libfile-mimeinfo-perl libgdk-pixbuf2.0-bin libgit-wrapper-perl libgitlab-api-v4-perl libgkl-jni libglib2.0-data libgpg-error-l10n libgtk-3-bin libhtml-form-perl libhtml-format-perl libhttp-daemon-perl libio-compress-brotli-perl libjline3-java libjson-perl libkmod2 libldap-common liblist-compare-perl libltdl-dev libmail-sendmail-perl libmailtools-perl libnamespace-clean-perl libnet-dbus-perl libnss-systemd librsvg2-common libsasl2-modules libsoap-lite-perl libstring-shellquote-perl libx11-protocol-perl libxstring-perl libxt-dev libyaml-snake-java licensecheck lintian linux-sysctl-defaults lynx lzip mesa-vulkan-drivers ntpsec openntpd pristine-tar psmisc publicsuffix python3-apt python3-argcomplete python3-debian python3-magic python3-requests python3-unidiff python3-xdg r-base-dev r-doc-html r-recommended sopv-doc strace systemd-cryptsetup systemd-timesyncd wget x11-utils x11-xserver-utils xdg-user-dirs 0 packages upgraded, 461 newly installed, 0 to remove and 0 not upgraded. Need to get 386 MB of archives. After unpacking 1012 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main amd64 libsystemd-shared amd64 257.7-1 [2151 kB] Get: 2 http://deb.debian.org/debian trixie/main amd64 libapparmor1 amd64 4.1.0-1 [43.7 kB] Get: 3 http://deb.debian.org/debian trixie/main amd64 systemd amd64 257.7-1 [3099 kB] Get: 4 http://deb.debian.org/debian trixie/main amd64 systemd-sysv amd64 257.7-1 [64.2 kB] Get: 5 http://deb.debian.org/debian trixie/main amd64 libdbus-1-3 amd64 1.16.2-2 [178 kB] Get: 6 http://deb.debian.org/debian trixie/main amd64 dbus-bin amd64 1.16.2-2 [80.0 kB] Get: 7 http://deb.debian.org/debian trixie/main amd64 dbus-session-bus-common all 1.16.2-2 [52.3 kB] Get: 8 http://deb.debian.org/debian trixie/main amd64 libexpat1 amd64 2.7.1-2 [108 kB] Get: 9 http://deb.debian.org/debian trixie/main amd64 dbus-daemon amd64 1.16.2-2 [159 kB] Get: 10 http://deb.debian.org/debian trixie/main amd64 dbus-system-bus-common all 1.16.2-2 [53.5 kB] Get: 11 http://deb.debian.org/debian trixie/main amd64 dbus amd64 1.16.2-2 [71.6 kB] Get: 12 http://deb.debian.org/debian trixie/main amd64 libpipeline1 amd64 1.5.8-1 [42.0 kB] Get: 13 http://deb.debian.org/debian trixie/main amd64 binfmt-support amd64 2.2.2-7 [64.3 kB] Get: 14 http://deb.debian.org/debian trixie/main amd64 libpython3.13-minimal amd64 3.13.5-2 [862 kB] Get: 15 http://deb.debian.org/debian trixie/main amd64 python3.13-minimal amd64 3.13.5-2 [2224 kB] Get: 16 http://deb.debian.org/debian trixie/main amd64 python3-minimal amd64 3.13.5-1 [27.2 kB] Get: 17 http://deb.debian.org/debian trixie/main amd64 media-types all 13.0.0 [29.3 kB] Get: 18 http://deb.debian.org/debian trixie/main amd64 netbase all 6.5 [12.4 kB] Get: 19 http://deb.debian.org/debian trixie/main amd64 tzdata all 2025b-4 [260 kB] Get: 20 http://deb.debian.org/debian trixie/main amd64 libffi8 amd64 3.4.8-2 [24.1 kB] Get: 21 http://deb.debian.org/debian trixie/main amd64 readline-common all 8.2-6 [69.4 kB] Get: 22 http://deb.debian.org/debian trixie/main amd64 libreadline8t64 amd64 8.2-6 [169 kB] Get: 23 http://deb.debian.org/debian trixie/main amd64 libpython3.13-stdlib amd64 3.13.5-2 [1956 kB] Get: 24 http://deb.debian.org/debian trixie/main amd64 python3.13 amd64 3.13.5-2 [757 kB] Get: 25 http://deb.debian.org/debian trixie/main amd64 libpython3-stdlib amd64 3.13.5-1 [10.2 kB] Get: 26 http://deb.debian.org/debian trixie/main amd64 python3 amd64 3.13.5-1 [28.2 kB] Get: 27 http://deb.debian.org/debian trixie/main amd64 libproc2-0 amd64 2:4.0.4-9 [65.6 kB] Get: 28 http://deb.debian.org/debian trixie/main amd64 procps amd64 2:4.0.4-9 [882 kB] Get: 29 http://deb.debian.org/debian trixie/main amd64 sensible-utils all 0.0.25 [25.0 kB] Get: 30 http://deb.debian.org/debian trixie/main amd64 openssl amd64 3.5.1-1 [1494 kB] Get: 31 http://deb.debian.org/debian trixie/main amd64 ca-certificates all 20250419 [162 kB] Get: 32 http://deb.debian.org/debian trixie/main amd64 libmagic-mgc amd64 1:5.46-5 [338 kB] Get: 33 http://deb.debian.org/debian trixie/main amd64 libmagic1t64 amd64 1:5.46-5 [109 kB] Get: 34 http://deb.debian.org/debian trixie/main amd64 file amd64 1:5.46-5 [43.6 kB] Get: 35 http://deb.debian.org/debian trixie/main amd64 gettext-base amd64 0.23.1-2 [243 kB] Get: 36 http://deb.debian.org/debian trixie/main amd64 libuchardet0 amd64 0.0.8-1+b2 [68.9 kB] Get: 37 http://deb.debian.org/debian trixie/main amd64 groff-base amd64 1.23.0-9 [1187 kB] Get: 38 http://deb.debian.org/debian trixie/main amd64 libpam-systemd amd64 257.7-1 [297 kB] Get: 39 http://deb.debian.org/debian trixie/main amd64 bsdextrautils amd64 2.41-5 [94.6 kB] Get: 40 http://deb.debian.org/debian trixie/main amd64 man-db amd64 2.13.1-1 [1469 kB] Get: 41 http://deb.debian.org/debian trixie/main amd64 libtext-charwidth-perl amd64 0.04-11+b4 [9476 B] Get: 42 http://deb.debian.org/debian trixie/main amd64 libtext-wrapi18n-perl all 0.06-10 [8808 B] Get: 43 http://deb.debian.org/debian trixie/main amd64 ucf all 3.0052 [43.3 kB] Get: 44 http://deb.debian.org/debian trixie/main amd64 libgdk-pixbuf2.0-common all 2.42.12+dfsg-4 [311 kB] Get: 45 http://deb.debian.org/debian trixie/main amd64 libglib2.0-0t64 amd64 2.84.3-1 [1515 kB] Get: 46 http://deb.debian.org/debian trixie/main amd64 libxml2 amd64 2.12.7+dfsg+really2.9.14-2.1 [698 kB] Get: 47 http://deb.debian.org/debian trixie/main amd64 shared-mime-info amd64 2.4-5+b2 [760 kB] Get: 48 http://deb.debian.org/debian trixie/main amd64 libjpeg62-turbo amd64 1:2.1.5-4 [168 kB] Get: 49 http://deb.debian.org/debian trixie/main amd64 libpng16-16t64 amd64 1.6.48-1 [282 kB] Get: 50 http://deb.debian.org/debian trixie/main amd64 libdeflate0 amd64 1.23-2 [47.3 kB] Get: 51 http://deb.debian.org/debian trixie/main amd64 libjbig0 amd64 2.1-6.1+b2 [32.1 kB] Get: 52 http://deb.debian.org/debian trixie/main amd64 liblerc4 amd64 4.0.0+ds-5 [183 kB] Get: 53 http://deb.debian.org/debian trixie/main amd64 libsharpyuv0 amd64 1.5.0-0.1 [116 kB] Get: 54 http://deb.debian.org/debian trixie/main amd64 libwebp7 amd64 1.5.0-0.1 [318 kB] Get: 55 http://deb.debian.org/debian trixie/main amd64 libtiff6 amd64 4.7.0-3 [346 kB] Get: 56 http://deb.debian.org/debian trixie/main amd64 libgdk-pixbuf-2.0-0 amd64 2.42.12+dfsg-4 [141 kB] Get: 57 http://deb.debian.org/debian trixie/main amd64 gtk-update-icon-cache amd64 4.18.6+ds-2 [52.7 kB] Get: 58 http://deb.debian.org/debian trixie/main amd64 hicolor-icon-theme all 0.18-2 [11.8 kB] Get: 59 http://deb.debian.org/debian trixie/main amd64 adwaita-icon-theme all 48.1-1 [504 kB] Get: 60 http://deb.debian.org/debian trixie/main amd64 ca-certificates-java all 20240118 [11.6 kB] Get: 61 http://deb.debian.org/debian trixie/main amd64 java-common all 0.76 [6776 B] Get: 62 http://deb.debian.org/debian trixie/main amd64 liblcms2-2 amd64 2.16-2 [160 kB] Get: 63 http://deb.debian.org/debian trixie/main amd64 libnspr4 amd64 2:4.36-1 [110 kB] Get: 64 http://deb.debian.org/debian trixie/main amd64 libnss3 amd64 2:3.110-1 [1393 kB] Get: 65 http://deb.debian.org/debian trixie/main amd64 libpcsclite1 amd64 2.3.3-1 [55.2 kB] Get: 66 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jre-headless amd64 21.0.8+9-1 [41.8 MB] Get: 67 http://deb.debian.org/debian trixie/main amd64 default-jre-headless amd64 2:1.21-76 [3192 B] Get: 68 http://deb.debian.org/debian trixie/main amd64 ant all 1.10.15-1 [2163 kB] Get: 69 http://deb.debian.org/debian trixie/main amd64 ant-contrib all 1.0~b3+svn177-12 [262 kB] Get: 70 http://deb.debian.org/debian trixie/main amd64 at-spi2-common all 2.56.2-1 [171 kB] Get: 71 http://deb.debian.org/debian trixie/main amd64 m4 amd64 1.4.19-8 [294 kB] Get: 72 http://deb.debian.org/debian trixie/main amd64 autoconf all 2.72-3.1 [494 kB] Get: 73 http://deb.debian.org/debian trixie/main amd64 autotools-dev all 20240727.1 [60.2 kB] Get: 74 http://deb.debian.org/debian trixie/main amd64 automake all 1:1.17-4 [862 kB] Get: 75 http://deb.debian.org/debian trixie/main amd64 autopoint all 0.23.1-2 [770 kB] Get: 76 http://deb.debian.org/debian trixie/main amd64 dbus-user-session amd64 1.16.2-2 [52.1 kB] Get: 77 http://deb.debian.org/debian trixie/main amd64 libdconf1 amd64 0.40.0-5 [41.8 kB] Get: 78 http://deb.debian.org/debian trixie/main amd64 dconf-service amd64 0.40.0-5 [32.4 kB] Get: 79 http://deb.debian.org/debian trixie/main amd64 dconf-gsettings-backend amd64 0.40.0-5 [28.6 kB] Get: 80 http://deb.debian.org/debian trixie/main amd64 dctrl-tools amd64 2.24-3+b1 [104 kB] Get: 81 http://deb.debian.org/debian trixie/main amd64 libdebhelper-perl all 13.24.2 [90.9 kB] Get: 82 http://deb.debian.org/debian trixie/main amd64 libtool all 2.5.4-4 [539 kB] Get: 83 http://deb.debian.org/debian trixie/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 84 http://deb.debian.org/debian trixie/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 85 http://deb.debian.org/debian trixie/main amd64 libfile-stripnondeterminism-perl all 1.14.1-2 [19.7 kB] Get: 86 http://deb.debian.org/debian trixie/main amd64 dh-strip-nondeterminism all 1.14.1-2 [8620 B] Get: 87 http://deb.debian.org/debian trixie/main amd64 libelf1t64 amd64 0.192-4 [189 kB] Get: 88 http://deb.debian.org/debian trixie/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 89 http://deb.debian.org/debian trixie/main amd64 libunistring5 amd64 1.3-2 [477 kB] Get: 90 http://deb.debian.org/debian trixie/main amd64 gettext amd64 0.23.1-2 [1680 kB] Get: 91 http://deb.debian.org/debian trixie/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 92 http://deb.debian.org/debian trixie/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 93 http://deb.debian.org/debian trixie/main amd64 debhelper all 13.24.2 [919 kB] Get: 94 http://deb.debian.org/debian trixie/main amd64 libatk1.0-0t64 amd64 2.56.2-1 [51.9 kB] Get: 95 http://deb.debian.org/debian trixie/main amd64 libxau6 amd64 1:1.0.11-1 [20.4 kB] Get: 96 http://deb.debian.org/debian trixie/main amd64 libxdmcp6 amd64 1:1.1.5-1 [27.8 kB] Get: 97 http://deb.debian.org/debian trixie/main amd64 libxcb1 amd64 1.17.0-2+b1 [144 kB] Get: 98 http://deb.debian.org/debian trixie/main amd64 libx11-data all 2:1.8.12-1 [343 kB] Get: 99 http://deb.debian.org/debian trixie/main amd64 libx11-6 amd64 2:1.8.12-1 [815 kB] Get: 100 http://deb.debian.org/debian trixie/main amd64 libxext6 amd64 2:1.3.4-1+b3 [50.4 kB] Get: 101 http://deb.debian.org/debian trixie/main amd64 libxi6 amd64 2:1.8.2-1 [78.9 kB] Get: 102 http://deb.debian.org/debian trixie/main amd64 libatspi2.0-0t64 amd64 2.56.2-1 [80.7 kB] Get: 103 http://deb.debian.org/debian trixie/main amd64 libatk-bridge2.0-0t64 amd64 2.56.2-1 [68.5 kB] Get: 104 http://deb.debian.org/debian trixie/main amd64 libbrotli1 amd64 1.1.0-2+b7 [307 kB] Get: 105 http://deb.debian.org/debian trixie/main amd64 libfreetype6 amd64 2.13.3+dfsg-1 [452 kB] Get: 106 http://deb.debian.org/debian trixie/main amd64 fonts-dejavu-mono all 2.37-8 [489 kB] Get: 107 http://deb.debian.org/debian trixie/main amd64 fonts-dejavu-core all 2.37-8 [840 kB] Get: 108 http://deb.debian.org/debian trixie/main amd64 fontconfig-config amd64 2.15.0-2.3 [318 kB] Get: 109 http://deb.debian.org/debian trixie/main amd64 libfontconfig1 amd64 2.15.0-2.3 [392 kB] Get: 110 http://deb.debian.org/debian trixie/main amd64 libpixman-1-0 amd64 0.44.0-3 [248 kB] Get: 111 http://deb.debian.org/debian trixie/main amd64 libxcb-render0 amd64 1.17.0-2+b1 [115 kB] Get: 112 http://deb.debian.org/debian trixie/main amd64 libxcb-shm0 amd64 1.17.0-2+b1 [105 kB] Get: 113 http://deb.debian.org/debian trixie/main amd64 libxrender1 amd64 1:0.9.12-1 [27.9 kB] Get: 114 http://deb.debian.org/debian trixie/main amd64 libcairo2 amd64 1.18.4-1+b1 [538 kB] Get: 115 http://deb.debian.org/debian trixie/main amd64 libcairo-gobject2 amd64 1.18.4-1+b1 [130 kB] Get: 116 http://deb.debian.org/debian trixie/main amd64 libcloudproviders0 amd64 0.3.6-2 [29.2 kB] Get: 117 http://deb.debian.org/debian trixie/main amd64 libcolord2 amd64 1.4.7-3 [139 kB] Get: 118 http://deb.debian.org/debian trixie/main amd64 libavahi-common-data amd64 0.8-16 [112 kB] Get: 119 http://deb.debian.org/debian trixie/main amd64 libavahi-common3 amd64 0.8-16 [44.2 kB] Get: 120 http://deb.debian.org/debian trixie/main amd64 libavahi-client3 amd64 0.8-16 [48.4 kB] Get: 121 http://deb.debian.org/debian trixie/main amd64 libidn2-0 amd64 2.3.8-2 [109 kB] Get: 122 http://deb.debian.org/debian trixie/main amd64 libp11-kit0 amd64 0.25.5-3 [425 kB] Get: 123 http://deb.debian.org/debian trixie/main amd64 libtasn1-6 amd64 4.20.0-2 [49.9 kB] Get: 124 http://deb.debian.org/debian trixie/main amd64 libgnutls30t64 amd64 3.8.9-3 [1465 kB] Get: 125 http://deb.debian.org/debian trixie/main amd64 libkrb5support0 amd64 1.21.3-5 [33.0 kB] Get: 126 http://deb.debian.org/debian trixie/main amd64 libcom-err2 amd64 1.47.2-3+b3 [25.0 kB] Get: 127 http://deb.debian.org/debian trixie/main amd64 libk5crypto3 amd64 1.21.3-5 [81.5 kB] Get: 128 http://deb.debian.org/debian trixie/main amd64 libkeyutils1 amd64 1.6.3-6 [9456 B] Get: 129 http://deb.debian.org/debian trixie/main amd64 libkrb5-3 amd64 1.21.3-5 [326 kB] Get: 130 http://deb.debian.org/debian trixie/main amd64 libgssapi-krb5-2 amd64 1.21.3-5 [138 kB] Get: 131 http://deb.debian.org/debian trixie/main amd64 libcups2t64 amd64 2.4.10-3 [251 kB] Get: 132 http://deb.debian.org/debian trixie/main amd64 libepoxy0 amd64 1.5.10-2 [193 kB] Get: 133 http://deb.debian.org/debian trixie/main amd64 libfribidi0 amd64 1.0.16-1 [26.5 kB] Get: 134 http://deb.debian.org/debian trixie/main amd64 libgraphite2-3 amd64 1.3.14-2+b1 [75.4 kB] Get: 135 http://deb.debian.org/debian trixie/main amd64 libharfbuzz0b amd64 10.2.0-1+b1 [479 kB] Get: 136 http://deb.debian.org/debian trixie/main amd64 fontconfig amd64 2.15.0-2.3 [463 kB] Get: 137 http://deb.debian.org/debian trixie/main amd64 libthai-data all 0.1.29-2 [168 kB] Get: 138 http://deb.debian.org/debian trixie/main amd64 libdatrie1 amd64 0.2.13-3+b1 [38.1 kB] Get: 139 http://deb.debian.org/debian trixie/main amd64 libthai0 amd64 0.1.29-2+b1 [49.4 kB] Get: 140 http://deb.debian.org/debian trixie/main amd64 libpango-1.0-0 amd64 1.56.3-1 [226 kB] Get: 141 http://deb.debian.org/debian trixie/main amd64 libpangoft2-1.0-0 amd64 1.56.3-1 [55.6 kB] Get: 142 http://deb.debian.org/debian trixie/main amd64 libpangocairo-1.0-0 amd64 1.56.3-1 [35.7 kB] Get: 143 http://deb.debian.org/debian trixie/main amd64 libwayland-client0 amd64 1.23.1-3 [26.8 kB] Get: 144 http://deb.debian.org/debian trixie/main amd64 libwayland-cursor0 amd64 1.23.1-3 [11.9 kB] Get: 145 http://deb.debian.org/debian trixie/main amd64 libwayland-egl1 amd64 1.23.1-3 [5860 B] Get: 146 http://deb.debian.org/debian trixie/main amd64 libxcomposite1 amd64 1:0.4.6-1 [16.3 kB] Get: 147 http://deb.debian.org/debian trixie/main amd64 libxfixes3 amd64 1:6.0.0-2+b4 [20.2 kB] Get: 148 http://deb.debian.org/debian trixie/main amd64 libxcursor1 amd64 1:1.2.3-1 [39.7 kB] Get: 149 http://deb.debian.org/debian trixie/main amd64 libxdamage1 amd64 1:1.1.6-1+b2 [15.5 kB] Get: 150 http://deb.debian.org/debian trixie/main amd64 libxinerama1 amd64 2:1.1.4-3+b4 [16.0 kB] Get: 151 http://deb.debian.org/debian trixie/main amd64 xkb-data all 2.42-1 [790 kB] Get: 152 http://deb.debian.org/debian trixie/main amd64 libxkbcommon0 amd64 1.7.0-2 [113 kB] Get: 153 http://deb.debian.org/debian trixie/main amd64 libxrandr2 amd64 2:1.5.4-1+b3 [36.3 kB] Get: 154 http://deb.debian.org/debian trixie/main amd64 libgtk-3-common all 3.24.49-3 [4908 kB] Get: 155 http://deb.debian.org/debian trixie/main amd64 libgtk-3-0t64 amd64 3.24.49-3 [2769 kB] Get: 156 http://deb.debian.org/debian trixie/main amd64 libglvnd0 amd64 1.7.0-1+b2 [52.0 kB] Get: 157 http://deb.debian.org/debian trixie/main amd64 libdrm-common all 2.4.124-2 [8288 B] Get: 158 http://deb.debian.org/debian trixie/main amd64 libdrm2 amd64 2.4.124-2 [39.0 kB] Get: 159 http://deb.debian.org/debian trixie/main amd64 libx11-xcb1 amd64 2:1.8.12-1 [247 kB] Get: 160 http://deb.debian.org/debian trixie/main amd64 libxcb-dri3-0 amd64 1.17.0-2+b1 [107 kB] Get: 161 http://deb.debian.org/debian trixie/main amd64 libxcb-glx0 amd64 1.17.0-2+b1 [122 kB] Get: 162 http://deb.debian.org/debian trixie/main amd64 libxcb-present0 amd64 1.17.0-2+b1 [106 kB] Get: 163 http://deb.debian.org/debian trixie/main amd64 libxcb-xfixes0 amd64 1.17.0-2+b1 [109 kB] Get: 164 http://deb.debian.org/debian trixie/main amd64 libxxf86vm1 amd64 1:1.1.4-1+b4 [19.3 kB] Get: 165 http://deb.debian.org/debian trixie/main amd64 libdrm-amdgpu1 amd64 2.4.124-2 [22.6 kB] Get: 166 http://deb.debian.org/debian trixie/main amd64 libpciaccess0 amd64 0.17-3+b3 [51.9 kB] Get: 167 http://deb.debian.org/debian trixie/main amd64 libdrm-intel1 amd64 2.4.124-2 [64.1 kB] Get: 168 http://deb.debian.org/debian trixie/main amd64 libedit2 amd64 3.1-20250104-1 [93.8 kB] Get: 169 http://deb.debian.org/debian trixie/main amd64 libz3-4 amd64 4.13.3-1 [8560 kB] Get: 170 http://deb.debian.org/debian trixie/main amd64 libllvm19 amd64 1:19.1.7-3+b1 [26.0 MB] Get: 171 http://deb.debian.org/debian trixie/main amd64 libsensors-config all 1:3.6.2-2 [16.2 kB] Get: 172 http://deb.debian.org/debian trixie/main amd64 libsensors5 amd64 1:3.6.2-2 [37.5 kB] Get: 173 http://deb.debian.org/debian trixie/main amd64 libxcb-randr0 amd64 1.17.0-2+b1 [117 kB] Get: 174 http://deb.debian.org/debian trixie/main amd64 libxcb-sync1 amd64 1.17.0-2+b1 [109 kB] Get: 175 http://deb.debian.org/debian trixie/main amd64 libxshmfence1 amd64 1.3.3-1 [10.9 kB] Get: 176 http://deb.debian.org/debian trixie/main amd64 mesa-libgallium amd64 25.0.7-2 [9629 kB] Get: 177 http://deb.debian.org/debian trixie/main amd64 libwayland-server0 amd64 1.23.1-3 [34.4 kB] Get: 178 http://deb.debian.org/debian trixie/main amd64 libgbm1 amd64 25.0.7-2 [44.4 kB] Get: 179 http://deb.debian.org/debian trixie/main amd64 libvulkan1 amd64 1.4.309.0-1 [130 kB] Get: 180 http://deb.debian.org/debian trixie/main amd64 libgl1-mesa-dri amd64 25.0.7-2 [46.1 kB] Get: 181 http://deb.debian.org/debian trixie/main amd64 libglx-mesa0 amd64 25.0.7-2 [143 kB] Get: 182 http://deb.debian.org/debian trixie/main amd64 libglx0 amd64 1.7.0-1+b2 [34.9 kB] Get: 183 http://deb.debian.org/debian trixie/main amd64 libgl1 amd64 1.7.0-1+b2 [89.5 kB] Get: 184 http://deb.debian.org/debian trixie/main amd64 libasound2-data all 1.2.14-1 [21.1 kB] Get: 185 http://deb.debian.org/debian trixie/main amd64 libasound2t64 amd64 1.2.14-1 [381 kB] Get: 186 http://deb.debian.org/debian trixie/main amd64 libgif7 amd64 5.2.2-1+b1 [44.2 kB] Get: 187 http://deb.debian.org/debian trixie/main amd64 x11-common all 1:7.7+24 [217 kB] Get: 188 http://deb.debian.org/debian trixie/main amd64 libxtst6 amd64 2:1.2.5-1 [25.8 kB] Get: 189 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jre amd64 21.0.8+9-1 [205 kB] Get: 190 http://deb.debian.org/debian trixie/main amd64 default-jre amd64 2:1.21-76 [1068 B] Get: 191 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jdk-headless amd64 21.0.8+9-1 [82.9 MB] Get: 192 http://deb.debian.org/debian trixie/main amd64 default-jdk-headless amd64 2:1.21-76 [1124 B] Get: 193 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jdk amd64 21.0.8+9-1 [3624 kB] Get: 194 http://deb.debian.org/debian trixie/main amd64 default-jdk amd64 2:1.21-76 [1076 B] Get: 195 http://deb.debian.org/debian trixie/main amd64 libgpg-error0 amd64 1.51-4 [82.1 kB] Get: 196 http://deb.debian.org/debian trixie/main amd64 libassuan9 amd64 3.0.2-2 [61.5 kB] Get: 197 http://deb.debian.org/debian trixie/main amd64 libgcrypt20 amd64 1.11.0-7 [843 kB] Get: 198 http://deb.debian.org/debian trixie/main amd64 gpgconf amd64 2.4.7-21+b3 [129 kB] Get: 199 http://deb.debian.org/debian trixie/main amd64 libksba8 amd64 1.6.7-2+b1 [136 kB] Get: 200 http://deb.debian.org/debian trixie/main amd64 libnpth0t64 amd64 1.8-3 [23.2 kB] Get: 201 http://deb.debian.org/debian trixie/main amd64 gpg amd64 2.4.7-21+b3 [634 kB] Get: 202 http://deb.debian.org/debian trixie/main amd64 pinentry-curses amd64 1.3.1-2 [86.4 kB] Get: 203 http://deb.debian.org/debian trixie/main amd64 gpg-agent amd64 2.4.7-21+b3 [271 kB] Get: 204 http://deb.debian.org/debian trixie/main amd64 libfile-dirlist-perl all 0.05-3 [7600 B] Get: 205 http://deb.debian.org/debian trixie/main amd64 libfile-which-perl all 1.27-2 [15.1 kB] Get: 206 http://deb.debian.org/debian trixie/main amd64 libfile-homedir-perl all 1.006-2 [42.4 kB] Get: 207 http://deb.debian.org/debian trixie/main amd64 libfile-touch-perl all 0.12-2 [8816 B] Get: 208 http://deb.debian.org/debian trixie/main amd64 libclass-method-modifiers-perl all 2.15-1 [18.0 kB] Get: 209 http://deb.debian.org/debian trixie/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b5 [36.1 kB] Get: 210 http://deb.debian.org/debian trixie/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b2 [10.6 kB] Get: 211 http://deb.debian.org/debian trixie/main amd64 libdynaloader-functions-perl all 0.004-2 [12.2 kB] Get: 212 http://deb.debian.org/debian trixie/main amd64 libdevel-callchecker-perl amd64 0.009-2 [15.6 kB] Get: 213 http://deb.debian.org/debian trixie/main amd64 libparams-classify-perl amd64 0.015-2+b4 [22.5 kB] Get: 214 http://deb.debian.org/debian trixie/main amd64 libmodule-runtime-perl all 0.018-1 [17.8 kB] Get: 215 http://deb.debian.org/debian trixie/main amd64 libimport-into-perl all 1.002005-2 [11.3 kB] Get: 216 http://deb.debian.org/debian trixie/main amd64 librole-tiny-perl all 2.002004-1 [21.4 kB] Get: 217 http://deb.debian.org/debian trixie/main amd64 libsub-quote-perl all 2.006008-1 [21.8 kB] Get: 218 http://deb.debian.org/debian trixie/main amd64 libmoo-perl all 2.005005-1 [58.0 kB] Get: 219 http://deb.debian.org/debian trixie/main amd64 libencode-locale-perl all 1.05-3 [12.9 kB] Get: 220 http://deb.debian.org/debian trixie/main amd64 libtimedate-perl all 2.3300-2 [39.3 kB] Get: 221 http://deb.debian.org/debian trixie/main amd64 libhttp-date-perl all 6.06-1 [10.7 kB] Get: 222 http://deb.debian.org/debian trixie/main amd64 libfile-listing-perl all 6.16-1 [12.4 kB] Get: 223 http://deb.debian.org/debian trixie/main amd64 libhtml-tagset-perl all 3.24-1 [14.7 kB] Get: 224 http://deb.debian.org/debian trixie/main amd64 liburi-perl all 5.30-1 [105 kB] Get: 225 http://deb.debian.org/debian trixie/main amd64 libhtml-parser-perl amd64 3.83-1+b2 [99.7 kB] Get: 226 http://deb.debian.org/debian trixie/main amd64 libhtml-tree-perl all 5.07-3 [211 kB] Get: 227 http://deb.debian.org/debian trixie/main amd64 libclone-perl amd64 0.47-1+b1 [13.9 kB] Get: 228 http://deb.debian.org/debian trixie/main amd64 libio-html-perl all 1.004-3 [16.2 kB] Get: 229 http://deb.debian.org/debian trixie/main amd64 liblwp-mediatypes-perl all 6.04-2 [20.2 kB] Get: 230 http://deb.debian.org/debian trixie/main amd64 libhttp-message-perl all 7.00-2 [79.8 kB] Get: 231 http://deb.debian.org/debian trixie/main amd64 libhttp-cookies-perl all 6.11-1 [19.1 kB] Get: 232 http://deb.debian.org/debian trixie/main amd64 libhttp-negotiate-perl all 6.01-2 [13.1 kB] Get: 233 http://deb.debian.org/debian trixie/main amd64 perl-openssl-defaults amd64 7+b2 [6724 B] Get: 234 http://deb.debian.org/debian trixie/main amd64 libnet-ssleay-perl amd64 1.94-3 [339 kB] Get: 235 http://deb.debian.org/debian trixie/main amd64 libio-socket-ssl-perl all 2.089-1 [223 kB] Get: 236 http://deb.debian.org/debian trixie/main amd64 libnet-http-perl all 6.23-1 [23.9 kB] Get: 237 http://deb.debian.org/debian trixie/main amd64 liblwp-protocol-https-perl all 6.14-1 [10.8 kB] Get: 238 http://deb.debian.org/debian trixie/main amd64 libtry-tiny-perl all 0.32-1 [22.9 kB] Get: 239 http://deb.debian.org/debian trixie/main amd64 libwww-robotrules-perl all 6.02-1 [12.9 kB] Get: 240 http://deb.debian.org/debian trixie/main amd64 libwww-perl all 6.78-1 [183 kB] Get: 241 http://deb.debian.org/debian trixie/main amd64 patchutils amd64 0.4.2-1 [77.5 kB] Get: 242 http://deb.debian.org/debian trixie/main amd64 gpgv amd64 2.4.7-21+b3 [241 kB] Get: 243 http://deb.debian.org/debian trixie/main amd64 sopv-gpgv all 0.1.4-1 [11.3 kB] Get: 244 http://deb.debian.org/debian trixie/main amd64 wdiff amd64 1.2.2-9 [122 kB] Get: 245 http://deb.debian.org/debian trixie/main amd64 devscripts all 2.25.15 [1067 kB] Get: 246 http://deb.debian.org/debian trixie/main amd64 fastjar amd64 2:0.98-7 [80.1 kB] Get: 247 http://deb.debian.org/debian trixie/main amd64 jarwrapper all 0.80 [9692 B] Get: 248 http://deb.debian.org/debian trixie/main amd64 javahelper all 0.80 [80.4 kB] Get: 249 http://deb.debian.org/debian trixie/main amd64 libhamcrest-java all 2.2-2 [121 kB] Get: 250 http://deb.debian.org/debian trixie/main amd64 junit4 all 4.13.2-5 [350 kB] Get: 251 http://deb.debian.org/debian trixie/main amd64 libapiguardian-java all 1.1.2-1 [4656 B] Get: 252 http://deb.debian.org/debian trixie/main amd64 libopentest4j-java all 1.2.0-4 [9516 B] Get: 253 http://deb.debian.org/debian trixie/main amd64 libopentest4j-reporting-java all 0.1.0-M1-2 [49.0 kB] Get: 254 http://deb.debian.org/debian trixie/main amd64 libpicocli-java all 4.6.2-2 [390 kB] Get: 255 http://deb.debian.org/debian trixie/main amd64 libunivocity-parsers-java all 2.9.1-1 [397 kB] Get: 256 http://deb.debian.org/debian trixie/main amd64 junit5 all 5.10.3-1 [2459 kB] Get: 257 http://deb.debian.org/debian trixie/main amd64 libactivation-java all 1.2.0-2 [84.7 kB] Get: 258 http://deb.debian.org/debian trixie/main amd64 libaopalliance-java all 20070526-7 [8572 B] Get: 259 http://deb.debian.org/debian trixie/main amd64 libapache-pom-java all 33-2 [5852 B] Get: 260 http://deb.debian.org/debian trixie/main amd64 libasm-java all 9.8-1 [392 kB] Get: 261 http://deb.debian.org/debian trixie/main amd64 libatinject-jsr330-api-java all 1.0+ds1-6 [5112 B] Get: 262 http://deb.debian.org/debian trixie/main amd64 libcommons-parent-java all 56-1 [10.8 kB] Get: 263 http://deb.debian.org/debian trixie/main amd64 libcommons-lang3-java all 3.17.0-1 [641 kB] Get: 264 http://deb.debian.org/debian trixie/main amd64 libfreemarker-java all 2.3.32-2.1 [1525 kB] Get: 265 http://deb.debian.org/debian trixie/main amd64 libgoogle-gson-java all 2.10.1-1 [262 kB] Get: 266 http://deb.debian.org/debian trixie/main amd64 libjoptsimple-java all 5.0.4-7 [73.7 kB] Get: 267 http://deb.debian.org/debian trixie/main amd64 libcommons-codec-java all 1.18.0-1 [304 kB] Get: 268 http://deb.debian.org/debian trixie/main amd64 libcommons-logging-java all 1.3.0-2 [68.6 kB] Get: 269 http://deb.debian.org/debian trixie/main amd64 libhttpcore-java all 4.4.16-1 [636 kB] Get: 270 http://deb.debian.org/debian trixie/main amd64 libhttpclient-java all 4.5.14-1 [1247 kB] Get: 271 http://deb.debian.org/debian trixie/main amd64 liblightcouch-java all 0.2.0-1 [75.0 kB] Get: 272 http://deb.debian.org/debian trixie/main amd64 libmongodb-java all 3.6.3-2 [1901 kB] Get: 273 http://deb.debian.org/debian trixie/main amd64 libslf4j-java all 1.7.32-2 [142 kB] Get: 274 http://deb.debian.org/debian trixie/main amd64 liblog4j2-java all 2.19.0-2 [2310 kB] Get: 275 http://deb.debian.org/debian trixie/main amd64 libbarclay-java all 5.0.0+dfsg-1 [108 kB] Get: 276 http://deb.debian.org/debian trixie/main amd64 libblas3 amd64 3.12.1-4 [160 kB] Get: 277 http://deb.debian.org/debian trixie/main amd64 libbsh-java all 2.0b4-20 [291 kB] Get: 278 http://deb.debian.org/debian trixie/main amd64 libcommons-io-java all 2.19.0-1 [524 kB] Get: 279 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-utils-java all 3.4.2-1 [137 kB] Get: 280 http://deb.debian.org/debian trixie/main amd64 libcommons-cli-java all 1.6.0-1 [60.4 kB] Get: 281 http://deb.debian.org/debian trixie/main amd64 libgeronimo-annotation-1.3-spec-java all 1.3-1 [11.1 kB] Get: 282 http://deb.debian.org/debian trixie/main amd64 liberror-prone-java all 2.18.0-1 [22.5 kB] Get: 283 http://deb.debian.org/debian trixie/main amd64 libjsr305-java all 0.1~+svn49-12 [26.6 kB] Get: 284 http://deb.debian.org/debian trixie/main amd64 libguava-java all 32.0.1-1 [2708 kB] Get: 285 http://deb.debian.org/debian trixie/main amd64 libguice-java all 5.1.0-1 [932 kB] Get: 286 http://deb.debian.org/debian trixie/main amd64 libmaven-parent-java all 43-2 [6252 B] Get: 287 http://deb.debian.org/debian trixie/main amd64 libplexus-utils2-java all 3.4.2-1 [258 kB] Get: 288 http://deb.debian.org/debian trixie/main amd64 libwagon-provider-api-java all 3.5.3-2 [48.3 kB] Get: 289 http://deb.debian.org/debian trixie/main amd64 libmaven-resolver-java all 1.9.22-1 [729 kB] Get: 290 http://deb.debian.org/debian trixie/main amd64 libplexus-cipher-java all 2.0-1 [14.9 kB] Get: 291 http://deb.debian.org/debian trixie/main amd64 libplexus-classworlds-java all 2.7.0-1 [50.6 kB] Get: 292 http://deb.debian.org/debian trixie/main amd64 libplexus-component-annotations-java all 2.1.1-1 [7660 B] Get: 293 http://deb.debian.org/debian trixie/main amd64 libplexus-interpolation-java all 1.27-1 [76.8 kB] Get: 294 http://deb.debian.org/debian trixie/main amd64 libplexus-sec-dispatcher-java all 2.0-3 [28.3 kB] Get: 295 http://deb.debian.org/debian trixie/main amd64 libgeronimo-interceptor-3.0-spec-java all 1.0.1-5 [8444 B] Get: 296 http://deb.debian.org/debian trixie/main amd64 libcdi-api-java all 1.2-4 [55.3 kB] Get: 297 http://deb.debian.org/debian trixie/main amd64 libsisu-inject-java all 0.3.5-1 [352 kB] Get: 298 http://deb.debian.org/debian trixie/main amd64 libsisu-plexus-java all 0.3.5-1 [183 kB] Get: 299 http://deb.debian.org/debian trixie/main amd64 libmaven3-core-java all 3.9.9-1 [1661 kB] Get: 300 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-io-java all 3.0.0-4 [33.2 kB] Get: 301 http://deb.debian.org/debian trixie/main amd64 libmaven-file-management-java all 3.0.0-2 [35.1 kB] Get: 302 http://deb.debian.org/debian trixie/main amd64 libbuild-helper-maven-plugin-java all 3.3.0-1 [59.5 kB] Get: 303 http://deb.debian.org/debian trixie/main amd64 libbyte-buddy-java all 1.14.19-1 [4756 kB] Get: 304 http://deb.debian.org/debian trixie/main amd64 libcolt-free-java all 1.2.0+dfsg-8 [440 kB] Get: 305 http://deb.debian.org/debian trixie/main amd64 libcommons-collections3-java all 3.2.2-3 [530 kB] Get: 306 http://deb.debian.org/debian trixie/main amd64 libcommons-beanutils-java all 1.10.1-1.1 [231 kB] Get: 307 http://deb.debian.org/debian trixie/main amd64 libcommons-collections4-java all 4.4-2 [682 kB] Get: 308 http://deb.debian.org/debian trixie/main amd64 libcommons-compress-java all 1.27.1-2 [641 kB] Get: 309 http://deb.debian.org/debian trixie/main amd64 libcommons-lang-java all 2.6-10 [273 kB] Get: 310 http://deb.debian.org/debian trixie/main amd64 libcommons-configuration-java all 1.10-7 [348 kB] Get: 311 http://deb.debian.org/debian trixie/main amd64 libcommons-digester-java all 1.8.1-7 [138 kB] Get: 312 http://deb.debian.org/debian trixie/main amd64 libcommons-exec-java all 1.3-3 [48.4 kB] Get: 313 http://deb.debian.org/debian trixie/main amd64 libcommons-jexl2-java all 2.1.1-6 [256 kB] Get: 314 http://deb.debian.org/debian trixie/main amd64 libcommons-math-java all 2.2-9 [933 kB] Get: 315 http://deb.debian.org/debian trixie/main amd64 libcommons-math3-java all 3.6.1-4 [2040 kB] Get: 316 http://deb.debian.org/debian trixie/main amd64 libplexus-io-java all 3.3.1-2 [65.3 kB] Get: 317 http://deb.debian.org/debian trixie/main amd64 libsnappy1v5 amd64 1.2.2-1 [29.3 kB] Get: 318 http://deb.debian.org/debian trixie/main amd64 libsnappy-jni amd64 1.1.10.7-1 [6492 B] Get: 319 http://deb.debian.org/debian trixie/main amd64 libsnappy-java all 1.1.10.7-1 [87.6 kB] Get: 320 http://deb.debian.org/debian trixie/main amd64 libxz-java all 1.9-1 [143 kB] Get: 321 http://deb.debian.org/debian trixie/main amd64 libplexus-archiver-java all 4.6.1-1 [187 kB] Get: 322 http://deb.debian.org/debian trixie/main amd64 libmaven-archiver-java all 3.6.2-1 [26.1 kB] Get: 323 http://deb.debian.org/debian trixie/main amd64 libmaven-jar-plugin-java all 3.3.0-2 [24.0 kB] Get: 324 http://deb.debian.org/debian trixie/main amd64 libcommons-text-java all 1.13.1-1 [228 kB] Get: 325 http://deb.debian.org/debian trixie/main amd64 sgml-base all 1.31+nmu1 [10.9 kB] Get: 326 http://deb.debian.org/debian trixie/main amd64 libcommons-validator-java all 1:1.9.0-1 [191 kB] Get: 327 http://deb.debian.org/debian trixie/main amd64 libsasl2-modules-db amd64 2.1.28+dfsg1-9 [19.8 kB] Get: 328 http://deb.debian.org/debian trixie/main amd64 libsasl2-2 amd64 2.1.28+dfsg1-9 [57.5 kB] Get: 329 http://deb.debian.org/debian trixie/main amd64 libldap2 amd64 2.6.10+dfsg-1 [194 kB] Get: 330 http://deb.debian.org/debian trixie/main amd64 libnghttp2-14 amd64 1.64.0-1.1 [76.0 kB] Get: 331 http://deb.debian.org/debian trixie/main amd64 libnghttp3-9 amd64 1.8.0-1 [67.7 kB] Get: 332 http://deb.debian.org/debian trixie/main amd64 libpsl5t64 amd64 0.21.2-1.1+b1 [57.2 kB] Get: 333 http://deb.debian.org/debian trixie/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2+b5 [58.8 kB] Get: 334 http://deb.debian.org/debian trixie/main amd64 libssh2-1t64 amd64 1.11.1-1 [245 kB] Get: 335 http://deb.debian.org/debian trixie/main amd64 libcurl4t64 amd64 8.14.1-2 [391 kB] Get: 336 http://deb.debian.org/debian trixie/main amd64 libdistlib-java all 1.0-5 [72.5 kB] Get: 337 http://deb.debian.org/debian trixie/main amd64 libjaxen-java all 1.1.6-5 [214 kB] Get: 338 http://deb.debian.org/debian trixie/main amd64 libdom4j-java all 2.1.4-1 [312 kB] Get: 339 http://deb.debian.org/debian trixie/main amd64 libdoxia-core-java all 2.0.0-1 [149 kB] Get: 340 http://deb.debian.org/debian trixie/main amd64 libplexus-xml-java all 3.0.1-2 [93.7 kB] Get: 341 http://deb.debian.org/debian trixie/main amd64 libdoxia-java all 2.0.0-1 [113 kB] Get: 342 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-api-java all 4.0.0-1 [6724 B] Get: 343 http://deb.debian.org/debian trixie/main amd64 libxbean-reflect-java all 4.5-9 [132 kB] Get: 344 http://deb.debian.org/debian trixie/main amd64 libplexus-container-default-java all 2.1.1-1 [193 kB] Get: 345 http://deb.debian.org/debian trixie/main amd64 libplexus-i18n-java all 1.0-beta-10-6 [13.4 kB] Get: 346 http://deb.debian.org/debian trixie/main amd64 velocity all 1.7-7 [431 kB] Get: 347 http://deb.debian.org/debian trixie/main amd64 libplexus-velocity-java all 1.2-4 [9676 B] Get: 348 http://deb.debian.org/debian trixie/main amd64 liboro-java all 2.0.8a-15 [69.3 kB] Get: 349 http://deb.debian.org/debian trixie/main amd64 libvelocity-tools-java all 2.0-9 [311 kB] Get: 350 http://deb.debian.org/debian trixie/main amd64 libdoxia-sitetools-java all 2.0.0-1 [176 kB] Get: 351 http://deb.debian.org/debian trixie/main amd64 libfastutil-java all 8.5.15+dfsg-1 [20.0 MB] Get: 352 http://deb.debian.org/debian trixie/main amd64 libxpp3-java all 1.1.4c-4 [294 kB] Get: 353 http://deb.debian.org/debian trixie/main amd64 libxstream-java all 1.4.21-1 [567 kB] Get: 354 http://deb.debian.org/debian trixie/main amd64 libjsap-java all 2.1-5 [102 kB] Get: 355 http://deb.debian.org/debian trixie/main amd64 liblogback-java all 1:1.2.11-6 [701 kB] Get: 356 http://deb.debian.org/debian trixie/main amd64 libdsiutils-java all 2.7.3+dfsg-1 [524 kB] Get: 357 http://deb.debian.org/debian trixie/main amd64 libobjenesis-java all 3.4-2 [41.3 kB] Get: 358 http://deb.debian.org/debian trixie/main amd64 libeasymock-java all 5.5.0-1 [134 kB] Get: 359 http://deb.debian.org/debian trixie/main amd64 libel-api-java all 3.0.0-3 [64.9 kB] Get: 360 http://deb.debian.org/debian trixie/main amd64 libexec-maven-plugin-java all 3.1.0-2 [66.7 kB] Get: 361 http://deb.debian.org/debian trixie/main amd64 libezmorph-java all 1.0.6-4 [75.9 kB] Get: 362 http://deb.debian.org/debian trixie/main amd64 libgatk-native-bindings-java all 1.0.0+dfsg-2 [8024 B] Get: 363 http://deb.debian.org/debian trixie/main amd64 libgfortran5 amd64 14.2.0-19 [836 kB] Get: 364 http://deb.debian.org/debian trixie/main amd64 libxml-commons-external-java all 1.4.01-6 [240 kB] Get: 365 http://deb.debian.org/debian trixie/main amd64 libxml-commons-resolver1.1-java all 1.2-11 [98.3 kB] Get: 366 http://deb.debian.org/debian trixie/main amd64 libxerces2-java all 2.12.2-1 [1440 kB] Get: 367 http://deb.debian.org/debian trixie/main amd64 libxom-java all 1.3.9-1 [174 kB] Get: 368 http://deb.debian.org/debian trixie/main amd64 libjson-java all 3.1.0+dfsg-2 [142 kB] Get: 369 http://deb.debian.org/debian trixie/main amd64 libmbedcrypto16 amd64 3.6.4-2 [360 kB] Get: 370 http://deb.debian.org/debian trixie/main amd64 libmbedx509-7 amd64 3.6.4-2 [151 kB] Get: 371 http://deb.debian.org/debian trixie/main amd64 libmbedtls21 amd64 3.6.4-2 [242 kB] Get: 372 http://deb.debian.org/debian trixie/main amd64 ncbi-vdb-data all 3.2.1+dfsg-2 [88.5 kB] Get: 373 http://deb.debian.org/debian trixie/main amd64 libncbi-vdb3 amd64 3.2.1+dfsg-2 [1164 kB] Get: 374 http://deb.debian.org/debian trixie/main amd64 libncbi-ngs3 amd64 3.2.1+dfsg-4 [159 kB] Get: 375 http://deb.debian.org/debian trixie/main amd64 libngs-jni amd64 3.2.1+dfsg-4 [27.7 kB] Get: 376 http://deb.debian.org/debian trixie/main amd64 libngs-java amd64 3.2.1+dfsg-4 [114 kB] Get: 377 http://deb.debian.org/debian trixie/main amd64 librhino-java all 1.7.15-1 [1382 kB] Get: 378 http://deb.debian.org/debian trixie/main amd64 libhtsjdk-java all 4.1.3+dfsg-2 [1841 kB] Get: 379 http://deb.debian.org/debian trixie/main amd64 libgkl-java all 0.8.11+dfsg-2 [24.7 kB] Get: 380 http://deb.debian.org/debian trixie/main amd64 libicu4j-java all 73.2-1 [16.4 MB] Get: 381 http://deb.debian.org/debian trixie/main amd64 liblog4j1.2-java all 1.2.17-11 [444 kB] Get: 382 http://deb.debian.org/debian trixie/main amd64 libicb-utils-java all 2.0.1+git20161002.afee1d9-5 [81.5 kB] Get: 383 http://deb.debian.org/debian trixie/main amd64 libice6 amd64 2:1.1.1-1 [65.4 kB] Get: 384 http://deb.debian.org/debian trixie/main amd64 libicu76 amd64 76.1-4 [9722 kB] Get: 385 http://deb.debian.org/debian trixie/main amd64 libjansi-java all 2.4.1-2 [100 kB] Get: 386 http://deb.debian.org/debian trixie/main amd64 libjavassist-java all 1:3.27.0-1 [731 kB] Get: 387 http://deb.debian.org/debian trixie/main amd64 libjaxb-api-java all 2.3.1-1 [119 kB] Get: 388 http://deb.debian.org/debian trixie/main amd64 libjboss-logging-java all 3.5.3-1 [56.2 kB] Get: 389 http://deb.debian.org/debian trixie/main amd64 libjboss-vfs-java all 3.2.15.Final-3 [130 kB] Get: 390 http://deb.debian.org/debian trixie/main amd64 libjbzip2-java all 0.9.1-8 [42.7 kB] Get: 391 http://deb.debian.org/debian trixie/main amd64 libjcommander-java all 1.71-4 [73.0 kB] Get: 392 http://deb.debian.org/debian trixie/main amd64 libjsp-api-java all 2.3.4-3 [53.7 kB] Get: 393 http://deb.debian.org/debian trixie/main amd64 libservlet-api-java all 4.0.1-2 [81.0 kB] Get: 394 http://deb.debian.org/debian trixie/main amd64 libwebsocket-api-java all 1.1-2 [40.1 kB] Get: 395 http://deb.debian.org/debian trixie/main amd64 libjetty9-java all 9.4.57-1 [2965 kB] Get: 396 http://deb.debian.org/debian trixie/main amd64 libjsoup-java all 1.15.3-1 [431 kB] Get: 397 http://deb.debian.org/debian trixie/main amd64 libjtidy-java all 7+svn20110807-6 [251 kB] Get: 398 http://deb.debian.org/debian trixie/main amd64 liblapack3 amd64 3.12.1-4 [2447 kB] Get: 399 http://deb.debian.org/debian trixie/main amd64 libmaven-antrun-plugin-java all 3.1.0-1 [36.9 kB] Get: 400 http://deb.debian.org/debian trixie/main amd64 libmaven-common-artifact-filters-java all 3.4.0-1 [47.7 kB] Get: 401 http://deb.debian.org/debian trixie/main amd64 libmaven-artifact-transfer-java all 0.13.1-3 [158 kB] Get: 402 http://deb.debian.org/debian trixie/main amd64 libplexus-build-api-java all 0.0.7-4 [10.3 kB] Get: 403 http://deb.debian.org/debian trixie/main amd64 libmaven-filtering-java all 3.4.0-1 [51.4 kB] Get: 404 http://deb.debian.org/debian trixie/main amd64 libmaven-assembly-plugin-java all 3.4.2-2 [242 kB] Get: 405 http://deb.debian.org/debian trixie/main amd64 libmaven-clean-plugin-java all 3.2.0-2 [32.2 kB] Get: 406 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-incremental-java all 1.1-6 [9916 B] Get: 407 http://deb.debian.org/debian trixie/main amd64 libplexus-compiler-java all 2.13.0-1 [99.5 kB] Get: 408 http://deb.debian.org/debian trixie/main amd64 libqdox2-java all 2.0.3-1 [296 kB] Get: 409 http://deb.debian.org/debian trixie/main amd64 libplexus-languages-java all 1.1.1-3 [47.8 kB] Get: 410 http://deb.debian.org/debian trixie/main amd64 libmaven-compiler-plugin-java all 3.13.0-1 [78.8 kB] Get: 411 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-analyzer-java all 1.15.1-1 [38.5 kB] Get: 412 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-tree-java all 3.3.0-1 [35.0 kB] Get: 413 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-impl-java all 4.0.0-1 [17.6 kB] Get: 414 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-plugin-java all 3.8.1-1 [191 kB] Get: 415 http://deb.debian.org/debian trixie/main amd64 libmaven-invoker-java all 3.3.0-1 [29.1 kB] Get: 416 http://deb.debian.org/debian trixie/main amd64 libplexus-interactivity-api-java all 1.3-1 [11.6 kB] Get: 417 http://deb.debian.org/debian trixie/main amd64 libmaven-javadoc-plugin-java all 3.10.1-2 [451 kB] Get: 418 http://deb.debian.org/debian trixie/main amd64 libplexus-ant-factory-java all 1.0~alpha2.1-5 [11.7 kB] Get: 419 http://deb.debian.org/debian trixie/main amd64 libplexus-container-default1.5-java all 2.1.1-1 [4476 B] Get: 420 http://deb.debian.org/debian trixie/main amd64 libplexus-bsh-factory-java all 1.0~alpha7-5 [8360 B] Get: 421 http://deb.debian.org/debian trixie/main amd64 libmaven-plugin-tools-java all 3.10.2-2 [245 kB] Get: 422 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-exec-java all 2.0.0-1 [23.9 kB] Get: 423 http://deb.debian.org/debian trixie/main amd64 libmaven-resources-plugin-java all 3.3.1-1 [27.5 kB] Get: 424 http://deb.debian.org/debian trixie/main amd64 libmaven-site-plugin-java all 3.21.0-1 [106 kB] Get: 425 http://deb.debian.org/debian trixie/main amd64 libmaven-source-plugin-java all 3.3.1-1 [27.7 kB] Get: 426 http://deb.debian.org/debian trixie/main amd64 libpaper2 amd64 2.2.5-0.3+b2 [16.7 kB] Get: 427 http://deb.debian.org/debian trixie/main amd64 libpaper-utils amd64 2.2.5-0.3+b2 [16.5 kB] Get: 428 http://deb.debian.org/debian trixie/main amd64 libpicard-java all 3.3.0+dfsg-2 [1778 kB] Get: 429 http://deb.debian.org/debian trixie/main amd64 libpj-java all 0.0~20150107+dfsg-5 [1389 kB] Get: 430 http://deb.debian.org/debian trixie/main amd64 libpkgconf3 amd64 1.8.1-4 [36.4 kB] Get: 431 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] Get: 432 http://deb.debian.org/debian trixie/main amd64 libprotobuf32t64 amd64 3.21.12-11 [983 kB] Get: 433 http://deb.debian.org/debian trixie/main amd64 libprotobuf-lite32t64 amd64 3.21.12-11 [274 kB] Get: 434 http://deb.debian.org/debian trixie/main amd64 libprotobuf-dev amd64 3.21.12-11 [1328 kB] Get: 435 http://deb.debian.org/debian trixie/main amd64 libprotobuf-java all 3.21.12-11 [1267 kB] Get: 436 http://deb.debian.org/debian trixie/main amd64 libprotoc32t64 amd64 3.21.12-11 [922 kB] Get: 437 http://deb.debian.org/debian trixie/main amd64 libreflections-java all 0.10.2+dfsg-2 [125 kB] Get: 438 http://deb.debian.org/debian trixie/main amd64 libsm6 amd64 2:1.2.6-1 [37.3 kB] Get: 439 http://deb.debian.org/debian trixie/main amd64 libsurefire-java all 2.22.3-4 [1391 kB] Get: 440 http://deb.debian.org/debian trixie/main amd64 libtcl8.6 amd64 8.6.16+dfsg-1 [1042 kB] Get: 441 http://deb.debian.org/debian trixie/main amd64 libtirpc-common all 1.3.6+ds-1 [11.0 kB] Get: 442 http://deb.debian.org/debian trixie/main amd64 libtirpc3t64 amd64 1.3.6+ds-1 [83.3 kB] Get: 443 http://deb.debian.org/debian trixie/main amd64 libxft2 amd64 2.3.6-1+b4 [54.5 kB] Get: 444 http://deb.debian.org/debian trixie/main amd64 libxss1 amd64 1:1.2.3-1+b3 [17.0 kB] Get: 445 http://deb.debian.org/debian trixie/main amd64 libtk8.6 amd64 8.6.16-1 [793 kB] Get: 446 http://deb.debian.org/debian trixie/main amd64 libwagon-file-java all 3.5.3-2 [8452 B] Get: 447 http://deb.debian.org/debian trixie/main amd64 libwagon-http-java all 3.5.3-2 [49.6 kB] Get: 448 http://deb.debian.org/debian trixie/main amd64 libxml2-utils amd64 2.12.7+dfsg+really2.9.14-2.1 [100 kB] Get: 449 http://deb.debian.org/debian trixie/main amd64 libxt6t64 amd64 1:1.2.1-1.2+b2 [188 kB] Get: 450 http://deb.debian.org/debian trixie/main amd64 maven all 3.9.9-1 [19.7 kB] Get: 451 http://deb.debian.org/debian trixie/main amd64 maven-repo-helper all 1.11 [142 kB] Get: 452 http://deb.debian.org/debian trixie/main amd64 unzip amd64 6.0-29 [173 kB] Get: 453 http://deb.debian.org/debian trixie/main amd64 maven-debian-helper all 2.6.7 [108 kB] Get: 454 http://deb.debian.org/debian trixie/main amd64 pkgconf-bin amd64 1.8.1-4 [30.2 kB] Get: 455 http://deb.debian.org/debian trixie/main amd64 pkgconf amd64 1.8.1-4 [26.2 kB] Get: 456 http://deb.debian.org/debian trixie/main amd64 protobuf-compiler amd64 3.21.12-11 [84.7 kB] Get: 457 http://deb.debian.org/debian trixie/main amd64 zip amd64 3.0-15 [235 kB] Get: 458 http://deb.debian.org/debian trixie/main amd64 xdg-utils all 1.2.1-2 [75.8 kB] Get: 459 http://deb.debian.org/debian trixie/main amd64 r-base-core amd64 4.5.0-3 [28.6 MB] Get: 460 http://deb.debian.org/debian trixie/main amd64 r-cran-rjava amd64 1.0-11-2 [713 kB] Get: 461 http://deb.debian.org/debian trixie/main amd64 testng all 6.9.12-4 [795 kB] Fetched 386 MB in 5s (71.2 MB/s) Preconfiguring packages ... Selecting previously unselected package libsystemd-shared:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19851 files and directories currently installed.) Preparing to unpack .../libsystemd-shared_257.7-1_amd64.deb ... Unpacking libsystemd-shared:amd64 (257.7-1) ... Selecting previously unselected package libapparmor1:amd64. Preparing to unpack .../libapparmor1_4.1.0-1_amd64.deb ... Unpacking libapparmor1:amd64 (4.1.0-1) ... Setting up libsystemd-shared:amd64 (257.7-1) ... Selecting previously unselected package systemd. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19864 files and directories currently installed.) Preparing to unpack .../systemd_257.7-1_amd64.deb ... Unpacking systemd (257.7-1) ... Setting up libapparmor1:amd64 (4.1.0-1) ... Setting up systemd (257.7-1) ... Created symlink '/etc/systemd/system/getty.target.wants/getty@tty1.service' -> '/usr/lib/systemd/system/getty@.service'. Created symlink '/etc/systemd/system/multi-user.target.wants/remote-fs.target' -> '/usr/lib/systemd/system/remote-fs.target'. Created symlink '/etc/systemd/system/sysinit.target.wants/systemd-pstore.service' -> '/usr/lib/systemd/system/systemd-pstore.service'. Initializing machine ID from random generator. Creating group 'systemd-journal' with GID 999. Creating group 'systemd-network' with GID 998. Creating user 'systemd-network' (systemd Network Management) with UID 998 and GID 998. /usr/lib/tmpfiles.d/legacy.conf:14: Duplicate line for path "/run/lock", ignoring. Selecting previously unselected package systemd-sysv. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20802 files and directories currently installed.) Preparing to unpack .../00-systemd-sysv_257.7-1_amd64.deb ... Unpacking systemd-sysv (257.7-1) ... Selecting previously unselected package libdbus-1-3:amd64. Preparing to unpack .../01-libdbus-1-3_1.16.2-2_amd64.deb ... Unpacking libdbus-1-3:amd64 (1.16.2-2) ... Selecting previously unselected package dbus-bin. Preparing to unpack .../02-dbus-bin_1.16.2-2_amd64.deb ... Unpacking dbus-bin (1.16.2-2) ... Selecting previously unselected package dbus-session-bus-common. Preparing to unpack .../03-dbus-session-bus-common_1.16.2-2_all.deb ... Unpacking dbus-session-bus-common (1.16.2-2) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../04-libexpat1_2.7.1-2_amd64.deb ... Unpacking libexpat1:amd64 (2.7.1-2) ... Selecting previously unselected package dbus-daemon. Preparing to unpack .../05-dbus-daemon_1.16.2-2_amd64.deb ... Unpacking dbus-daemon (1.16.2-2) ... Selecting previously unselected package dbus-system-bus-common. Preparing to unpack .../06-dbus-system-bus-common_1.16.2-2_all.deb ... Unpacking dbus-system-bus-common (1.16.2-2) ... Selecting previously unselected package dbus. Preparing to unpack .../07-dbus_1.16.2-2_amd64.deb ... Unpacking dbus (1.16.2-2) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../08-libpipeline1_1.5.8-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-1) ... Selecting previously unselected package binfmt-support. Preparing to unpack .../09-binfmt-support_2.2.2-7_amd64.deb ... Unpacking binfmt-support (2.2.2-7) ... Selecting previously unselected package libpython3.13-minimal:amd64. Preparing to unpack .../10-libpython3.13-minimal_3.13.5-2_amd64.deb ... Unpacking libpython3.13-minimal:amd64 (3.13.5-2) ... Selecting previously unselected package python3.13-minimal. Preparing to unpack .../11-python3.13-minimal_3.13.5-2_amd64.deb ... Unpacking python3.13-minimal (3.13.5-2) ... Setting up libpython3.13-minimal:amd64 (3.13.5-2) ... Setting up libexpat1:amd64 (2.7.1-2) ... Setting up python3.13-minimal (3.13.5-2) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21251 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.13.5-1_amd64.deb ... Unpacking python3-minimal (3.13.5-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_13.0.0_all.deb ... Unpacking media-types (13.0.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.5_all.deb ... Unpacking netbase (6.5) ... Selecting previously unselected package tzdata. Preparing to unpack .../3-tzdata_2025b-4_all.deb ... Unpacking tzdata (2025b-4) ... Selecting previously unselected package libffi8:amd64. Preparing to unpack .../4-libffi8_3.4.8-2_amd64.deb ... Unpacking libffi8:amd64 (3.4.8-2) ... Selecting previously unselected package readline-common. Preparing to unpack .../5-readline-common_8.2-6_all.deb ... Unpacking readline-common (8.2-6) ... Selecting previously unselected package libreadline8t64:amd64. Preparing to unpack .../6-libreadline8t64_8.2-6_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8 to /lib/x86_64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8.2 to /lib/x86_64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8 to /lib/x86_64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8.2 to /lib/x86_64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:amd64 (8.2-6) ... Selecting previously unselected package libpython3.13-stdlib:amd64. Preparing to unpack .../7-libpython3.13-stdlib_3.13.5-2_amd64.deb ... Unpacking libpython3.13-stdlib:amd64 (3.13.5-2) ... Selecting previously unselected package python3.13. Preparing to unpack .../8-python3.13_3.13.5-2_amd64.deb ... Unpacking python3.13 (3.13.5-2) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../9-libpython3-stdlib_3.13.5-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.13.5-1) ... Setting up python3-minimal (3.13.5-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 22266 files and directories currently installed.) Preparing to unpack .../000-python3_3.13.5-1_amd64.deb ... Unpacking python3 (3.13.5-1) ... Selecting previously unselected package libproc2-0:amd64. Preparing to unpack .../001-libproc2-0_2%3a4.0.4-9_amd64.deb ... Unpacking libproc2-0:amd64 (2:4.0.4-9) ... Selecting previously unselected package procps. Preparing to unpack .../002-procps_2%3a4.0.4-9_amd64.deb ... Unpacking procps (2:4.0.4-9) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../003-sensible-utils_0.0.25_all.deb ... Unpacking sensible-utils (0.0.25) ... Selecting previously unselected package openssl. Preparing to unpack .../004-openssl_3.5.1-1_amd64.deb ... Unpacking openssl (3.5.1-1) ... Selecting previously unselected package ca-certificates. Preparing to unpack .../005-ca-certificates_20250419_all.deb ... Unpacking ca-certificates (20250419) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../006-libmagic-mgc_1%3a5.46-5_amd64.deb ... Unpacking libmagic-mgc (1:5.46-5) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../007-libmagic1t64_1%3a5.46-5_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.46-5) ... Selecting previously unselected package file. Preparing to unpack .../008-file_1%3a5.46-5_amd64.deb ... Unpacking file (1:5.46-5) ... Selecting previously unselected package gettext-base. Preparing to unpack .../009-gettext-base_0.23.1-2_amd64.deb ... Unpacking gettext-base (0.23.1-2) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../010-libuchardet0_0.0.8-1+b2_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../011-groff-base_1.23.0-9_amd64.deb ... Unpacking groff-base (1.23.0-9) ... Selecting previously unselected package libpam-systemd:amd64. Preparing to unpack .../012-libpam-systemd_257.7-1_amd64.deb ... Unpacking libpam-systemd:amd64 (257.7-1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../013-bsdextrautils_2.41-5_amd64.deb ... Unpacking bsdextrautils (2.41-5) ... Selecting previously unselected package man-db. Preparing to unpack .../014-man-db_2.13.1-1_amd64.deb ... Unpacking man-db (2.13.1-1) ... Selecting previously unselected package libtext-charwidth-perl:amd64. Preparing to unpack .../015-libtext-charwidth-perl_0.04-11+b4_amd64.deb ... Unpacking libtext-charwidth-perl:amd64 (0.04-11+b4) ... Selecting previously unselected package libtext-wrapi18n-perl. Preparing to unpack .../016-libtext-wrapi18n-perl_0.06-10_all.deb ... Unpacking libtext-wrapi18n-perl (0.06-10) ... Selecting previously unselected package ucf. Preparing to unpack .../017-ucf_3.0052_all.deb ... Moving old data out of the way Unpacking ucf (3.0052) ... Selecting previously unselected package libgdk-pixbuf2.0-common. Preparing to unpack .../018-libgdk-pixbuf2.0-common_2.42.12+dfsg-4_all.deb ... Unpacking libgdk-pixbuf2.0-common (2.42.12+dfsg-4) ... Selecting previously unselected package libglib2.0-0t64:amd64. Preparing to unpack .../019-libglib2.0-0t64_2.84.3-1_amd64.deb ... Unpacking libglib2.0-0t64:amd64 (2.84.3-1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../020-libxml2_2.12.7+dfsg+really2.9.14-2.1_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg+really2.9.14-2.1) ... Selecting previously unselected package shared-mime-info. Preparing to unpack .../021-shared-mime-info_2.4-5+b2_amd64.deb ... Unpacking shared-mime-info (2.4-5+b2) ... Selecting previously unselected package libjpeg62-turbo:amd64. Preparing to unpack .../022-libjpeg62-turbo_1%3a2.1.5-4_amd64.deb ... Unpacking libjpeg62-turbo:amd64 (1:2.1.5-4) ... Selecting previously unselected package libpng16-16t64:amd64. Preparing to unpack .../023-libpng16-16t64_1.6.48-1_amd64.deb ... Unpacking libpng16-16t64:amd64 (1.6.48-1) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../024-libdeflate0_1.23-2_amd64.deb ... Unpacking libdeflate0:amd64 (1.23-2) ... Selecting previously unselected package libjbig0:amd64. Preparing to unpack .../025-libjbig0_2.1-6.1+b2_amd64.deb ... Unpacking libjbig0:amd64 (2.1-6.1+b2) ... Selecting previously unselected package liblerc4:amd64. Preparing to unpack .../026-liblerc4_4.0.0+ds-5_amd64.deb ... Unpacking liblerc4:amd64 (4.0.0+ds-5) ... Selecting previously unselected package libsharpyuv0:amd64. Preparing to unpack .../027-libsharpyuv0_1.5.0-0.1_amd64.deb ... Unpacking libsharpyuv0:amd64 (1.5.0-0.1) ... Selecting previously unselected package libwebp7:amd64. Preparing to unpack .../028-libwebp7_1.5.0-0.1_amd64.deb ... Unpacking libwebp7:amd64 (1.5.0-0.1) ... Selecting previously unselected package libtiff6:amd64. Preparing to unpack .../029-libtiff6_4.7.0-3_amd64.deb ... Unpacking libtiff6:amd64 (4.7.0-3) ... Selecting previously unselected package libgdk-pixbuf-2.0-0:amd64. Preparing to unpack .../030-libgdk-pixbuf-2.0-0_2.42.12+dfsg-4_amd64.deb ... Unpacking libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-4) ... Selecting previously unselected package gtk-update-icon-cache. Preparing to unpack .../031-gtk-update-icon-cache_4.18.6+ds-2_amd64.deb ... No diversion 'diversion of /usr/sbin/update-icon-caches to /usr/sbin/update-icon-caches.gtk2 by libgtk-3-bin', none removed. No diversion 'diversion of /usr/share/man/man8/update-icon-caches.8.gz to /usr/share/man/man8/update-icon-caches.gtk2.8.gz by libgtk-3-bin', none removed. Unpacking gtk-update-icon-cache (4.18.6+ds-2) ... Selecting previously unselected package hicolor-icon-theme. Preparing to unpack .../032-hicolor-icon-theme_0.18-2_all.deb ... Unpacking hicolor-icon-theme (0.18-2) ... Selecting previously unselected package adwaita-icon-theme. Preparing to unpack .../033-adwaita-icon-theme_48.1-1_all.deb ... Unpacking adwaita-icon-theme (48.1-1) ... Selecting previously unselected package ca-certificates-java. Preparing to unpack .../034-ca-certificates-java_20240118_all.deb ... Unpacking ca-certificates-java (20240118) ... Selecting previously unselected package java-common. Preparing to unpack .../035-java-common_0.76_all.deb ... Unpacking java-common (0.76) ... Selecting previously unselected package liblcms2-2:amd64. Preparing to unpack .../036-liblcms2-2_2.16-2_amd64.deb ... Unpacking liblcms2-2:amd64 (2.16-2) ... Selecting previously unselected package libnspr4:amd64. Preparing to unpack .../037-libnspr4_2%3a4.36-1_amd64.deb ... Unpacking libnspr4:amd64 (2:4.36-1) ... Selecting previously unselected package libnss3:amd64. Preparing to unpack .../038-libnss3_2%3a3.110-1_amd64.deb ... Unpacking libnss3:amd64 (2:3.110-1) ... Selecting previously unselected package libpcsclite1:amd64. Preparing to unpack .../039-libpcsclite1_2.3.3-1_amd64.deb ... Unpacking libpcsclite1:amd64 (2.3.3-1) ... Selecting previously unselected package openjdk-21-jre-headless:amd64. Preparing to unpack .../040-openjdk-21-jre-headless_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jre-headless:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jre-headless. Preparing to unpack .../041-default-jre-headless_2%3a1.21-76_amd64.deb ... Unpacking default-jre-headless (2:1.21-76) ... Selecting previously unselected package ant. Preparing to unpack .../042-ant_1.10.15-1_all.deb ... Unpacking ant (1.10.15-1) ... Selecting previously unselected package ant-contrib. Preparing to unpack .../043-ant-contrib_1.0~b3+svn177-12_all.deb ... Unpacking ant-contrib (1.0~b3+svn177-12) ... Selecting previously unselected package at-spi2-common. Preparing to unpack .../044-at-spi2-common_2.56.2-1_all.deb ... Unpacking at-spi2-common (2.56.2-1) ... Selecting previously unselected package m4. Preparing to unpack .../045-m4_1.4.19-8_amd64.deb ... Unpacking m4 (1.4.19-8) ... Selecting previously unselected package autoconf. Preparing to unpack .../046-autoconf_2.72-3.1_all.deb ... Unpacking autoconf (2.72-3.1) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../047-autotools-dev_20240727.1_all.deb ... Unpacking autotools-dev (20240727.1) ... Selecting previously unselected package automake. Preparing to unpack .../048-automake_1%3a1.17-4_all.deb ... Unpacking automake (1:1.17-4) ... Selecting previously unselected package autopoint. Preparing to unpack .../049-autopoint_0.23.1-2_all.deb ... Unpacking autopoint (0.23.1-2) ... Selecting previously unselected package dbus-user-session. Preparing to unpack .../050-dbus-user-session_1.16.2-2_amd64.deb ... Unpacking dbus-user-session (1.16.2-2) ... Selecting previously unselected package libdconf1:amd64. Preparing to unpack .../051-libdconf1_0.40.0-5_amd64.deb ... Unpacking libdconf1:amd64 (0.40.0-5) ... Selecting previously unselected package dconf-service. Preparing to unpack .../052-dconf-service_0.40.0-5_amd64.deb ... Unpacking dconf-service (0.40.0-5) ... Selecting previously unselected package dconf-gsettings-backend:amd64. Preparing to unpack .../053-dconf-gsettings-backend_0.40.0-5_amd64.deb ... Unpacking dconf-gsettings-backend:amd64 (0.40.0-5) ... Selecting previously unselected package dctrl-tools. Preparing to unpack .../054-dctrl-tools_2.24-3+b1_amd64.deb ... Unpacking dctrl-tools (2.24-3+b1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../055-libdebhelper-perl_13.24.2_all.deb ... Unpacking libdebhelper-perl (13.24.2) ... Selecting previously unselected package libtool. Preparing to unpack .../056-libtool_2.5.4-4_all.deb ... Unpacking libtool (2.5.4-4) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../057-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../058-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../059-libfile-stripnondeterminism-perl_1.14.1-2_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.1-2) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../060-dh-strip-nondeterminism_1.14.1-2_all.deb ... Unpacking dh-strip-nondeterminism (1.14.1-2) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../061-libelf1t64_0.192-4_amd64.deb ... Unpacking libelf1t64:amd64 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../062-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libunistring5:amd64. Preparing to unpack .../063-libunistring5_1.3-2_amd64.deb ... Unpacking libunistring5:amd64 (1.3-2) ... Selecting previously unselected package gettext. Preparing to unpack .../064-gettext_0.23.1-2_amd64.deb ... Unpacking gettext (0.23.1-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../065-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../066-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../067-debhelper_13.24.2_all.deb ... Unpacking debhelper (13.24.2) ... Selecting previously unselected package libatk1.0-0t64:amd64. Preparing to unpack .../068-libatk1.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatk1.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libxau6:amd64. Preparing to unpack .../069-libxau6_1%3a1.0.11-1_amd64.deb ... Unpacking libxau6:amd64 (1:1.0.11-1) ... Selecting previously unselected package libxdmcp6:amd64. Preparing to unpack .../070-libxdmcp6_1%3a1.1.5-1_amd64.deb ... Unpacking libxdmcp6:amd64 (1:1.1.5-1) ... Selecting previously unselected package libxcb1:amd64. Preparing to unpack .../071-libxcb1_1.17.0-2+b1_amd64.deb ... Unpacking libxcb1:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libx11-data. Preparing to unpack .../072-libx11-data_2%3a1.8.12-1_all.deb ... Unpacking libx11-data (2:1.8.12-1) ... Selecting previously unselected package libx11-6:amd64. Preparing to unpack .../073-libx11-6_2%3a1.8.12-1_amd64.deb ... Unpacking libx11-6:amd64 (2:1.8.12-1) ... Selecting previously unselected package libxext6:amd64. Preparing to unpack .../074-libxext6_2%3a1.3.4-1+b3_amd64.deb ... Unpacking libxext6:amd64 (2:1.3.4-1+b3) ... Selecting previously unselected package libxi6:amd64. Preparing to unpack .../075-libxi6_2%3a1.8.2-1_amd64.deb ... Unpacking libxi6:amd64 (2:1.8.2-1) ... Selecting previously unselected package libatspi2.0-0t64:amd64. Preparing to unpack .../076-libatspi2.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatspi2.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libatk-bridge2.0-0t64:amd64. Preparing to unpack .../077-libatk-bridge2.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatk-bridge2.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../078-libbrotli1_1.1.0-2+b7_amd64.deb ... Unpacking libbrotli1:amd64 (1.1.0-2+b7) ... Selecting previously unselected package libfreetype6:amd64. Preparing to unpack .../079-libfreetype6_2.13.3+dfsg-1_amd64.deb ... Unpacking libfreetype6:amd64 (2.13.3+dfsg-1) ... Selecting previously unselected package fonts-dejavu-mono. Preparing to unpack .../080-fonts-dejavu-mono_2.37-8_all.deb ... Unpacking fonts-dejavu-mono (2.37-8) ... Selecting previously unselected package fonts-dejavu-core. Preparing to unpack .../081-fonts-dejavu-core_2.37-8_all.deb ... Unpacking fonts-dejavu-core (2.37-8) ... Selecting previously unselected package fontconfig-config. Preparing to unpack .../082-fontconfig-config_2.15.0-2.3_amd64.deb ... Unpacking fontconfig-config (2.15.0-2.3) ... Selecting previously unselected package libfontconfig1:amd64. Preparing to unpack .../083-libfontconfig1_2.15.0-2.3_amd64.deb ... Unpacking libfontconfig1:amd64 (2.15.0-2.3) ... Selecting previously unselected package libpixman-1-0:amd64. Preparing to unpack .../084-libpixman-1-0_0.44.0-3_amd64.deb ... Unpacking libpixman-1-0:amd64 (0.44.0-3) ... Selecting previously unselected package libxcb-render0:amd64. Preparing to unpack .../085-libxcb-render0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-render0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-shm0:amd64. Preparing to unpack .../086-libxcb-shm0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-shm0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxrender1:amd64. Preparing to unpack .../087-libxrender1_1%3a0.9.12-1_amd64.deb ... Unpacking libxrender1:amd64 (1:0.9.12-1) ... Selecting previously unselected package libcairo2:amd64. Preparing to unpack .../088-libcairo2_1.18.4-1+b1_amd64.deb ... Unpacking libcairo2:amd64 (1.18.4-1+b1) ... Selecting previously unselected package libcairo-gobject2:amd64. Preparing to unpack .../089-libcairo-gobject2_1.18.4-1+b1_amd64.deb ... Unpacking libcairo-gobject2:amd64 (1.18.4-1+b1) ... Selecting previously unselected package libcloudproviders0:amd64. Preparing to unpack .../090-libcloudproviders0_0.3.6-2_amd64.deb ... Unpacking libcloudproviders0:amd64 (0.3.6-2) ... Selecting previously unselected package libcolord2:amd64. Preparing to unpack .../091-libcolord2_1.4.7-3_amd64.deb ... Unpacking libcolord2:amd64 (1.4.7-3) ... Selecting previously unselected package libavahi-common-data:amd64. Preparing to unpack .../092-libavahi-common-data_0.8-16_amd64.deb ... Unpacking libavahi-common-data:amd64 (0.8-16) ... Selecting previously unselected package libavahi-common3:amd64. Preparing to unpack .../093-libavahi-common3_0.8-16_amd64.deb ... Unpacking libavahi-common3:amd64 (0.8-16) ... Selecting previously unselected package libavahi-client3:amd64. Preparing to unpack .../094-libavahi-client3_0.8-16_amd64.deb ... Unpacking libavahi-client3:amd64 (0.8-16) ... Selecting previously unselected package libidn2-0:amd64. Preparing to unpack .../095-libidn2-0_2.3.8-2_amd64.deb ... Unpacking libidn2-0:amd64 (2.3.8-2) ... Selecting previously unselected package libp11-kit0:amd64. Preparing to unpack .../096-libp11-kit0_0.25.5-3_amd64.deb ... Unpacking libp11-kit0:amd64 (0.25.5-3) ... Selecting previously unselected package libtasn1-6:amd64. Preparing to unpack .../097-libtasn1-6_4.20.0-2_amd64.deb ... Unpacking libtasn1-6:amd64 (4.20.0-2) ... Selecting previously unselected package libgnutls30t64:amd64. Preparing to unpack .../098-libgnutls30t64_3.8.9-3_amd64.deb ... Unpacking libgnutls30t64:amd64 (3.8.9-3) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../099-libkrb5support0_1.21.3-5_amd64.deb ... Unpacking libkrb5support0:amd64 (1.21.3-5) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../100-libcom-err2_1.47.2-3+b3_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.2-3+b3) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../101-libk5crypto3_1.21.3-5_amd64.deb ... Unpacking libk5crypto3:amd64 (1.21.3-5) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../102-libkeyutils1_1.6.3-6_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-6) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../103-libkrb5-3_1.21.3-5_amd64.deb ... Unpacking libkrb5-3:amd64 (1.21.3-5) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../104-libgssapi-krb5-2_1.21.3-5_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.21.3-5) ... Selecting previously unselected package libcups2t64:amd64. Preparing to unpack .../105-libcups2t64_2.4.10-3_amd64.deb ... Unpacking libcups2t64:amd64 (2.4.10-3) ... Selecting previously unselected package libepoxy0:amd64. Preparing to unpack .../106-libepoxy0_1.5.10-2_amd64.deb ... Unpacking libepoxy0:amd64 (1.5.10-2) ... Selecting previously unselected package libfribidi0:amd64. Preparing to unpack .../107-libfribidi0_1.0.16-1_amd64.deb ... Unpacking libfribidi0:amd64 (1.0.16-1) ... Selecting previously unselected package libgraphite2-3:amd64. Preparing to unpack .../108-libgraphite2-3_1.3.14-2+b1_amd64.deb ... Unpacking libgraphite2-3:amd64 (1.3.14-2+b1) ... Selecting previously unselected package libharfbuzz0b:amd64. Preparing to unpack .../109-libharfbuzz0b_10.2.0-1+b1_amd64.deb ... Unpacking libharfbuzz0b:amd64 (10.2.0-1+b1) ... Selecting previously unselected package fontconfig. Preparing to unpack .../110-fontconfig_2.15.0-2.3_amd64.deb ... Unpacking fontconfig (2.15.0-2.3) ... Selecting previously unselected package libthai-data. Preparing to unpack .../111-libthai-data_0.1.29-2_all.deb ... Unpacking libthai-data (0.1.29-2) ... Selecting previously unselected package libdatrie1:amd64. Preparing to unpack .../112-libdatrie1_0.2.13-3+b1_amd64.deb ... Unpacking libdatrie1:amd64 (0.2.13-3+b1) ... Selecting previously unselected package libthai0:amd64. Preparing to unpack .../113-libthai0_0.1.29-2+b1_amd64.deb ... Unpacking libthai0:amd64 (0.1.29-2+b1) ... Selecting previously unselected package libpango-1.0-0:amd64. Preparing to unpack .../114-libpango-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpango-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libpangoft2-1.0-0:amd64. Preparing to unpack .../115-libpangoft2-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpangoft2-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libpangocairo-1.0-0:amd64. Preparing to unpack .../116-libpangocairo-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpangocairo-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libwayland-client0:amd64. Preparing to unpack .../117-libwayland-client0_1.23.1-3_amd64.deb ... Unpacking libwayland-client0:amd64 (1.23.1-3) ... Selecting previously unselected package libwayland-cursor0:amd64. Preparing to unpack .../118-libwayland-cursor0_1.23.1-3_amd64.deb ... Unpacking libwayland-cursor0:amd64 (1.23.1-3) ... Selecting previously unselected package libwayland-egl1:amd64. Preparing to unpack .../119-libwayland-egl1_1.23.1-3_amd64.deb ... Unpacking libwayland-egl1:amd64 (1.23.1-3) ... Selecting previously unselected package libxcomposite1:amd64. Preparing to unpack .../120-libxcomposite1_1%3a0.4.6-1_amd64.deb ... Unpacking libxcomposite1:amd64 (1:0.4.6-1) ... Selecting previously unselected package libxfixes3:amd64. Preparing to unpack .../121-libxfixes3_1%3a6.0.0-2+b4_amd64.deb ... Unpacking libxfixes3:amd64 (1:6.0.0-2+b4) ... Selecting previously unselected package libxcursor1:amd64. Preparing to unpack .../122-libxcursor1_1%3a1.2.3-1_amd64.deb ... Unpacking libxcursor1:amd64 (1:1.2.3-1) ... Selecting previously unselected package libxdamage1:amd64. Preparing to unpack .../123-libxdamage1_1%3a1.1.6-1+b2_amd64.deb ... Unpacking libxdamage1:amd64 (1:1.1.6-1+b2) ... Selecting previously unselected package libxinerama1:amd64. Preparing to unpack .../124-libxinerama1_2%3a1.1.4-3+b4_amd64.deb ... Unpacking libxinerama1:amd64 (2:1.1.4-3+b4) ... Selecting previously unselected package xkb-data. Preparing to unpack .../125-xkb-data_2.42-1_all.deb ... Unpacking xkb-data (2.42-1) ... Selecting previously unselected package libxkbcommon0:amd64. Preparing to unpack .../126-libxkbcommon0_1.7.0-2_amd64.deb ... Unpacking libxkbcommon0:amd64 (1.7.0-2) ... Selecting previously unselected package libxrandr2:amd64. Preparing to unpack .../127-libxrandr2_2%3a1.5.4-1+b3_amd64.deb ... Unpacking libxrandr2:amd64 (2:1.5.4-1+b3) ... Selecting previously unselected package libgtk-3-common. Preparing to unpack .../128-libgtk-3-common_3.24.49-3_all.deb ... Unpacking libgtk-3-common (3.24.49-3) ... Selecting previously unselected package libgtk-3-0t64:amd64. Preparing to unpack .../129-libgtk-3-0t64_3.24.49-3_amd64.deb ... Unpacking libgtk-3-0t64:amd64 (3.24.49-3) ... Selecting previously unselected package libglvnd0:amd64. Preparing to unpack .../130-libglvnd0_1.7.0-1+b2_amd64.deb ... Unpacking libglvnd0:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libdrm-common. Preparing to unpack .../131-libdrm-common_2.4.124-2_all.deb ... Unpacking libdrm-common (2.4.124-2) ... Selecting previously unselected package libdrm2:amd64. Preparing to unpack .../132-libdrm2_2.4.124-2_amd64.deb ... Unpacking libdrm2:amd64 (2.4.124-2) ... Selecting previously unselected package libx11-xcb1:amd64. Preparing to unpack .../133-libx11-xcb1_2%3a1.8.12-1_amd64.deb ... Unpacking libx11-xcb1:amd64 (2:1.8.12-1) ... Selecting previously unselected package libxcb-dri3-0:amd64. Preparing to unpack .../134-libxcb-dri3-0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-dri3-0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-glx0:amd64. Preparing to unpack .../135-libxcb-glx0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-glx0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-present0:amd64. Preparing to unpack .../136-libxcb-present0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-present0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-xfixes0:amd64. Preparing to unpack .../137-libxcb-xfixes0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-xfixes0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxxf86vm1:amd64. Preparing to unpack .../138-libxxf86vm1_1%3a1.1.4-1+b4_amd64.deb ... Unpacking libxxf86vm1:amd64 (1:1.1.4-1+b4) ... Selecting previously unselected package libdrm-amdgpu1:amd64. Preparing to unpack .../139-libdrm-amdgpu1_2.4.124-2_amd64.deb ... Unpacking libdrm-amdgpu1:amd64 (2.4.124-2) ... Selecting previously unselected package libpciaccess0:amd64. Preparing to unpack .../140-libpciaccess0_0.17-3+b3_amd64.deb ... Unpacking libpciaccess0:amd64 (0.17-3+b3) ... Selecting previously unselected package libdrm-intel1:amd64. Preparing to unpack .../141-libdrm-intel1_2.4.124-2_amd64.deb ... Unpacking libdrm-intel1:amd64 (2.4.124-2) ... Selecting previously unselected package libedit2:amd64. Preparing to unpack .../142-libedit2_3.1-20250104-1_amd64.deb ... Unpacking libedit2:amd64 (3.1-20250104-1) ... Selecting previously unselected package libz3-4:amd64. Preparing to unpack .../143-libz3-4_4.13.3-1_amd64.deb ... Unpacking libz3-4:amd64 (4.13.3-1) ... Selecting previously unselected package libllvm19:amd64. Preparing to unpack .../144-libllvm19_1%3a19.1.7-3+b1_amd64.deb ... Unpacking libllvm19:amd64 (1:19.1.7-3+b1) ... Selecting previously unselected package libsensors-config. Preparing to unpack .../145-libsensors-config_1%3a3.6.2-2_all.deb ... Unpacking libsensors-config (1:3.6.2-2) ... Selecting previously unselected package libsensors5:amd64. Preparing to unpack .../146-libsensors5_1%3a3.6.2-2_amd64.deb ... Unpacking libsensors5:amd64 (1:3.6.2-2) ... Selecting previously unselected package libxcb-randr0:amd64. Preparing to unpack .../147-libxcb-randr0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-randr0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-sync1:amd64. Preparing to unpack .../148-libxcb-sync1_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-sync1:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxshmfence1:amd64. Preparing to unpack .../149-libxshmfence1_1.3.3-1_amd64.deb ... Unpacking libxshmfence1:amd64 (1.3.3-1) ... Selecting previously unselected package mesa-libgallium:amd64. Preparing to unpack .../150-mesa-libgallium_25.0.7-2_amd64.deb ... Unpacking mesa-libgallium:amd64 (25.0.7-2) ... Selecting previously unselected package libwayland-server0:amd64. Preparing to unpack .../151-libwayland-server0_1.23.1-3_amd64.deb ... Unpacking libwayland-server0:amd64 (1.23.1-3) ... Selecting previously unselected package libgbm1:amd64. Preparing to unpack .../152-libgbm1_25.0.7-2_amd64.deb ... Unpacking libgbm1:amd64 (25.0.7-2) ... Selecting previously unselected package libvulkan1:amd64. Preparing to unpack .../153-libvulkan1_1.4.309.0-1_amd64.deb ... Unpacking libvulkan1:amd64 (1.4.309.0-1) ... Selecting previously unselected package libgl1-mesa-dri:amd64. Preparing to unpack .../154-libgl1-mesa-dri_25.0.7-2_amd64.deb ... Unpacking libgl1-mesa-dri:amd64 (25.0.7-2) ... Selecting previously unselected package libglx-mesa0:amd64. Preparing to unpack .../155-libglx-mesa0_25.0.7-2_amd64.deb ... Unpacking libglx-mesa0:amd64 (25.0.7-2) ... Selecting previously unselected package libglx0:amd64. Preparing to unpack .../156-libglx0_1.7.0-1+b2_amd64.deb ... Unpacking libglx0:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libgl1:amd64. Preparing to unpack .../157-libgl1_1.7.0-1+b2_amd64.deb ... Unpacking libgl1:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libasound2-data. Preparing to unpack .../158-libasound2-data_1.2.14-1_all.deb ... Unpacking libasound2-data (1.2.14-1) ... Selecting previously unselected package libasound2t64:amd64. Preparing to unpack .../159-libasound2t64_1.2.14-1_amd64.deb ... Unpacking libasound2t64:amd64 (1.2.14-1) ... Selecting previously unselected package libgif7:amd64. Preparing to unpack .../160-libgif7_5.2.2-1+b1_amd64.deb ... Unpacking libgif7:amd64 (5.2.2-1+b1) ... Selecting previously unselected package x11-common. Preparing to unpack .../161-x11-common_1%3a7.7+24_all.deb ... Unpacking x11-common (1:7.7+24) ... Selecting previously unselected package libxtst6:amd64. Preparing to unpack .../162-libxtst6_2%3a1.2.5-1_amd64.deb ... Unpacking libxtst6:amd64 (2:1.2.5-1) ... Selecting previously unselected package openjdk-21-jre:amd64. Preparing to unpack .../163-openjdk-21-jre_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jre:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jre. Preparing to unpack .../164-default-jre_2%3a1.21-76_amd64.deb ... Unpacking default-jre (2:1.21-76) ... Selecting previously unselected package openjdk-21-jdk-headless:amd64. Preparing to unpack .../165-openjdk-21-jdk-headless_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jdk-headless:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jdk-headless. Preparing to unpack .../166-default-jdk-headless_2%3a1.21-76_amd64.deb ... Unpacking default-jdk-headless (2:1.21-76) ... Selecting previously unselected package openjdk-21-jdk:amd64. Preparing to unpack .../167-openjdk-21-jdk_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jdk:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jdk. Preparing to unpack .../168-default-jdk_2%3a1.21-76_amd64.deb ... Unpacking default-jdk (2:1.21-76) ... Selecting previously unselected package libgpg-error0:amd64. Preparing to unpack .../169-libgpg-error0_1.51-4_amd64.deb ... Unpacking libgpg-error0:amd64 (1.51-4) ... Selecting previously unselected package libassuan9:amd64. Preparing to unpack .../170-libassuan9_3.0.2-2_amd64.deb ... Unpacking libassuan9:amd64 (3.0.2-2) ... Selecting previously unselected package libgcrypt20:amd64. Preparing to unpack .../171-libgcrypt20_1.11.0-7_amd64.deb ... Unpacking libgcrypt20:amd64 (1.11.0-7) ... Selecting previously unselected package gpgconf. Preparing to unpack .../172-gpgconf_2.4.7-21+b3_amd64.deb ... Unpacking gpgconf (2.4.7-21+b3) ... Selecting previously unselected package libksba8:amd64. Preparing to unpack .../173-libksba8_1.6.7-2+b1_amd64.deb ... Unpacking libksba8:amd64 (1.6.7-2+b1) ... Selecting previously unselected package libnpth0t64:amd64. Preparing to unpack .../174-libnpth0t64_1.8-3_amd64.deb ... Unpacking libnpth0t64:amd64 (1.8-3) ... Selecting previously unselected package gpg. Preparing to unpack .../175-gpg_2.4.7-21+b3_amd64.deb ... Unpacking gpg (2.4.7-21+b3) ... Selecting previously unselected package pinentry-curses. Preparing to unpack .../176-pinentry-curses_1.3.1-2_amd64.deb ... Unpacking pinentry-curses (1.3.1-2) ... Selecting previously unselected package gpg-agent. Preparing to unpack .../177-gpg-agent_2.4.7-21+b3_amd64.deb ... Unpacking gpg-agent (2.4.7-21+b3) ... Selecting previously unselected package libfile-dirlist-perl. Preparing to unpack .../178-libfile-dirlist-perl_0.05-3_all.deb ... Unpacking libfile-dirlist-perl (0.05-3) ... Selecting previously unselected package libfile-which-perl. Preparing to unpack .../179-libfile-which-perl_1.27-2_all.deb ... Unpacking libfile-which-perl (1.27-2) ... Selecting previously unselected package libfile-homedir-perl. Preparing to unpack .../180-libfile-homedir-perl_1.006-2_all.deb ... Unpacking libfile-homedir-perl (1.006-2) ... Selecting previously unselected package libfile-touch-perl. Preparing to unpack .../181-libfile-touch-perl_0.12-2_all.deb ... Unpacking libfile-touch-perl (0.12-2) ... Selecting previously unselected package libclass-method-modifiers-perl. Preparing to unpack .../182-libclass-method-modifiers-perl_2.15-1_all.deb ... Unpacking libclass-method-modifiers-perl (2.15-1) ... Selecting previously unselected package libclass-xsaccessor-perl. Preparing to unpack .../183-libclass-xsaccessor-perl_1.19-4+b5_amd64.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b5) ... Selecting previously unselected package libb-hooks-op-check-perl:amd64. Preparing to unpack .../184-libb-hooks-op-check-perl_0.22-3+b2_amd64.deb ... Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Selecting previously unselected package libdynaloader-functions-perl. Preparing to unpack .../185-libdynaloader-functions-perl_0.004-2_all.deb ... Unpacking libdynaloader-functions-perl (0.004-2) ... Selecting previously unselected package libdevel-callchecker-perl:amd64. Preparing to unpack .../186-libdevel-callchecker-perl_0.009-2_amd64.deb ... Unpacking libdevel-callchecker-perl:amd64 (0.009-2) ... Selecting previously unselected package libparams-classify-perl:amd64. Preparing to unpack .../187-libparams-classify-perl_0.015-2+b4_amd64.deb ... Unpacking libparams-classify-perl:amd64 (0.015-2+b4) ... Selecting previously unselected package libmodule-runtime-perl. Preparing to unpack .../188-libmodule-runtime-perl_0.018-1_all.deb ... Unpacking libmodule-runtime-perl (0.018-1) ... Selecting previously unselected package libimport-into-perl. Preparing to unpack .../189-libimport-into-perl_1.002005-2_all.deb ... Unpacking libimport-into-perl (1.002005-2) ... Selecting previously unselected package librole-tiny-perl. Preparing to unpack .../190-librole-tiny-perl_2.002004-1_all.deb ... Unpacking librole-tiny-perl (2.002004-1) ... Selecting previously unselected package libsub-quote-perl. Preparing to unpack .../191-libsub-quote-perl_2.006008-1_all.deb ... Unpacking libsub-quote-perl (2.006008-1) ... Selecting previously unselected package libmoo-perl. Preparing to unpack .../192-libmoo-perl_2.005005-1_all.deb ... Unpacking libmoo-perl (2.005005-1) ... Selecting previously unselected package libencode-locale-perl. Preparing to unpack .../193-libencode-locale-perl_1.05-3_all.deb ... Unpacking libencode-locale-perl (1.05-3) ... Selecting previously unselected package libtimedate-perl. Preparing to unpack .../194-libtimedate-perl_2.3300-2_all.deb ... Unpacking libtimedate-perl (2.3300-2) ... Selecting previously unselected package libhttp-date-perl. Preparing to unpack .../195-libhttp-date-perl_6.06-1_all.deb ... Unpacking libhttp-date-perl (6.06-1) ... Selecting previously unselected package libfile-listing-perl. Preparing to unpack .../196-libfile-listing-perl_6.16-1_all.deb ... Unpacking libfile-listing-perl (6.16-1) ... Selecting previously unselected package libhtml-tagset-perl. Preparing to unpack .../197-libhtml-tagset-perl_3.24-1_all.deb ... Unpacking libhtml-tagset-perl (3.24-1) ... Selecting previously unselected package liburi-perl. Preparing to unpack .../198-liburi-perl_5.30-1_all.deb ... Unpacking liburi-perl (5.30-1) ... Selecting previously unselected package libhtml-parser-perl:amd64. Preparing to unpack .../199-libhtml-parser-perl_3.83-1+b2_amd64.deb ... Unpacking libhtml-parser-perl:amd64 (3.83-1+b2) ... Selecting previously unselected package libhtml-tree-perl. Preparing to unpack .../200-libhtml-tree-perl_5.07-3_all.deb ... Unpacking libhtml-tree-perl (5.07-3) ... Selecting previously unselected package libclone-perl:amd64. Preparing to unpack .../201-libclone-perl_0.47-1+b1_amd64.deb ... Unpacking libclone-perl:amd64 (0.47-1+b1) ... Selecting previously unselected package libio-html-perl. Preparing to unpack .../202-libio-html-perl_1.004-3_all.deb ... Unpacking libio-html-perl (1.004-3) ... Selecting previously unselected package liblwp-mediatypes-perl. Preparing to unpack .../203-liblwp-mediatypes-perl_6.04-2_all.deb ... Unpacking liblwp-mediatypes-perl (6.04-2) ... Selecting previously unselected package libhttp-message-perl. Preparing to unpack .../204-libhttp-message-perl_7.00-2_all.deb ... Unpacking libhttp-message-perl (7.00-2) ... Selecting previously unselected package libhttp-cookies-perl. Preparing to unpack .../205-libhttp-cookies-perl_6.11-1_all.deb ... Unpacking libhttp-cookies-perl (6.11-1) ... Selecting previously unselected package libhttp-negotiate-perl. Preparing to unpack .../206-libhttp-negotiate-perl_6.01-2_all.deb ... Unpacking libhttp-negotiate-perl (6.01-2) ... Selecting previously unselected package perl-openssl-defaults:amd64. Preparing to unpack .../207-perl-openssl-defaults_7+b2_amd64.deb ... Unpacking perl-openssl-defaults:amd64 (7+b2) ... Selecting previously unselected package libnet-ssleay-perl:amd64. Preparing to unpack .../208-libnet-ssleay-perl_1.94-3_amd64.deb ... Unpacking libnet-ssleay-perl:amd64 (1.94-3) ... Selecting previously unselected package libio-socket-ssl-perl. Preparing to unpack .../209-libio-socket-ssl-perl_2.089-1_all.deb ... Unpacking libio-socket-ssl-perl (2.089-1) ... Selecting previously unselected package libnet-http-perl. Preparing to unpack .../210-libnet-http-perl_6.23-1_all.deb ... Unpacking libnet-http-perl (6.23-1) ... Selecting previously unselected package liblwp-protocol-https-perl. Preparing to unpack .../211-liblwp-protocol-https-perl_6.14-1_all.deb ... Unpacking liblwp-protocol-https-perl (6.14-1) ... Selecting previously unselected package libtry-tiny-perl. Preparing to unpack .../212-libtry-tiny-perl_0.32-1_all.deb ... Unpacking libtry-tiny-perl (0.32-1) ... Selecting previously unselected package libwww-robotrules-perl. Preparing to unpack .../213-libwww-robotrules-perl_6.02-1_all.deb ... Unpacking libwww-robotrules-perl (6.02-1) ... Selecting previously unselected package libwww-perl. Preparing to unpack .../214-libwww-perl_6.78-1_all.deb ... Unpacking libwww-perl (6.78-1) ... Selecting previously unselected package patchutils. Preparing to unpack .../215-patchutils_0.4.2-1_amd64.deb ... Unpacking patchutils (0.4.2-1) ... Selecting previously unselected package gpgv. Preparing to unpack .../216-gpgv_2.4.7-21+b3_amd64.deb ... Unpacking gpgv (2.4.7-21+b3) ... Selecting previously unselected package sopv-gpgv. Preparing to unpack .../217-sopv-gpgv_0.1.4-1_all.deb ... Unpacking sopv-gpgv (0.1.4-1) ... Selecting previously unselected package wdiff. Preparing to unpack .../218-wdiff_1.2.2-9_amd64.deb ... Unpacking wdiff (1.2.2-9) ... Selecting previously unselected package devscripts. Preparing to unpack .../219-devscripts_2.25.15_all.deb ... Unpacking devscripts (2.25.15) ... Selecting previously unselected package fastjar. Preparing to unpack .../220-fastjar_2%3a0.98-7_amd64.deb ... Unpacking fastjar (2:0.98-7) ... Selecting previously unselected package jarwrapper. Preparing to unpack .../221-jarwrapper_0.80_all.deb ... Unpacking jarwrapper (0.80) ... Selecting previously unselected package javahelper. Preparing to unpack .../222-javahelper_0.80_all.deb ... Unpacking javahelper (0.80) ... Selecting previously unselected package libhamcrest-java. Preparing to unpack .../223-libhamcrest-java_2.2-2_all.deb ... Unpacking libhamcrest-java (2.2-2) ... Selecting previously unselected package junit4. Preparing to unpack .../224-junit4_4.13.2-5_all.deb ... Unpacking junit4 (4.13.2-5) ... Selecting previously unselected package libapiguardian-java. Preparing to unpack .../225-libapiguardian-java_1.1.2-1_all.deb ... Unpacking libapiguardian-java (1.1.2-1) ... Selecting previously unselected package libopentest4j-java. Preparing to unpack .../226-libopentest4j-java_1.2.0-4_all.deb ... Unpacking libopentest4j-java (1.2.0-4) ... Selecting previously unselected package libopentest4j-reporting-java. Preparing to unpack .../227-libopentest4j-reporting-java_0.1.0-M1-2_all.deb ... Unpacking libopentest4j-reporting-java (0.1.0-M1-2) ... Selecting previously unselected package libpicocli-java. Preparing to unpack .../228-libpicocli-java_4.6.2-2_all.deb ... Unpacking libpicocli-java (4.6.2-2) ... Selecting previously unselected package libunivocity-parsers-java. Preparing to unpack .../229-libunivocity-parsers-java_2.9.1-1_all.deb ... Unpacking libunivocity-parsers-java (2.9.1-1) ... Selecting previously unselected package junit5. Preparing to unpack .../230-junit5_5.10.3-1_all.deb ... Unpacking junit5 (5.10.3-1) ... Selecting previously unselected package libactivation-java. Preparing to unpack .../231-libactivation-java_1.2.0-2_all.deb ... Unpacking libactivation-java (1.2.0-2) ... Selecting previously unselected package libaopalliance-java. Preparing to unpack .../232-libaopalliance-java_20070526-7_all.deb ... Unpacking libaopalliance-java (20070526-7) ... Selecting previously unselected package libapache-pom-java. Preparing to unpack .../233-libapache-pom-java_33-2_all.deb ... Unpacking libapache-pom-java (33-2) ... Selecting previously unselected package libasm-java. Preparing to unpack .../234-libasm-java_9.8-1_all.deb ... Unpacking libasm-java (9.8-1) ... Selecting previously unselected package libatinject-jsr330-api-java. Preparing to unpack .../235-libatinject-jsr330-api-java_1.0+ds1-6_all.deb ... Unpacking libatinject-jsr330-api-java (1.0+ds1-6) ... Selecting previously unselected package libcommons-parent-java. Preparing to unpack .../236-libcommons-parent-java_56-1_all.deb ... Unpacking libcommons-parent-java (56-1) ... Selecting previously unselected package libcommons-lang3-java. Preparing to unpack .../237-libcommons-lang3-java_3.17.0-1_all.deb ... Unpacking libcommons-lang3-java (3.17.0-1) ... Selecting previously unselected package libfreemarker-java. Preparing to unpack .../238-libfreemarker-java_2.3.32-2.1_all.deb ... Unpacking libfreemarker-java (2.3.32-2.1) ... Selecting previously unselected package libgoogle-gson-java. Preparing to unpack .../239-libgoogle-gson-java_2.10.1-1_all.deb ... Unpacking libgoogle-gson-java (2.10.1-1) ... Selecting previously unselected package libjoptsimple-java. Preparing to unpack .../240-libjoptsimple-java_5.0.4-7_all.deb ... Unpacking libjoptsimple-java (5.0.4-7) ... Selecting previously unselected package libcommons-codec-java. Preparing to unpack .../241-libcommons-codec-java_1.18.0-1_all.deb ... Unpacking libcommons-codec-java (1.18.0-1) ... Selecting previously unselected package libcommons-logging-java. Preparing to unpack .../242-libcommons-logging-java_1.3.0-2_all.deb ... Unpacking libcommons-logging-java (1.3.0-2) ... Selecting previously unselected package libhttpcore-java. Preparing to unpack .../243-libhttpcore-java_4.4.16-1_all.deb ... Unpacking libhttpcore-java (4.4.16-1) ... Selecting previously unselected package libhttpclient-java. Preparing to unpack .../244-libhttpclient-java_4.5.14-1_all.deb ... Unpacking libhttpclient-java (4.5.14-1) ... Selecting previously unselected package liblightcouch-java. Preparing to unpack .../245-liblightcouch-java_0.2.0-1_all.deb ... Unpacking liblightcouch-java (0.2.0-1) ... Selecting previously unselected package libmongodb-java. Preparing to unpack .../246-libmongodb-java_3.6.3-2_all.deb ... Unpacking libmongodb-java (3.6.3-2) ... Selecting previously unselected package libslf4j-java. Preparing to unpack .../247-libslf4j-java_1.7.32-2_all.deb ... Unpacking libslf4j-java (1.7.32-2) ... Selecting previously unselected package liblog4j2-java. Preparing to unpack .../248-liblog4j2-java_2.19.0-2_all.deb ... Unpacking liblog4j2-java (2.19.0-2) ... Selecting previously unselected package libbarclay-java. Preparing to unpack .../249-libbarclay-java_5.0.0+dfsg-1_all.deb ... Unpacking libbarclay-java (5.0.0+dfsg-1) ... Selecting previously unselected package libblas3:amd64. Preparing to unpack .../250-libblas3_3.12.1-4_amd64.deb ... Unpacking libblas3:amd64 (3.12.1-4) ... Selecting previously unselected package libbsh-java. Preparing to unpack .../251-libbsh-java_2.0b4-20_all.deb ... Unpacking libbsh-java (2.0b4-20) ... Selecting previously unselected package libcommons-io-java. Preparing to unpack .../252-libcommons-io-java_2.19.0-1_all.deb ... Unpacking libcommons-io-java (2.19.0-1) ... Selecting previously unselected package libmaven-shared-utils-java. Preparing to unpack .../253-libmaven-shared-utils-java_3.4.2-1_all.deb ... Unpacking libmaven-shared-utils-java (3.4.2-1) ... Selecting previously unselected package libcommons-cli-java. Preparing to unpack .../254-libcommons-cli-java_1.6.0-1_all.deb ... Unpacking libcommons-cli-java (1.6.0-1) ... Selecting previously unselected package libgeronimo-annotation-1.3-spec-java. Preparing to unpack .../255-libgeronimo-annotation-1.3-spec-java_1.3-1_all.deb ... Unpacking libgeronimo-annotation-1.3-spec-java (1.3-1) ... Selecting previously unselected package liberror-prone-java. Preparing to unpack .../256-liberror-prone-java_2.18.0-1_all.deb ... Unpacking liberror-prone-java (2.18.0-1) ... Selecting previously unselected package libjsr305-java. Preparing to unpack .../257-libjsr305-java_0.1~+svn49-12_all.deb ... Unpacking libjsr305-java (0.1~+svn49-12) ... Selecting previously unselected package libguava-java. Preparing to unpack .../258-libguava-java_32.0.1-1_all.deb ... Unpacking libguava-java (32.0.1-1) ... Selecting previously unselected package libguice-java. Preparing to unpack .../259-libguice-java_5.1.0-1_all.deb ... Unpacking libguice-java (5.1.0-1) ... Selecting previously unselected package libmaven-parent-java. Preparing to unpack .../260-libmaven-parent-java_43-2_all.deb ... Unpacking libmaven-parent-java (43-2) ... Selecting previously unselected package libplexus-utils2-java. Preparing to unpack .../261-libplexus-utils2-java_3.4.2-1_all.deb ... Unpacking libplexus-utils2-java (3.4.2-1) ... Selecting previously unselected package libwagon-provider-api-java. Preparing to unpack .../262-libwagon-provider-api-java_3.5.3-2_all.deb ... Unpacking libwagon-provider-api-java (3.5.3-2) ... Selecting previously unselected package libmaven-resolver-java. Preparing to unpack .../263-libmaven-resolver-java_1.9.22-1_all.deb ... Unpacking libmaven-resolver-java (1.9.22-1) ... Selecting previously unselected package libplexus-cipher-java. Preparing to unpack .../264-libplexus-cipher-java_2.0-1_all.deb ... Unpacking libplexus-cipher-java (2.0-1) ... Selecting previously unselected package libplexus-classworlds-java. Preparing to unpack .../265-libplexus-classworlds-java_2.7.0-1_all.deb ... Unpacking libplexus-classworlds-java (2.7.0-1) ... Selecting previously unselected package libplexus-component-annotations-java. Preparing to unpack .../266-libplexus-component-annotations-java_2.1.1-1_all.deb ... Unpacking libplexus-component-annotations-java (2.1.1-1) ... Selecting previously unselected package libplexus-interpolation-java. Preparing to unpack .../267-libplexus-interpolation-java_1.27-1_all.deb ... Unpacking libplexus-interpolation-java (1.27-1) ... Selecting previously unselected package libplexus-sec-dispatcher-java. Preparing to unpack .../268-libplexus-sec-dispatcher-java_2.0-3_all.deb ... Unpacking libplexus-sec-dispatcher-java (2.0-3) ... Selecting previously unselected package libgeronimo-interceptor-3.0-spec-java. Preparing to unpack .../269-libgeronimo-interceptor-3.0-spec-java_1.0.1-5_all.deb ... Unpacking libgeronimo-interceptor-3.0-spec-java (1.0.1-5) ... Selecting previously unselected package libcdi-api-java. Preparing to unpack .../270-libcdi-api-java_1.2-4_all.deb ... Unpacking libcdi-api-java (1.2-4) ... Selecting previously unselected package libsisu-inject-java. Preparing to unpack .../271-libsisu-inject-java_0.3.5-1_all.deb ... Unpacking libsisu-inject-java (0.3.5-1) ... Selecting previously unselected package libsisu-plexus-java. Preparing to unpack .../272-libsisu-plexus-java_0.3.5-1_all.deb ... Unpacking libsisu-plexus-java (0.3.5-1) ... Selecting previously unselected package libmaven3-core-java. Preparing to unpack .../273-libmaven3-core-java_3.9.9-1_all.deb ... Unpacking libmaven3-core-java (3.9.9-1) ... Selecting previously unselected package libmaven-shared-io-java. Preparing to unpack .../274-libmaven-shared-io-java_3.0.0-4_all.deb ... Unpacking libmaven-shared-io-java (3.0.0-4) ... Selecting previously unselected package libmaven-file-management-java. Preparing to unpack .../275-libmaven-file-management-java_3.0.0-2_all.deb ... Unpacking libmaven-file-management-java (3.0.0-2) ... Selecting previously unselected package libbuild-helper-maven-plugin-java. Preparing to unpack .../276-libbuild-helper-maven-plugin-java_3.3.0-1_all.deb ... Unpacking libbuild-helper-maven-plugin-java (3.3.0-1) ... Selecting previously unselected package libbyte-buddy-java. Preparing to unpack .../277-libbyte-buddy-java_1.14.19-1_all.deb ... Unpacking libbyte-buddy-java (1.14.19-1) ... Selecting previously unselected package libcolt-free-java. Preparing to unpack .../278-libcolt-free-java_1.2.0+dfsg-8_all.deb ... Unpacking libcolt-free-java (1.2.0+dfsg-8) ... Selecting previously unselected package libcommons-collections3-java. Preparing to unpack .../279-libcommons-collections3-java_3.2.2-3_all.deb ... Unpacking libcommons-collections3-java (3.2.2-3) ... Selecting previously unselected package libcommons-beanutils-java. Preparing to unpack .../280-libcommons-beanutils-java_1.10.1-1.1_all.deb ... Unpacking libcommons-beanutils-java (1.10.1-1.1) ... Selecting previously unselected package libcommons-collections4-java. Preparing to unpack .../281-libcommons-collections4-java_4.4-2_all.deb ... Unpacking libcommons-collections4-java (4.4-2) ... Selecting previously unselected package libcommons-compress-java. Preparing to unpack .../282-libcommons-compress-java_1.27.1-2_all.deb ... Unpacking libcommons-compress-java (1.27.1-2) ... Selecting previously unselected package libcommons-lang-java. Preparing to unpack .../283-libcommons-lang-java_2.6-10_all.deb ... Unpacking libcommons-lang-java (2.6-10) ... Selecting previously unselected package libcommons-configuration-java. Preparing to unpack .../284-libcommons-configuration-java_1.10-7_all.deb ... Unpacking libcommons-configuration-java (1.10-7) ... Selecting previously unselected package libcommons-digester-java. Preparing to unpack .../285-libcommons-digester-java_1.8.1-7_all.deb ... Unpacking libcommons-digester-java (1.8.1-7) ... Selecting previously unselected package libcommons-exec-java. Preparing to unpack .../286-libcommons-exec-java_1.3-3_all.deb ... Unpacking libcommons-exec-java (1.3-3) ... Selecting previously unselected package libcommons-jexl2-java. Preparing to unpack .../287-libcommons-jexl2-java_2.1.1-6_all.deb ... Unpacking libcommons-jexl2-java (2.1.1-6) ... Selecting previously unselected package libcommons-math-java. Preparing to unpack .../288-libcommons-math-java_2.2-9_all.deb ... Unpacking libcommons-math-java (2.2-9) ... Selecting previously unselected package libcommons-math3-java. Preparing to unpack .../289-libcommons-math3-java_3.6.1-4_all.deb ... Unpacking libcommons-math3-java (3.6.1-4) ... Selecting previously unselected package libplexus-io-java. Preparing to unpack .../290-libplexus-io-java_3.3.1-2_all.deb ... Unpacking libplexus-io-java (3.3.1-2) ... Selecting previously unselected package libsnappy1v5:amd64. Preparing to unpack .../291-libsnappy1v5_1.2.2-1_amd64.deb ... Unpacking libsnappy1v5:amd64 (1.2.2-1) ... Selecting previously unselected package libsnappy-jni. Preparing to unpack .../292-libsnappy-jni_1.1.10.7-1_amd64.deb ... Unpacking libsnappy-jni (1.1.10.7-1) ... Selecting previously unselected package libsnappy-java. Preparing to unpack .../293-libsnappy-java_1.1.10.7-1_all.deb ... Unpacking libsnappy-java (1.1.10.7-1) ... Selecting previously unselected package libxz-java. Preparing to unpack .../294-libxz-java_1.9-1_all.deb ... Unpacking libxz-java (1.9-1) ... Selecting previously unselected package libplexus-archiver-java. Preparing to unpack .../295-libplexus-archiver-java_4.6.1-1_all.deb ... Unpacking libplexus-archiver-java (4.6.1-1) ... Selecting previously unselected package libmaven-archiver-java. Preparing to unpack .../296-libmaven-archiver-java_3.6.2-1_all.deb ... Unpacking libmaven-archiver-java (3.6.2-1) ... Selecting previously unselected package libmaven-jar-plugin-java. Preparing to unpack .../297-libmaven-jar-plugin-java_3.3.0-2_all.deb ... Unpacking libmaven-jar-plugin-java (3.3.0-2) ... Selecting previously unselected package libcommons-text-java. Preparing to unpack .../298-libcommons-text-java_1.13.1-1_all.deb ... Unpacking libcommons-text-java (1.13.1-1) ... Selecting previously unselected package sgml-base. Preparing to unpack .../299-sgml-base_1.31+nmu1_all.deb ... Unpacking sgml-base (1.31+nmu1) ... Selecting previously unselected package libcommons-validator-java. Preparing to unpack .../300-libcommons-validator-java_1%3a1.9.0-1_all.deb ... Unpacking libcommons-validator-java (1:1.9.0-1) ... Selecting previously unselected package libsasl2-modules-db:amd64. Preparing to unpack .../301-libsasl2-modules-db_2.1.28+dfsg1-9_amd64.deb ... Unpacking libsasl2-modules-db:amd64 (2.1.28+dfsg1-9) ... Selecting previously unselected package libsasl2-2:amd64. Preparing to unpack .../302-libsasl2-2_2.1.28+dfsg1-9_amd64.deb ... Unpacking libsasl2-2:amd64 (2.1.28+dfsg1-9) ... Selecting previously unselected package libldap2:amd64. Preparing to unpack .../303-libldap2_2.6.10+dfsg-1_amd64.deb ... Unpacking libldap2:amd64 (2.6.10+dfsg-1) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../304-libnghttp2-14_1.64.0-1.1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.64.0-1.1) ... Selecting previously unselected package libnghttp3-9:amd64. Preparing to unpack .../305-libnghttp3-9_1.8.0-1_amd64.deb ... Unpacking libnghttp3-9:amd64 (1.8.0-1) ... Selecting previously unselected package libpsl5t64:amd64. Preparing to unpack .../306-libpsl5t64_0.21.2-1.1+b1_amd64.deb ... Unpacking libpsl5t64:amd64 (0.21.2-1.1+b1) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../307-librtmp1_2.4+20151223.gitfa8646d.1-2+b5_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b5) ... Selecting previously unselected package libssh2-1t64:amd64. Preparing to unpack .../308-libssh2-1t64_1.11.1-1_amd64.deb ... Unpacking libssh2-1t64:amd64 (1.11.1-1) ... Selecting previously unselected package libcurl4t64:amd64. Preparing to unpack .../309-libcurl4t64_8.14.1-2_amd64.deb ... Unpacking libcurl4t64:amd64 (8.14.1-2) ... Selecting previously unselected package libdistlib-java. Preparing to unpack .../310-libdistlib-java_1.0-5_all.deb ... Unpacking libdistlib-java (1.0-5) ... Selecting previously unselected package libjaxen-java. Preparing to unpack .../311-libjaxen-java_1.1.6-5_all.deb ... Unpacking libjaxen-java (1.1.6-5) ... Selecting previously unselected package libdom4j-java. Preparing to unpack .../312-libdom4j-java_2.1.4-1_all.deb ... Unpacking libdom4j-java (2.1.4-1) ... Selecting previously unselected package libdoxia-core-java. Preparing to unpack .../313-libdoxia-core-java_2.0.0-1_all.deb ... Unpacking libdoxia-core-java (2.0.0-1) ... Selecting previously unselected package libplexus-xml-java. Preparing to unpack .../314-libplexus-xml-java_3.0.1-2_all.deb ... Unpacking libplexus-xml-java (3.0.1-2) ... Selecting previously unselected package libdoxia-java. Preparing to unpack .../315-libdoxia-java_2.0.0-1_all.deb ... Unpacking libdoxia-java (2.0.0-1) ... Selecting previously unselected package libmaven-reporting-api-java. Preparing to unpack .../316-libmaven-reporting-api-java_4.0.0-1_all.deb ... Unpacking libmaven-reporting-api-java (4.0.0-1) ... Selecting previously unselected package libxbean-reflect-java. Preparing to unpack .../317-libxbean-reflect-java_4.5-9_all.deb ... Unpacking libxbean-reflect-java (4.5-9) ... Selecting previously unselected package libplexus-container-default-java. Preparing to unpack .../318-libplexus-container-default-java_2.1.1-1_all.deb ... Unpacking libplexus-container-default-java (2.1.1-1) ... Selecting previously unselected package libplexus-i18n-java. Preparing to unpack .../319-libplexus-i18n-java_1.0-beta-10-6_all.deb ... Unpacking libplexus-i18n-java (1.0-beta-10-6) ... Selecting previously unselected package velocity. Preparing to unpack .../320-velocity_1.7-7_all.deb ... Unpacking velocity (1.7-7) ... Selecting previously unselected package libplexus-velocity-java. Preparing to unpack .../321-libplexus-velocity-java_1.2-4_all.deb ... Unpacking libplexus-velocity-java (1.2-4) ... Selecting previously unselected package liboro-java. Preparing to unpack .../322-liboro-java_2.0.8a-15_all.deb ... Unpacking liboro-java (2.0.8a-15) ... Selecting previously unselected package libvelocity-tools-java. Preparing to unpack .../323-libvelocity-tools-java_2.0-9_all.deb ... Unpacking libvelocity-tools-java (2.0-9) ... Selecting previously unselected package libdoxia-sitetools-java. Preparing to unpack .../324-libdoxia-sitetools-java_2.0.0-1_all.deb ... Unpacking libdoxia-sitetools-java (2.0.0-1) ... Selecting previously unselected package libfastutil-java. Preparing to unpack .../325-libfastutil-java_8.5.15+dfsg-1_all.deb ... Unpacking libfastutil-java (8.5.15+dfsg-1) ... Selecting previously unselected package libxpp3-java. Preparing to unpack .../326-libxpp3-java_1.1.4c-4_all.deb ... Unpacking libxpp3-java (1.1.4c-4) ... Selecting previously unselected package libxstream-java. Preparing to unpack .../327-libxstream-java_1.4.21-1_all.deb ... Unpacking libxstream-java (1.4.21-1) ... Selecting previously unselected package libjsap-java. Preparing to unpack .../328-libjsap-java_2.1-5_all.deb ... Unpacking libjsap-java (2.1-5) ... Selecting previously unselected package liblogback-java. Preparing to unpack .../329-liblogback-java_1%3a1.2.11-6_all.deb ... Unpacking liblogback-java (1:1.2.11-6) ... Selecting previously unselected package libdsiutils-java. Preparing to unpack .../330-libdsiutils-java_2.7.3+dfsg-1_all.deb ... Unpacking libdsiutils-java (2.7.3+dfsg-1) ... Selecting previously unselected package libobjenesis-java. Preparing to unpack .../331-libobjenesis-java_3.4-2_all.deb ... Unpacking libobjenesis-java (3.4-2) ... Selecting previously unselected package libeasymock-java. Preparing to unpack .../332-libeasymock-java_5.5.0-1_all.deb ... Unpacking libeasymock-java (5.5.0-1) ... Selecting previously unselected package libel-api-java. Preparing to unpack .../333-libel-api-java_3.0.0-3_all.deb ... Unpacking libel-api-java (3.0.0-3) ... Selecting previously unselected package libexec-maven-plugin-java. Preparing to unpack .../334-libexec-maven-plugin-java_3.1.0-2_all.deb ... Unpacking libexec-maven-plugin-java (3.1.0-2) ... Selecting previously unselected package libezmorph-java. Preparing to unpack .../335-libezmorph-java_1.0.6-4_all.deb ... Unpacking libezmorph-java (1.0.6-4) ... Selecting previously unselected package libgatk-native-bindings-java. Preparing to unpack .../336-libgatk-native-bindings-java_1.0.0+dfsg-2_all.deb ... Unpacking libgatk-native-bindings-java (1.0.0+dfsg-2) ... Selecting previously unselected package libgfortran5:amd64. Preparing to unpack .../337-libgfortran5_14.2.0-19_amd64.deb ... Unpacking libgfortran5:amd64 (14.2.0-19) ... Selecting previously unselected package libxml-commons-external-java. Preparing to unpack .../338-libxml-commons-external-java_1.4.01-6_all.deb ... Unpacking libxml-commons-external-java (1.4.01-6) ... Selecting previously unselected package libxml-commons-resolver1.1-java. Preparing to unpack .../339-libxml-commons-resolver1.1-java_1.2-11_all.deb ... Unpacking libxml-commons-resolver1.1-java (1.2-11) ... Selecting previously unselected package libxerces2-java. Preparing to unpack .../340-libxerces2-java_2.12.2-1_all.deb ... Unpacking libxerces2-java (2.12.2-1) ... Selecting previously unselected package libxom-java. Preparing to unpack .../341-libxom-java_1.3.9-1_all.deb ... Unpacking libxom-java (1.3.9-1) ... Selecting previously unselected package libjson-java. Preparing to unpack .../342-libjson-java_3.1.0+dfsg-2_all.deb ... Unpacking libjson-java (3.1.0+dfsg-2) ... Selecting previously unselected package libmbedcrypto16:amd64. Preparing to unpack .../343-libmbedcrypto16_3.6.4-2_amd64.deb ... Unpacking libmbedcrypto16:amd64 (3.6.4-2) ... Selecting previously unselected package libmbedx509-7:amd64. Preparing to unpack .../344-libmbedx509-7_3.6.4-2_amd64.deb ... Unpacking libmbedx509-7:amd64 (3.6.4-2) ... Selecting previously unselected package libmbedtls21:amd64. Preparing to unpack .../345-libmbedtls21_3.6.4-2_amd64.deb ... Unpacking libmbedtls21:amd64 (3.6.4-2) ... Selecting previously unselected package ncbi-vdb-data. Preparing to unpack .../346-ncbi-vdb-data_3.2.1+dfsg-2_all.deb ... Unpacking ncbi-vdb-data (3.2.1+dfsg-2) ... Selecting previously unselected package libncbi-vdb3:amd64. Preparing to unpack .../347-libncbi-vdb3_3.2.1+dfsg-2_amd64.deb ... Unpacking libncbi-vdb3:amd64 (3.2.1+dfsg-2) ... Selecting previously unselected package libncbi-ngs3:amd64. Preparing to unpack .../348-libncbi-ngs3_3.2.1+dfsg-4_amd64.deb ... Unpacking libncbi-ngs3:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package libngs-jni:amd64. Preparing to unpack .../349-libngs-jni_3.2.1+dfsg-4_amd64.deb ... Unpacking libngs-jni:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package libngs-java:amd64. Preparing to unpack .../350-libngs-java_3.2.1+dfsg-4_amd64.deb ... Unpacking libngs-java:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package librhino-java. Preparing to unpack .../351-librhino-java_1.7.15-1_all.deb ... Unpacking librhino-java (1.7.15-1) ... Selecting previously unselected package libhtsjdk-java. Preparing to unpack .../352-libhtsjdk-java_4.1.3+dfsg-2_all.deb ... Unpacking libhtsjdk-java (4.1.3+dfsg-2) ... Selecting previously unselected package libgkl-java. Preparing to unpack .../353-libgkl-java_0.8.11+dfsg-2_all.deb ... Unpacking libgkl-java (0.8.11+dfsg-2) ... Selecting previously unselected package libicu4j-java. Preparing to unpack .../354-libicu4j-java_73.2-1_all.deb ... Unpacking libicu4j-java (73.2-1) ... Selecting previously unselected package liblog4j1.2-java. Preparing to unpack .../355-liblog4j1.2-java_1.2.17-11_all.deb ... Unpacking liblog4j1.2-java (1.2.17-11) ... Selecting previously unselected package libicb-utils-java. Preparing to unpack .../356-libicb-utils-java_2.0.1+git20161002.afee1d9-5_all.deb ... Unpacking libicb-utils-java (2.0.1+git20161002.afee1d9-5) ... Selecting previously unselected package libice6:amd64. Preparing to unpack .../357-libice6_2%3a1.1.1-1_amd64.deb ... Unpacking libice6:amd64 (2:1.1.1-1) ... Selecting previously unselected package libicu76:amd64. Preparing to unpack .../358-libicu76_76.1-4_amd64.deb ... Unpacking libicu76:amd64 (76.1-4) ... Selecting previously unselected package libjansi-java. Preparing to unpack .../359-libjansi-java_2.4.1-2_all.deb ... Unpacking libjansi-java (2.4.1-2) ... Selecting previously unselected package libjavassist-java. Preparing to unpack .../360-libjavassist-java_1%3a3.27.0-1_all.deb ... Unpacking libjavassist-java (1:3.27.0-1) ... Selecting previously unselected package libjaxb-api-java. Preparing to unpack .../361-libjaxb-api-java_2.3.1-1_all.deb ... Unpacking libjaxb-api-java (2.3.1-1) ... Selecting previously unselected package libjboss-logging-java. Preparing to unpack .../362-libjboss-logging-java_3.5.3-1_all.deb ... Unpacking libjboss-logging-java (3.5.3-1) ... Selecting previously unselected package libjboss-vfs-java. Preparing to unpack .../363-libjboss-vfs-java_3.2.15.Final-3_all.deb ... Unpacking libjboss-vfs-java (3.2.15.Final-3) ... Selecting previously unselected package libjbzip2-java. Preparing to unpack .../364-libjbzip2-java_0.9.1-8_all.deb ... Unpacking libjbzip2-java (0.9.1-8) ... Selecting previously unselected package libjcommander-java. Preparing to unpack .../365-libjcommander-java_1.71-4_all.deb ... Unpacking libjcommander-java (1.71-4) ... Selecting previously unselected package libjsp-api-java. Preparing to unpack .../366-libjsp-api-java_2.3.4-3_all.deb ... Unpacking libjsp-api-java (2.3.4-3) ... Selecting previously unselected package libservlet-api-java. Preparing to unpack .../367-libservlet-api-java_4.0.1-2_all.deb ... Unpacking libservlet-api-java (4.0.1-2) ... Selecting previously unselected package libwebsocket-api-java. Preparing to unpack .../368-libwebsocket-api-java_1.1-2_all.deb ... Unpacking libwebsocket-api-java (1.1-2) ... Selecting previously unselected package libjetty9-java. Preparing to unpack .../369-libjetty9-java_9.4.57-1_all.deb ... Unpacking libjetty9-java (9.4.57-1) ... Selecting previously unselected package libjsoup-java. Preparing to unpack .../370-libjsoup-java_1.15.3-1_all.deb ... Unpacking libjsoup-java (1.15.3-1) ... Selecting previously unselected package libjtidy-java. Preparing to unpack .../371-libjtidy-java_7+svn20110807-6_all.deb ... Unpacking libjtidy-java (7+svn20110807-6) ... Selecting previously unselected package liblapack3:amd64. Preparing to unpack .../372-liblapack3_3.12.1-4_amd64.deb ... Unpacking liblapack3:amd64 (3.12.1-4) ... Selecting previously unselected package libmaven-antrun-plugin-java. Preparing to unpack .../373-libmaven-antrun-plugin-java_3.1.0-1_all.deb ... Unpacking libmaven-antrun-plugin-java (3.1.0-1) ... Selecting previously unselected package libmaven-common-artifact-filters-java. Preparing to unpack .../374-libmaven-common-artifact-filters-java_3.4.0-1_all.deb ... Unpacking libmaven-common-artifact-filters-java (3.4.0-1) ... Selecting previously unselected package libmaven-artifact-transfer-java. Preparing to unpack .../375-libmaven-artifact-transfer-java_0.13.1-3_all.deb ... Unpacking libmaven-artifact-transfer-java (0.13.1-3) ... Selecting previously unselected package libplexus-build-api-java. Preparing to unpack .../376-libplexus-build-api-java_0.0.7-4_all.deb ... Unpacking libplexus-build-api-java (0.0.7-4) ... Selecting previously unselected package libmaven-filtering-java. Preparing to unpack .../377-libmaven-filtering-java_3.4.0-1_all.deb ... Unpacking libmaven-filtering-java (3.4.0-1) ... Selecting previously unselected package libmaven-assembly-plugin-java. Preparing to unpack .../378-libmaven-assembly-plugin-java_3.4.2-2_all.deb ... Unpacking libmaven-assembly-plugin-java (3.4.2-2) ... Selecting previously unselected package libmaven-clean-plugin-java. Preparing to unpack .../379-libmaven-clean-plugin-java_3.2.0-2_all.deb ... Unpacking libmaven-clean-plugin-java (3.2.0-2) ... Selecting previously unselected package libmaven-shared-incremental-java. Preparing to unpack .../380-libmaven-shared-incremental-java_1.1-6_all.deb ... Unpacking libmaven-shared-incremental-java (1.1-6) ... Selecting previously unselected package libplexus-compiler-java. Preparing to unpack .../381-libplexus-compiler-java_2.13.0-1_all.deb ... Unpacking libplexus-compiler-java (2.13.0-1) ... Selecting previously unselected package libqdox2-java. Preparing to unpack .../382-libqdox2-java_2.0.3-1_all.deb ... Unpacking libqdox2-java (2.0.3-1) ... Selecting previously unselected package libplexus-languages-java. Preparing to unpack .../383-libplexus-languages-java_1.1.1-3_all.deb ... Unpacking libplexus-languages-java (1.1.1-3) ... Selecting previously unselected package libmaven-compiler-plugin-java. Preparing to unpack .../384-libmaven-compiler-plugin-java_3.13.0-1_all.deb ... Unpacking libmaven-compiler-plugin-java (3.13.0-1) ... Selecting previously unselected package libmaven-dependency-analyzer-java. Preparing to unpack .../385-libmaven-dependency-analyzer-java_1.15.1-1_all.deb ... Unpacking libmaven-dependency-analyzer-java (1.15.1-1) ... Selecting previously unselected package libmaven-dependency-tree-java. Preparing to unpack .../386-libmaven-dependency-tree-java_3.3.0-1_all.deb ... Unpacking libmaven-dependency-tree-java (3.3.0-1) ... Selecting previously unselected package libmaven-reporting-impl-java. Preparing to unpack .../387-libmaven-reporting-impl-java_4.0.0-1_all.deb ... Unpacking libmaven-reporting-impl-java (4.0.0-1) ... Selecting previously unselected package libmaven-dependency-plugin-java. Preparing to unpack .../388-libmaven-dependency-plugin-java_3.8.1-1_all.deb ... Unpacking libmaven-dependency-plugin-java (3.8.1-1) ... Selecting previously unselected package libmaven-invoker-java. Preparing to unpack .../389-libmaven-invoker-java_3.3.0-1_all.deb ... Unpacking libmaven-invoker-java (3.3.0-1) ... Selecting previously unselected package libplexus-interactivity-api-java. Preparing to unpack .../390-libplexus-interactivity-api-java_1.3-1_all.deb ... Unpacking libplexus-interactivity-api-java (1.3-1) ... Selecting previously unselected package libmaven-javadoc-plugin-java. Preparing to unpack .../391-libmaven-javadoc-plugin-java_3.10.1-2_all.deb ... Unpacking libmaven-javadoc-plugin-java (3.10.1-2) ... Selecting previously unselected package libplexus-ant-factory-java. Preparing to unpack .../392-libplexus-ant-factory-java_1.0~alpha2.1-5_all.deb ... Unpacking libplexus-ant-factory-java (1.0~alpha2.1-5) ... Selecting previously unselected package libplexus-container-default1.5-java. Preparing to unpack .../393-libplexus-container-default1.5-java_2.1.1-1_all.deb ... Unpacking libplexus-container-default1.5-java (2.1.1-1) ... Selecting previously unselected package libplexus-bsh-factory-java. Preparing to unpack .../394-libplexus-bsh-factory-java_1.0~alpha7-5_all.deb ... Unpacking libplexus-bsh-factory-java (1.0~alpha7-5) ... Selecting previously unselected package libmaven-plugin-tools-java. Preparing to unpack .../395-libmaven-plugin-tools-java_3.10.2-2_all.deb ... Unpacking libmaven-plugin-tools-java (3.10.2-2) ... Selecting previously unselected package libmaven-reporting-exec-java. Preparing to unpack .../396-libmaven-reporting-exec-java_2.0.0-1_all.deb ... Unpacking libmaven-reporting-exec-java (2.0.0-1) ... Selecting previously unselected package libmaven-resources-plugin-java. Preparing to unpack .../397-libmaven-resources-plugin-java_3.3.1-1_all.deb ... Unpacking libmaven-resources-plugin-java (3.3.1-1) ... Selecting previously unselected package libmaven-site-plugin-java. Preparing to unpack .../398-libmaven-site-plugin-java_3.21.0-1_all.deb ... Unpacking libmaven-site-plugin-java (3.21.0-1) ... Selecting previously unselected package libmaven-source-plugin-java. Preparing to unpack .../399-libmaven-source-plugin-java_3.3.1-1_all.deb ... Unpacking libmaven-source-plugin-java (3.3.1-1) ... Selecting previously unselected package libpaper2:amd64. Preparing to unpack .../400-libpaper2_2.2.5-0.3+b2_amd64.deb ... Unpacking libpaper2:amd64 (2.2.5-0.3+b2) ... Selecting previously unselected package libpaper-utils. Preparing to unpack .../401-libpaper-utils_2.2.5-0.3+b2_amd64.deb ... Unpacking libpaper-utils (2.2.5-0.3+b2) ... Selecting previously unselected package libpicard-java. Preparing to unpack .../402-libpicard-java_3.3.0+dfsg-2_all.deb ... Unpacking libpicard-java (3.3.0+dfsg-2) ... Selecting previously unselected package libpj-java. Preparing to unpack .../403-libpj-java_0.0~20150107+dfsg-5_all.deb ... Unpacking libpj-java (0.0~20150107+dfsg-5) ... Selecting previously unselected package libpkgconf3:amd64. Preparing to unpack .../404-libpkgconf3_1.8.1-4_amd64.deb ... Unpacking libpkgconf3:amd64 (1.8.1-4) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../405-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Selecting previously unselected package libprotobuf32t64:amd64. Preparing to unpack .../406-libprotobuf32t64_3.21.12-11_amd64.deb ... Unpacking libprotobuf32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-lite32t64:amd64. Preparing to unpack .../407-libprotobuf-lite32t64_3.21.12-11_amd64.deb ... Unpacking libprotobuf-lite32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-dev:amd64. Preparing to unpack .../408-libprotobuf-dev_3.21.12-11_amd64.deb ... Unpacking libprotobuf-dev:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-java. Preparing to unpack .../409-libprotobuf-java_3.21.12-11_all.deb ... Unpacking libprotobuf-java (3.21.12-11) ... Selecting previously unselected package libprotoc32t64:amd64. Preparing to unpack .../410-libprotoc32t64_3.21.12-11_amd64.deb ... Unpacking libprotoc32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libreflections-java. Preparing to unpack .../411-libreflections-java_0.10.2+dfsg-2_all.deb ... Unpacking libreflections-java (0.10.2+dfsg-2) ... Selecting previously unselected package libsm6:amd64. Preparing to unpack .../412-libsm6_2%3a1.2.6-1_amd64.deb ... Unpacking libsm6:amd64 (2:1.2.6-1) ... Selecting previously unselected package libsurefire-java. Preparing to unpack .../413-libsurefire-java_2.22.3-4_all.deb ... Unpacking libsurefire-java (2.22.3-4) ... Selecting previously unselected package libtcl8.6:amd64. Preparing to unpack .../414-libtcl8.6_8.6.16+dfsg-1_amd64.deb ... Unpacking libtcl8.6:amd64 (8.6.16+dfsg-1) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../415-libtirpc-common_1.3.6+ds-1_all.deb ... Unpacking libtirpc-common (1.3.6+ds-1) ... Selecting previously unselected package libtirpc3t64:amd64. Preparing to unpack .../416-libtirpc3t64_1.3.6+ds-1_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3 to /lib/x86_64-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3.0.0 to /lib/x86_64-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:amd64 (1.3.6+ds-1) ... Selecting previously unselected package libxft2:amd64. Preparing to unpack .../417-libxft2_2.3.6-1+b4_amd64.deb ... Unpacking libxft2:amd64 (2.3.6-1+b4) ... Selecting previously unselected package libxss1:amd64. Preparing to unpack .../418-libxss1_1%3a1.2.3-1+b3_amd64.deb ... Unpacking libxss1:amd64 (1:1.2.3-1+b3) ... Selecting previously unselected package libtk8.6:amd64. Preparing to unpack .../419-libtk8.6_8.6.16-1_amd64.deb ... Unpacking libtk8.6:amd64 (8.6.16-1) ... Selecting previously unselected package libwagon-file-java. Preparing to unpack .../420-libwagon-file-java_3.5.3-2_all.deb ... Unpacking libwagon-file-java (3.5.3-2) ... Selecting previously unselected package libwagon-http-java. Preparing to unpack .../421-libwagon-http-java_3.5.3-2_all.deb ... Unpacking libwagon-http-java (3.5.3-2) ... Selecting previously unselected package libxml2-utils. Preparing to unpack .../422-libxml2-utils_2.12.7+dfsg+really2.9.14-2.1_amd64.deb ... Unpacking libxml2-utils (2.12.7+dfsg+really2.9.14-2.1) ... Selecting previously unselected package libxt6t64:amd64. Preparing to unpack .../423-libxt6t64_1%3a1.2.1-1.2+b2_amd64.deb ... Unpacking libxt6t64:amd64 (1:1.2.1-1.2+b2) ... Selecting previously unselected package maven. Preparing to unpack .../424-maven_3.9.9-1_all.deb ... Unpacking maven (3.9.9-1) ... Selecting previously unselected package maven-repo-helper. Preparing to unpack .../425-maven-repo-helper_1.11_all.deb ... Unpacking maven-repo-helper (1.11) ... Selecting previously unselected package unzip. Preparing to unpack .../426-unzip_6.0-29_amd64.deb ... Unpacking unzip (6.0-29) ... Selecting previously unselected package maven-debian-helper. Preparing to unpack .../427-maven-debian-helper_2.6.7_all.deb ... Unpacking maven-debian-helper (2.6.7) ... Selecting previously unselected package pkgconf-bin. Preparing to unpack .../428-pkgconf-bin_1.8.1-4_amd64.deb ... Unpacking pkgconf-bin (1.8.1-4) ... Selecting previously unselected package pkgconf:amd64. Preparing to unpack .../429-pkgconf_1.8.1-4_amd64.deb ... Unpacking pkgconf:amd64 (1.8.1-4) ... Selecting previously unselected package protobuf-compiler. Preparing to unpack .../430-protobuf-compiler_3.21.12-11_amd64.deb ... Unpacking protobuf-compiler (3.21.12-11) ... Selecting previously unselected package zip. Preparing to unpack .../431-zip_3.0-15_amd64.deb ... Unpacking zip (3.0-15) ... Selecting previously unselected package xdg-utils. Preparing to unpack .../432-xdg-utils_1.2.1-2_all.deb ... Unpacking xdg-utils (1.2.1-2) ... Selecting previously unselected package r-base-core. Preparing to unpack .../433-r-base-core_4.5.0-3_amd64.deb ... Unpacking r-base-core (4.5.0-3) ... Selecting previously unselected package r-cran-rjava. Preparing to unpack .../434-r-cran-rjava_1.0-11-2_amd64.deb ... Unpacking r-cran-rjava (1.0-11-2) ... Selecting previously unselected package testng. Preparing to unpack .../435-testng_6.9.12-4_all.deb ... Unpacking testng (6.9.12-4) ... Setting up libprotobuf-lite32t64:amd64 (3.21.12-11) ... Setting up media-types (13.0.0) ... Setting up libpipeline1:amd64 (1.5.8-1) ... Setting up fastjar (2:0.98-7) ... Setting up libgraphite2-3:amd64 (1.3.14-2+b1) ... Setting up liblcms2-2:amd64 (2.16-2) ... Setting up libpixman-1-0:amd64 (0.44.0-3) ... Setting up libjcommander-java (1.71-4) ... Setting up libfastutil-java (8.5.15+dfsg-1) ... Setting up libtext-charwidth-perl:amd64 (0.04-11+b4) ... Setting up wdiff (1.2.2-9) ... Setting up libsharpyuv0:amd64 (1.5.0-0.1) ... Setting up libpciaccess0:amd64 (0.17-3+b3) ... Setting up libslf4j-java (1.7.32-2) ... Setting up libprotobuf32t64:amd64 (3.21.12-11) ... Setting up libfile-which-perl (1.27-2) ... Setting up systemd-sysv (257.7-1) ... Setting up libxau6:amd64 (1:1.0.11-1) ... Setting up libxdmcp6:amd64 (1:1.1.5-1) ... Setting up libplexus-utils2-java (3.4.2-1) ... Setting up libnpth0t64:amd64 (1.8-3) ... Setting up libkeyutils1:amd64 (1.6.3-6) ... Setting up libplexus-classworlds-java (2.7.0-1) ... Setting up libxcb1:amd64 (1.17.0-2+b1) ... Setting up libopentest4j-reporting-java (0.1.0-M1-2) ... Setting up libplexus-build-api-java (0.0.7-4) ... Setting up libxcb-xfixes0:amd64 (1.17.0-2+b1) ... Setting up liblerc4:amd64 (4.0.0+ds-5) ... Setting up libjsr305-java (0.1~+svn49-12) ... Setting up bsdextrautils (2.41-5) ... Setting up hicolor-icon-theme (0.18-2) ... Setting up libgatk-native-bindings-java (1.0.0+dfsg-2) ... Setting up libgpg-error0:amd64 (1.51-4) ... Setting up libicu4j-java (73.2-1) ... Setting up java-common (0.76) ... Setting up libdynaloader-functions-perl (0.004-2) ... Setting up libdatrie1:amd64 (0.2.13-3+b1) ... Setting up libobjenesis-java (3.4-2) ... Setting up libclass-method-modifiers-perl (2.15-1) ... Setting up libqdox2-java (2.0.3-1) ... Setting up libaopalliance-java (20070526-7) ... Setting up libcommons-cli-java (1.6.0-1) ... Setting up libmagic-mgc (1:5.46-5) ... Setting up libcommons-exec-java (1.3-3) ... Setting up libxcb-render0:amd64 (1.17.0-2+b1) ... Setting up liblogback-java (1:1.2.11-6) ... Setting up libclone-perl:amd64 (0.47-1+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libglvnd0:amd64 (1.7.0-1+b2) ... Setting up libgoogle-gson-java (2.10.1-1) ... Setting up libtirpc-common (1.3.6+ds-1) ... Setting up libhtml-tagset-perl (3.24-1) ... Setting up libxcb-glx0:amd64 (1.17.0-2+b1) ... Setting up unzip (6.0-29) ... Setting up libdebhelper-perl (13.24.2) ... Setting up libbrotli1:amd64 (1.1.0-2+b7) ... Setting up libedit2:amd64 (3.1-20250104-1) ... Setting up liblwp-mediatypes-perl (6.04-2) ... Setting up libgdk-pixbuf2.0-common (2.42.12+dfsg-4) ... Setting up libmagic1t64:amd64 (1:5.46-5) ... Setting up libpicocli-java (4.6.2-2) ... Setting up libasm-java (9.8-1) ... Setting up x11-common (1:7.7+24) ... Running in chroot, ignoring request. Setting up X socket directories... /tmp/.X11-unix /tmp/.ICE-unix. Setting up libtry-tiny-perl (0.32-1) ... Setting up libsensors-config (1:3.6.2-2) ... Setting up libnghttp2-14:amd64 (1.64.0-1.1) ... Setting up libdeflate0:amd64 (1.23-2) ... Setting up perl-openssl-defaults:amd64 (7+b2) ... Setting up liblog4j1.2-java (1.2.17-11) ... Setting up gettext-base (0.23.1-2) ... Setting up m4 (1.4.19-8) ... Setting up libel-api-java (3.0.0-3) ... Setting up libgcrypt20:amd64 (1.11.0-7) ... Setting up xkb-data (2.42-1) ... Setting up libencode-locale-perl (1.05-3) ... Setting up libplexus-component-annotations-java (2.1.1-1) ... Setting up libxcb-shm0:amd64 (1.17.0-2+b1) ... Setting up libcom-err2:amd64 (1.47.2-3+b3) ... Setting up file (1:5.46-5) ... Setting up libjboss-logging-java (3.5.3-1) ... Setting up libunivocity-parsers-java (2.9.1-1) ... Setting up libtext-wrapi18n-perl (0.06-10) ... Setting up libjbig0:amd64 (2.1-6.1+b2) ... Setting up libelf1t64:amd64 (0.192-4) ... Setting up liboro-java (2.0.8a-15) ... Setting up libsnappy1v5:amd64 (1.2.2-1) ... Setting up libkrb5support0:amd64 (1.21.3-5) ... Setting up libexec-maven-plugin-java (3.1.0-2) ... Setting up libsasl2-modules-db:amd64 (2.1.28+dfsg1-9) ... Setting up tzdata (2025b-4) ... Current default time zone: 'Etc/UTC' Local time is now: Tue Sep 8 23:32:20 UTC 2026. Universal Time is now: Tue Sep 8 23:32:20 UTC 2026. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libxcb-present0:amd64 (1.17.0-2+b1) ... Setting up libgeronimo-annotation-1.3-spec-java (1.3-1) ... Setting up libgeronimo-interceptor-3.0-spec-java (1.0.1-5) ... Setting up libcommons-collections3-java (3.2.2-3) ... Setting up libasound2-data (1.2.14-1) ... Setting up libjavassist-java (1:3.27.0-1) ... Setting up zip (3.0-15) ... Setting up librhino-java (1.7.15-1) ... Setting up autotools-dev (20240727.1) ... Setting up libz3-4:amd64 (4.13.3-1) ... Setting up libblas3:amd64 (3.12.1-4) ... update-alternatives: using /usr/lib/x86_64-linux-gnu/blas/libblas.so.3 to provide /usr/lib/x86_64-linux-gnu/libblas.so.3 (libblas.so.3-x86_64-linux-gnu) in auto mode Setting up libpkgconf3:amd64 (1.8.1-4) ... Setting up libasound2t64:amd64 (1.2.14-1) ... Setting up libjpeg62-turbo:amd64 (1:2.1.5-4) ... Setting up libjaxen-java (1.1.6-5) ... Setting up libapiguardian-java (1.1.2-1) ... Setting up libx11-data (2:1.8.12-1) ... Setting up libepoxy0:amd64 (1.5.10-2) ... Setting up libnspr4:amd64 (2:4.36-1) ... Setting up libxcb-sync1:amd64 (1.17.0-2+b1) ... Setting up libjtidy-java (7+svn20110807-6) ... Setting up libjansi-java (2.4.1-2) ... Setting up libapache-pom-java (33-2) ... Setting up libavahi-common-data:amd64 (0.8-16) ... Setting up libxpp3-java (1.1.4c-4) ... Setting up libatinject-jsr330-api-java (1.0+ds1-6) ... Setting up libdbus-1-3:amd64 (1.16.2-2) ... Setting up libwebsocket-api-java (1.1-2) ... Setting up libfribidi0:amd64 (1.0.16-1) ... Setting up libproc2-0:amd64 (2:4.0.4-9) ... Setting up libplexus-interpolation-java (1.27-1) ... Setting up libunistring5:amd64 (1.3-2) ... Setting up fonts-dejavu-mono (2.37-8) ... Setting up libpng16-16t64:amd64 (1.6.48-1) ... Setting up libxml-commons-resolver1.1-java (1.2-11) ... Setting up libxz-java (1.9-1) ... Setting up libio-html-perl (1.004-3) ... Setting up libtcl8.6:amd64 (8.6.16+dfsg-1) ... Setting up autopoint (0.23.1-2) ... Setting up binfmt-support (2.2.2-7) ... Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of start. Created symlink '/etc/systemd/system/multi-user.target.wants/binfmt-support.service' -> '/usr/lib/systemd/system/binfmt-support.service'. Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Setting up fonts-dejavu-core (2.37-8) ... Setting up libjbzip2-java (0.9.1-8) ... Setting up libpcsclite1:amd64 (2.3.3-1) ... Setting up pkgconf-bin (1.8.1-4) ... Setting up libsensors5:amd64 (1:3.6.2-2) ... Setting up libmongodb-java (3.6.3-2) ... Setting up libk5crypto3:amd64 (1.21.3-5) ... Setting up libactivation-java (1.2.0-2) ... Setting up libhamcrest-java (2.2-2) ... Setting up libbsh-java (2.0b4-20) ... Setting up libjsp-api-java (2.3.4-3) ... Setting up libsasl2-2:amd64 (2.1.28+dfsg1-9) ... Setting up libgfortran5:amd64 (14.2.0-19) ... Setting up libvulkan1:amd64 (1.4.309.0-1) ... Setting up autoconf (2.72-3.1) ... Setting up libnghttp3-9:amd64 (1.8.0-1) ... Setting up libwebp7:amd64 (1.5.0-0.1) ... Setting up libcolt-free-java (1.2.0+dfsg-8) ... Setting up libtimedate-perl (2.3300-2) ... Setting up libgif7:amd64 (5.2.2-1+b1) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up libffi8:amd64 (3.4.8-2) ... Setting up dwz (0.15-1+b1) ... Setting up libplexus-interactivity-api-java (1.3-1) ... Setting up libfreemarker-java (2.3.32-2.1) ... Setting up sensible-utils (0.0.25) ... Setting up libxshmfence1:amd64 (1.3.3-1) ... Setting up libjsoup-java (1.15.3-1) ... Setting up at-spi2-common (2.56.2-1) ... Setting up libcommons-math-java (2.2-9) ... Setting up gpgv (2.4.7-21+b3) ... Setting up libtiff6:amd64 (4.7.0-3) ... Setting up libxcb-randr0:amd64 (1.17.0-2+b1) ... Setting up dbus-session-bus-common (1.16.2-2) ... Setting up libuchardet0:amd64 (0.0.8-1+b2) ... Setting up libassuan9:amd64 (3.0.2-2) ... Setting up libxml-commons-external-java (1.4.01-6) ... Setting up procps (2:4.0.4-9) ... Setting up libxbean-reflect-java (4.5-9) ... Setting up libservlet-api-java (4.0.1-2) ... Setting up libplexus-xml-java (3.0.1-2) ... Setting up librole-tiny-perl (2.002004-1) ... Setting up libopentest4j-java (1.2.0-4) ... Setting up libtasn1-6:amd64 (4.20.0-2) ... Setting up libx11-6:amd64 (2:1.8.12-1) ... Setting up ncbi-vdb-data (3.2.1+dfsg-2) ... Setting up libthai-data (0.1.29-2) ... Setting up netbase (6.5) ... Setting up libcommons-math3-java (3.6.1-4) ... Setting up sgml-base (1.31+nmu1) ... Setting up libsub-quote-perl (2.006008-1) ... Setting up libclass-xsaccessor-perl (1.19-4+b5) ... Setting up libkrb5-3:amd64 (1.21.3-5) ... Setting up libwayland-egl1:amd64 (1.23.1-3) ... Setting up libicu76:amd64 (76.1-4) ... Setting up libmbedcrypto16:amd64 (3.6.4-2) ... Setting up libpaper2:amd64 (2.2.5-0.3+b2) ... Setting up libssh2-1t64:amd64 (1.11.1-1) ... Setting up libhttpcore-java (4.4.16-1) ... Setting up libjoptsimple-java (5.0.4-7) ... Setting up libprotoc32t64:amd64 (3.21.12-11) ... Setting up libxerces2-java (2.12.2-1) ... Setting up libfile-dirlist-perl (0.05-3) ... Setting up dbus-system-bus-common (1.16.2-2) ... Creating group 'messagebus' with GID 997. Creating user 'messagebus' (System Message Bus) with UID 997 and GID 997. Setting up libfile-homedir-perl (1.006-2) ... Setting up libpj-java (0.0~20150107+dfsg-5) ... Setting up openssl (3.5.1-1) ... Setting up libdrm-common (2.4.124-2) ... Setting up libcdi-api-java (1.2-4) ... Setting up libsnappy-jni (1.1.10.7-1) ... Setting up libezmorph-java (1.0.6-4) ... Setting up libxcomposite1:amd64 (1:0.4.6-1) ... Setting up readline-common (8.2-6) ... Setting up libxml2:amd64 (2.12.7+dfsg+really2.9.14-2.1) ... Setting up xdg-utils (1.2.1-2) ... update-alternatives: using /usr/bin/xdg-open to provide /usr/bin/open (open) in auto mode Setting up libldap2:amd64 (2.6.10+dfsg-1) ... Setting up liburi-perl (5.30-1) ... Setting up dbus-bin (1.16.2-2) ... Setting up libfile-touch-perl (0.12-2) ... Setting up dctrl-tools (2.24-3+b1) ... Setting up libxkbcommon0:amd64 (1.7.0-2) ... Setting up libwayland-client0:amd64 (1.23.1-3) ... Setting up libnet-ssleay-perl:amd64 (1.94-3) ... Setting up automake (1:1.17-4) ... update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode Setting up libksba8:amd64 (1.6.7-2+b1) ... Setting up pinentry-curses (1.3.1-2) ... Setting up libdom4j-java (2.1.4-1) ... Setting up libjaxb-api-java (2.3.1-1) ... Setting up libfile-stripnondeterminism-perl (1.14.1-2) ... Setting up libxcb-dri3-0:amd64 (1.17.0-2+b1) ... Setting up libwagon-provider-api-java (3.5.3-2) ... Setting up libllvm19:amd64 (1:19.1.7-3+b1) ... Setting up libwayland-server0:amd64 (1.23.1-3) ... Setting up libx11-xcb1:amd64 (2:1.8.12-1) ... Setting up libice6:amd64 (2:1.1.1-1) ... Setting up libhttp-date-perl (6.06-1) ... Setting up libxstream-java (1.4.21-1) ... Setting up liblapack3:amd64 (3.12.1-4) ... update-alternatives: using /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/x86_64-linux-gnu/liblapack.so.3 (liblapack.so.3-x86_64-linux-gnu) in auto mode Setting up gettext (0.23.1-2) ... Setting up libjetty9-java (9.4.57-1) ... Setting up libxdamage1:amd64 (1:1.1.6-1+b2) ... Setting up libfile-listing-perl (6.16-1) ... Setting up libplexus-languages-java (1.1.1-3) ... Setting up protobuf-compiler (3.21.12-11) ... Setting up libjboss-vfs-java (3.2.15.Final-3) ... Setting up libxrender1:amd64 (1:0.9.12-1) ... Setting up jarwrapper (0.80) ... Setting up libtool (2.5.4-4) ... Setting up fontconfig-config (2.15.0-2.3) ... Setting up libmaven-parent-java (43-2) ... Setting up libcommons-parent-java (56-1) ... Setting up libavahi-common3:amd64 (0.8-16) ... Setting up libcommons-logging-java (1.3.0-2) ... Setting up libxext6:amd64 (2:1.3.4-1+b3) ... Setting up libnet-http-perl (6.23-1) ... Setting up libsisu-inject-java (0.3.5-1) ... Setting up libidn2-0:amd64 (2.3.8-2) ... Setting up libnss3:amd64 (2:3.110-1) ... Setting up dbus-daemon (1.16.2-2) ... Setting up libpaper-utils (2.2.5-0.3+b2) ... Setting up libxom-java (1.3.9-1) ... Setting up libdevel-callchecker-perl:amd64 (0.009-2) ... Setting up libcommons-lang-java (2.6-10) ... Setting up libmaven-dependency-analyzer-java (1.15.1-1) ... Setting up libplexus-cipher-java (2.0-1) ... Setting up pkgconf:amd64 (1.8.1-4) ... Setting up libxxf86vm1:amd64 (1:1.1.4-1+b4) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up libprotobuf-dev:amd64 (3.21.12-11) ... Setting up dh-autoreconf (20) ... Setting up patchutils (0.4.2-1) ... Setting up libcommons-jexl2-java (2.1.1-6) ... Setting up libthai0:amd64 (0.1.29-2+b1) ... Setting up ca-certificates (20250419) ... Updating certificates in /etc/ssl/certs... 150 added, 0 removed; done. Setting up libsisu-plexus-java (0.3.5-1) ... Setting up libglib2.0-0t64:amd64 (2.84.3-1) ... Setting up libmbedx509-7:amd64 (3.6.4-2) ... Setting up libfreetype6:amd64 (2.13.3+dfsg-1) ... Setting up libxfixes3:amd64 (1:6.0.0-2+b4) ... Setting up testng (6.9.12-4) ... Setting up dbus (1.16.2-2) ... Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of start. Setting up shared-mime-info (2.4-5+b2) ... Setting up libp11-kit0:amd64 (0.25.5-3) ... Setting up libxinerama1:amd64 (2:1.1.4-3+b4) ... Setting up libgssapi-krb5-2:amd64 (1.21.3-5) ... Setting up libxrandr2:amd64 (2:1.5.4-1+b3) ... Setting up libcommons-collections4-java (4.4-2) ... Setting up ucf (3.0052) ... Setting up libcommons-lang3-java (3.17.0-1) ... Setting up libmbedtls21:amd64 (3.6.4-2) ... Setting up libreadline8t64:amd64 (8.2-6) ... Setting up dh-strip-nondeterminism (1.14.1-2) ... Setting up libwww-robotrules-perl (6.02-1) ... Setting up libdrm2:amd64 (2.4.124-2) ... Setting up groff-base (1.23.0-9) ... Setting up libwayland-cursor0:amd64 (1.23.1-3) ... Setting up libhtml-parser-perl:amd64 (3.83-1+b2) ... Setting up gpgconf (2.4.7-21+b3) ... Setting up libpam-systemd:amd64 (257.7-1) ... Setting up libcommons-beanutils-java (1.10.1-1.1) ... Setting up libplexus-sec-dispatcher-java (2.0-3) ... Setting up libharfbuzz0b:amd64 (10.2.0-1+b1) ... Setting up libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-4) ... Setting up libsnappy-java (1.1.10.7-1) ... Setting up libxss1:amd64 (1:1.2.3-1+b3) ... Setting up libfontconfig1:amd64 (2.15.0-2.3) ... Setting up ca-certificates-java (20240118) ... No JRE found. Skipping Java certificates setup. Setting up libcommons-configuration-java (1.10-7) ... Setting up libwagon-file-java (3.5.3-2) ... Setting up libxml2-utils (2.12.7+dfsg+really2.9.14-2.1) ... Setting up libcommons-codec-java (1.18.0-1) ... Setting up libsm6:amd64 (2:1.2.6-1) ... Setting up libreflections-java (0.10.2+dfsg-2) ... Setting up libpython3.13-stdlib:amd64 (3.13.5-2) ... Setting up libavahi-client3:amd64 (0.8-16) ... Setting up libio-socket-ssl-perl (2.089-1) ... Setting up gpg (2.4.7-21+b3) ... Created symlink '/etc/systemd/user/sockets.target.wants/keyboxd.socket' -> '/usr/lib/systemd/user/keyboxd.socket'. Setting up libpython3-stdlib:amd64 (3.13.5-1) ... Setting up libhttp-message-perl (7.00-2) ... Setting up libdrm-amdgpu1:amd64 (2.4.124-2) ... Setting up libgnutls30t64:amd64 (3.8.9-3) ... Setting up gtk-update-icon-cache (4.18.6+ds-2) ... Setting up libhttp-negotiate-perl (6.01-2) ... Setting up velocity (1.7-7) ... Setting up fontconfig (2.15.0-2.3) ... Regenerating fonts cache... done. Setting up libxft2:amd64 (2.3.6-1+b4) ... Setting up gpg-agent (2.4.7-21+b3) ... Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-browser.socket' -> '/usr/lib/systemd/user/gpg-agent-browser.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-extra.socket' -> '/usr/lib/systemd/user/gpg-agent-extra.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-ssh.socket' -> '/usr/lib/systemd/user/gpg-agent-ssh.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent.socket' -> '/usr/lib/systemd/user/gpg-agent.socket'. Setting up libatk1.0-0t64:amd64 (2.56.2-1) ... Setting up openjdk-21-jre-headless:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/java to provide /usr/bin/java (java) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jpackage to provide /usr/bin/jpackage (jpackage) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/keytool to provide /usr/bin/keytool (keytool) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/rmiregistry to provide /usr/bin/rmiregistry (rmiregistry) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/lib/jexec to provide /usr/bin/jexec (jexec) in auto mode Setting up libxi6:amd64 (2:1.8.2-1) ... Setting up libtirpc3t64:amd64 (1.3.6+ds-1) ... Setting up libhttp-cookies-perl (6.11-1) ... Setting up python3.13 (3.13.5-2) ... Setting up libcommons-io-java (2.19.0-1) ... Setting up libcommons-digester-java (1.8.1-7) ... Setting up libxtst6:amd64 (2:1.2.5-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libhtml-tree-perl (5.07-3) ... Setting up libtk8.6:amd64 (8.6.16-1) ... Setting up libdistlib-java (1.0-5) ... Setting up libxcursor1:amd64 (1:1.2.3-1) ... Setting up libparams-classify-perl:amd64 (0.015-2+b4) ... Setting up libpango-1.0-0:amd64 (1.56.3-1) ... Setting up libdrm-intel1:amd64 (2.4.124-2) ... Setting up libpsl5t64:amd64 (0.21.2-1.1+b1) ... Setting up libncbi-vdb3:amd64 (3.2.1+dfsg-2) ... Setting up libcloudproviders0:amd64 (0.3.6-2) ... Setting up python3 (3.13.5-1) ... Setting up sopv-gpgv (0.1.4-1) ... update-alternatives: using /usr/bin/sopv-gpgv to provide /usr/bin/sopv (sopv) in auto mode Setting up man-db (2.13.1-1) ... Not building database; man-db/auto-update is not 'true'. Created symlink '/etc/systemd/system/timers.target.wants/man-db.timer' -> '/usr/lib/systemd/system/man-db.timer'. Setting up libcairo2:amd64 (1.18.4-1+b1) ... Setting up libcolord2:amd64 (1.4.7-3) ... Setting up libdconf1:amd64 (0.40.0-5) ... Setting up libmaven-filtering-java (3.4.0-1) ... Setting up dbus-user-session (1.16.2-2) ... Setting up libmaven-resolver-java (1.9.22-1) ... Setting up adwaita-icon-theme (48.1-1) ... update-alternatives: using /usr/share/icons/Adwaita/cursor.theme to provide /usr/share/icons/default/index.theme (x-cursor-theme) in auto mode Setting up libmodule-runtime-perl (0.018-1) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b5) ... Setting up libatspi2.0-0t64:amd64 (2.56.2-1) ... Setting up libxt6t64:amd64 (1:1.2.1-1.2+b2) ... Setting up libhttpclient-java (4.5.14-1) ... Setting up libmaven-common-artifact-filters-java (3.4.0-1) ... Setting up libmaven-dependency-tree-java (3.3.0-1) ... Setting up liblightcouch-java (0.2.0-1) ... Setting up libwagon-http-java (3.5.3-2) ... Setting up libcairo-gobject2:amd64 (1.18.4-1+b1) ... Setting up libmaven-shared-utils-java (3.4.2-1) ... Setting up libpangoft2-1.0-0:amd64 (1.56.3-1) ... Setting up libmaven-resources-plugin-java (3.3.1-1) ... Setting up libcups2t64:amd64 (2.4.10-3) ... Setting up libpangocairo-1.0-0:amd64 (1.56.3-1) ... Setting up libncbi-ngs3:amd64 (3.2.1+dfsg-4) ... Setting up libatk-bridge2.0-0t64:amd64 (2.56.2-1) ... Setting up mesa-libgallium:amd64 (25.0.7-2) ... Setting up libngs-jni:amd64 (3.2.1+dfsg-4) ... Setting up libplexus-io-java (3.3.1-2) ... Setting up libcommons-compress-java (1.27.1-2) ... Setting up libcurl4t64:amd64 (8.14.1-2) ... Setting up libcommons-validator-java (1:1.9.0-1) ... Setting up libgbm1:amd64 (25.0.7-2) ... Setting up libimport-into-perl (1.002005-2) ... Setting up libmoo-perl (2.005005-1) ... Setting up liblog4j2-java (2.19.0-2) ... Setting up libgl1-mesa-dri:amd64 (25.0.7-2) ... Setting up libmaven-invoker-java (3.3.0-1) ... Setting up debhelper (13.24.2) ... Setting up dconf-service (0.40.0-5) ... Setting up r-base-core (4.5.0-3) ... Creating config file /etc/R/Renviron with new version Setting up libmaven-clean-plugin-java (3.2.0-2) ... Setting up libplexus-archiver-java (4.6.1-1) ... Setting up libngs-java:amd64 (3.2.1+dfsg-4) ... Setting up libbarclay-java (5.0.0+dfsg-1) ... Setting up libglx-mesa0:amd64 (25.0.7-2) ... Setting up libglx0:amd64 (1.7.0-1+b2) ... Setting up dconf-gsettings-backend:amd64 (0.40.0-5) ... Setting up libmaven-archiver-java (3.6.2-1) ... Setting up libgl1:amd64 (1.7.0-1+b2) ... Setting up libmaven-source-plugin-java (3.3.1-1) ... Setting up libgtk-3-common (3.24.49-3) ... Setting up libgtk-3-0t64:amd64 (3.24.49-3) ... Setting up liberror-prone-java (2.18.0-1) ... Setting up libwww-perl (6.78-1) ... Setting up devscripts (2.25.15) ... Setting up libguava-java (32.0.1-1) ... Setting up javahelper (0.80) ... Setting up libprotobuf-java (3.21.12-11) ... Setting up libplexus-container-default-java (2.1.1-1) ... Setting up liblwp-protocol-https-perl (6.14-1) ... Setting up libguice-java (5.1.0-1) ... Setting up libplexus-i18n-java (1.0-beta-10-6) ... Setting up libplexus-container-default1.5-java (2.1.1-1) ... Setting up libplexus-velocity-java (1.2-4) ... Setting up libmaven3-core-java (3.9.9-1) ... Setting up libmaven-shared-incremental-java (1.1-6) ... Setting up libmaven-shared-io-java (3.0.0-4) ... Setting up libplexus-bsh-factory-java (1.0~alpha7-5) ... Setting up libplexus-compiler-java (2.13.0-1) ... Setting up libmaven-compiler-plugin-java (3.13.0-1) ... Setting up libmaven-artifact-transfer-java (0.13.1-3) ... Setting up libmaven-file-management-java (3.0.0-2) ... Setting up libbyte-buddy-java (1.14.19-1) ... Setting up libbuild-helper-maven-plugin-java (3.3.0-1) ... Setting up libeasymock-java (5.5.0-1) ... Setting up libmaven-jar-plugin-java (3.3.0-2) ... Setting up libmaven-assembly-plugin-java (3.4.2-2) ... Setting up libcommons-text-java (1.13.1-1) ... Setting up libdoxia-core-java (2.0.0-1) ... Setting up libdoxia-java (2.0.0-1) ... Setting up libmaven-reporting-api-java (4.0.0-1) ... Setting up libmaven-reporting-exec-java (2.0.0-1) ... Processing triggers for libc-bin (2.41-11) ... Processing triggers for systemd (257.7-1) ... Processing triggers for ca-certificates-java (20240118) ... Adding debian:ACCVRAIZ1.pem Adding debian:AC_RAIZ_FNMT-RCM.pem Adding debian:AC_RAIZ_FNMT-RCM_SERVIDORES_SEGUROS.pem Adding debian:ANF_Secure_Server_Root_CA.pem Adding debian:Actalis_Authentication_Root_CA.pem Adding debian:AffirmTrust_Commercial.pem Adding debian:AffirmTrust_Networking.pem Adding debian:AffirmTrust_Premium.pem Adding debian:AffirmTrust_Premium_ECC.pem Adding debian:Amazon_Root_CA_1.pem Adding debian:Amazon_Root_CA_2.pem Adding debian:Amazon_Root_CA_3.pem Adding debian:Amazon_Root_CA_4.pem Adding debian:Atos_TrustedRoot_2011.pem Adding debian:Atos_TrustedRoot_Root_CA_ECC_TLS_2021.pem Adding debian:Atos_TrustedRoot_Root_CA_RSA_TLS_2021.pem Adding debian:Autoridad_de_Certificacion_Firmaprofesional_CIF_A62634068.pem Adding debian:BJCA_Global_Root_CA1.pem Adding debian:BJCA_Global_Root_CA2.pem Adding debian:Baltimore_CyberTrust_Root.pem Adding debian:Buypass_Class_2_Root_CA.pem Adding debian:Buypass_Class_3_Root_CA.pem Adding debian:CA_Disig_Root_R2.pem Adding debian:CFCA_EV_ROOT.pem Adding debian:COMODO_Certification_Authority.pem Adding debian:COMODO_ECC_Certification_Authority.pem Adding debian:COMODO_RSA_Certification_Authority.pem Adding debian:Certainly_Root_E1.pem Adding debian:Certainly_Root_R1.pem Adding debian:Certigna.pem Adding debian:Certigna_Root_CA.pem Adding debian:Certum_EC-384_CA.pem Adding debian:Certum_Trusted_Network_CA.pem Adding debian:Certum_Trusted_Network_CA_2.pem Adding debian:Certum_Trusted_Root_CA.pem Adding debian:CommScope_Public_Trust_ECC_Root-01.pem Adding debian:CommScope_Public_Trust_ECC_Root-02.pem Adding debian:CommScope_Public_Trust_RSA_Root-01.pem Adding debian:CommScope_Public_Trust_RSA_Root-02.pem Adding debian:Comodo_AAA_Services_root.pem Adding debian:D-TRUST_BR_Root_CA_1_2020.pem Adding debian:D-TRUST_BR_Root_CA_2_2023.pem Adding debian:D-TRUST_EV_Root_CA_1_2020.pem Adding debian:D-TRUST_EV_Root_CA_2_2023.pem Adding debian:D-TRUST_Root_Class_3_CA_2_2009.pem Adding debian:D-TRUST_Root_Class_3_CA_2_EV_2009.pem Adding debian:DigiCert_Assured_ID_Root_CA.pem Adding debian:DigiCert_Assured_ID_Root_G2.pem Adding debian:DigiCert_Assured_ID_Root_G3.pem Adding debian:DigiCert_Global_Root_CA.pem Adding debian:DigiCert_Global_Root_G2.pem Adding debian:DigiCert_Global_Root_G3.pem Adding debian:DigiCert_High_Assurance_EV_Root_CA.pem Adding debian:DigiCert_TLS_ECC_P384_Root_G5.pem Adding debian:DigiCert_TLS_RSA4096_Root_G5.pem Adding debian:DigiCert_Trusted_Root_G4.pem Adding debian:Entrust.net_Premium_2048_Secure_Server_CA.pem Adding debian:Entrust_Root_Certification_Authority.pem Adding debian:Entrust_Root_Certification_Authority_-_EC1.pem Adding debian:Entrust_Root_Certification_Authority_-_G2.pem Adding debian:FIRMAPROFESIONAL_CA_ROOT-A_WEB.pem Adding debian:GDCA_TrustAUTH_R5_ROOT.pem Adding debian:GLOBALTRUST_2020.pem Adding debian:GTS_Root_R1.pem Adding debian:GTS_Root_R2.pem Adding debian:GTS_Root_R3.pem Adding debian:GTS_Root_R4.pem Adding debian:GlobalSign_ECC_Root_CA_-_R4.pem Adding debian:GlobalSign_ECC_Root_CA_-_R5.pem Adding debian:GlobalSign_Root_CA.pem Adding debian:GlobalSign_Root_CA_-_R3.pem Adding debian:GlobalSign_Root_CA_-_R6.pem Adding debian:GlobalSign_Root_E46.pem Adding debian:GlobalSign_Root_R46.pem Adding debian:Go_Daddy_Class_2_CA.pem Adding debian:Go_Daddy_Root_Certificate_Authority_-_G2.pem Adding debian:HARICA_TLS_ECC_Root_CA_2021.pem Adding debian:HARICA_TLS_RSA_Root_CA_2021.pem Adding debian:Hellenic_Academic_and_Research_Institutions_ECC_RootCA_2015.pem Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2015.pem Adding debian:HiPKI_Root_CA_-_G1.pem Adding debian:Hongkong_Post_Root_CA_3.pem Adding debian:ISRG_Root_X1.pem Adding debian:ISRG_Root_X2.pem Adding debian:IdenTrust_Commercial_Root_CA_1.pem Adding debian:IdenTrust_Public_Sector_Root_CA_1.pem Adding debian:Izenpe.com.pem Adding debian:Microsec_e-Szigno_Root_CA_2009.pem Adding debian:Microsoft_ECC_Root_Certificate_Authority_2017.pem Adding debian:Microsoft_RSA_Root_Certificate_Authority_2017.pem Adding debian:NAVER_Global_Root_Certification_Authority.pem Adding debian:NetLock_Arany_=Class_Gold=_Főtanúsítvány.pem Adding debian:OISTE_WISeKey_Global_Root_GB_CA.pem Adding debian:OISTE_WISeKey_Global_Root_GC_CA.pem Adding debian:QuoVadis_Root_CA_1_G3.pem Adding debian:QuoVadis_Root_CA_2.pem Adding debian:QuoVadis_Root_CA_2_G3.pem Adding debian:QuoVadis_Root_CA_3.pem Adding debian:QuoVadis_Root_CA_3_G3.pem Adding debian:SSL.com_EV_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_EV_Root_Certification_Authority_RSA_R2.pem Adding debian:SSL.com_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_Root_Certification_Authority_RSA.pem Adding debian:SSL.com_TLS_ECC_Root_CA_2022.pem Adding debian:SSL.com_TLS_RSA_Root_CA_2022.pem Adding debian:SZAFIR_ROOT_CA2.pem Adding debian:Sectigo_Public_Server_Authentication_Root_E46.pem Adding debian:Sectigo_Public_Server_Authentication_Root_R46.pem Adding debian:SecureSign_Root_CA12.pem Adding debian:SecureSign_Root_CA14.pem Adding debian:SecureSign_Root_CA15.pem Adding debian:SecureTrust_CA.pem Adding debian:Secure_Global_CA.pem Adding debian:Security_Communication_ECC_RootCA1.pem Adding debian:Security_Communication_RootCA2.pem Adding debian:Starfield_Class_2_CA.pem Adding debian:Starfield_Root_Certificate_Authority_-_G2.pem Adding debian:Starfield_Services_Root_Certificate_Authority_-_G2.pem Adding debian:SwissSign_Gold_CA_-_G2.pem Adding debian:T-TeleSec_GlobalRoot_Class_2.pem Adding debian:T-TeleSec_GlobalRoot_Class_3.pem Adding debian:TUBITAK_Kamu_SM_SSL_Kok_Sertifikasi_-_Surum_1.pem Adding debian:TWCA_CYBER_Root_CA.pem Adding debian:TWCA_Global_Root_CA.pem Adding debian:TWCA_Root_Certification_Authority.pem Adding debian:Telekom_Security_TLS_ECC_Root_2020.pem Adding debian:Telekom_Security_TLS_RSA_Root_2023.pem Adding debian:TeliaSonera_Root_CA_v1.pem Adding debian:Telia_Root_CA_v2.pem Adding debian:TrustAsia_Global_Root_CA_G3.pem Adding debian:TrustAsia_Global_Root_CA_G4.pem Adding debian:Trustwave_Global_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P256_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P384_Certification_Authority.pem Adding debian:TunTrust_Root_CA.pem Adding debian:UCA_Extended_Validation_Root.pem Adding debian:UCA_Global_G2_Root.pem Adding debian:USERTrust_ECC_Certification_Authority.pem Adding debian:USERTrust_RSA_Certification_Authority.pem Adding debian:XRamp_Global_CA_Root.pem Adding debian:certSIGN_ROOT_CA.pem Adding debian:certSIGN_Root_CA_G2.pem Adding debian:e-Szigno_Root_CA_2017.pem Adding debian:ePKI_Root_Certification_Authority.pem Adding debian:emSign_ECC_Root_CA_-_C3.pem Adding debian:emSign_ECC_Root_CA_-_G3.pem Adding debian:emSign_Root_CA_-_C1.pem Adding debian:emSign_Root_CA_-_G1.pem Adding debian:vTrus_ECC_Root_CA.pem Adding debian:vTrus_Root_CA.pem done. Setting up maven (3.9.9-1) ... update-alternatives: using /usr/share/maven/bin/mvn to provide /usr/bin/mvn (mvn) in auto mode Setting up openjdk-21-jre:amd64 (21.0.8+9-1) ... Setting up ant (1.10.15-1) ... Setting up junit4 (4.13.2-5) ... Setting up openjdk-21-jdk-headless:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jar to provide /usr/bin/jar (jar) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jarsigner to provide /usr/bin/jarsigner (jarsigner) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javac to provide /usr/bin/javac (javac) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javadoc to provide /usr/bin/javadoc (javadoc) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javap to provide /usr/bin/javap (javap) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jcmd to provide /usr/bin/jcmd (jcmd) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdb to provide /usr/bin/jdb (jdb) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdeprscan to provide /usr/bin/jdeprscan (jdeprscan) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdeps to provide /usr/bin/jdeps (jdeps) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jfr to provide /usr/bin/jfr (jfr) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jimage to provide /usr/bin/jimage (jimage) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jinfo to provide /usr/bin/jinfo (jinfo) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jlink to provide /usr/bin/jlink (jlink) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jmap to provide /usr/bin/jmap (jmap) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jmod to provide /usr/bin/jmod (jmod) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jps to provide /usr/bin/jps (jps) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jrunscript to provide /usr/bin/jrunscript (jrunscript) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jshell to provide /usr/bin/jshell (jshell) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstack to provide /usr/bin/jstack (jstack) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstat to provide /usr/bin/jstat (jstat) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstatd to provide /usr/bin/jstatd (jstatd) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jwebserver to provide /usr/bin/jwebserver (jwebserver) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/serialver to provide /usr/bin/serialver (serialver) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jhsdb to provide /usr/bin/jhsdb (jhsdb) in auto mode Setting up default-jre-headless (2:1.21-76) ... Setting up ant-contrib (1.0~b3+svn177-12) ... Setting up maven-repo-helper (1.11) ... Setting up default-jre (2:1.21-76) ... Setting up libmaven-antrun-plugin-java (3.1.0-1) ... Setting up libplexus-ant-factory-java (1.0~alpha2.1-5) ... Setting up openjdk-21-jdk:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jconsole to provide /usr/bin/jconsole (jconsole) in auto mode Setting up default-jdk-headless (2:1.21-76) ... Setting up libjsap-java (2.1-5) ... Setting up r-cran-rjava (1.0-11-2) ... Setting up libdsiutils-java (2.7.3+dfsg-1) ... Setting up junit5 (5.10.3-1) ... Setting up libjson-java (3.1.0+dfsg-2) ... Setting up libhtsjdk-java (4.1.3+dfsg-2) ... Setting up libmaven-plugin-tools-java (3.10.2-2) ... Setting up libgkl-java (0.8.11+dfsg-2) ... Setting up default-jdk (2:1.21-76) ... Setting up libpicard-java (3.3.0+dfsg-2) ... Setting up libicb-utils-java (2.0.1+git20161002.afee1d9-5) ... Processing triggers for sgml-base (1.31+nmu1) ... Setting up libvelocity-tools-java (2.0-9) ... Setting up libdoxia-sitetools-java (2.0.0-1) ... Setting up libmaven-site-plugin-java (3.21.0-1) ... Setting up libmaven-javadoc-plugin-java (3.10.1-2) ... Setting up libmaven-reporting-impl-java (4.0.0-1) ... Setting up libsurefire-java (2.22.3-4) ... Setting up libmaven-dependency-plugin-java (3.8.1-1) ... Setting up maven-debian-helper (2.6.7) ... Processing triggers for ca-certificates (20250419) ... Updating certificates in /etc/ssl/certs... 0 added, 0 removed; done. Running hooks in /etc/ca-certificates/update.d... done. Processing triggers for ca-certificates-java (20240118) ... done. Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/reproducible-path/libgoby-java-3.3.1+dfsg2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../libgoby-java_3.3.1+dfsg2-11_source.changes dpkg-buildpackage: info: source package libgoby-java dpkg-buildpackage: info: source version 3.3.1+dfsg2-11 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Pierre Gruet dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean --with javahelper dh_auto_clean bash -c "for dir in \$(find . -name target -type d); do if [ -f \$(echo \$dir | sed -e s/target\$/pom.xml/) ]; then rm -Rf \$dir; fi done" mh_unpatchpoms -plibgoby-io-java jh_clean Duplicate specification "unlink|u" for option "u" debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' dh_clean rm -rf goby-distribution/test-data goby-distribution/test-results rm -rf test-results/ make[1]: Leaving directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' debian/rules binary dh binary --with javahelper dh_update_autotools_config dh_autoreconf dh_auto_configure mh_patchpoms -plibgoby-io-java --debian-build --keep-pom-version --maven-repo=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo jh_linkjars dh_auto_build /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode package -DskipTests -Dnotimestamp=true -Dlocale=en_US OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] The artifact org.apache.maven.plugins:maven-surefire-plugin:jar:2.17 has been relocated to org.apache.maven.plugins:maven-surefire-plugin:jar:2.22.3 [WARNING] The artifact org.apache.maven.plugins:maven-jar-plugin:jar:3.1.2 has been relocated to org.apache.maven.plugins:maven-jar-plugin:jar:3.3.0 [WARNING] Parameter 'additionalparam' is unknown for plugin 'maven-javadoc-plugin:3.10.1:jar (attach-javadocs)' [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] [mkdir] Created dir: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-io --- [INFO] Copying 2 resources from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-io --- [INFO] Recompiling the module because of changed source code. [INFO] Compiling 260 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- antrun:3.1.0:run (default) @ goby-io --- [WARNING] Parameter 'tasks' is deprecated: Use target instead. For version 3.0.0, this parameter is only defined to break the build if you use it! [WARNING] Parameter tasks is deprecated, use target instead [INFO] Executing tasks [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2 [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/classes [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-io --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-io --- [INFO] No sources to compile [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-io --- [INFO] Tests are skipped. [INFO] [INFO] --- jar:3.3.0:jar (default-jar) @ goby-io --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1.jar [INFO] [INFO] >>> source:3.3.1:jar (attach-sources) > generate-sources @ goby-io >>> [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] <<< source:3.3.1:jar (attach-sources) < generate-sources @ goby-io <<< [INFO] [INFO] [INFO] --- source:3.3.1:jar (attach-sources) @ goby-io --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1-sources.jar [INFO] [INFO] --- javadoc:3.10.1:jar (attach-javadocs) @ goby-io --- [INFO] Adding the --ignore-source-errors option [INFO] No previous run data found, generating javadoc. [WARNING] Javadoc Warnings [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:26: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:68: error: cannot find symbol [WARNING] Rengine rEngine; [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class FisherExactRCalculator [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactTestCalculator.java:21: error: package DistLib does not exist [WARNING] import DistLib.hypergeometric; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/EstimatedDistribution.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AnnotationAveragingWriter.java:39: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:32: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:43: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:44: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:45: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Unmarshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:76: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class StatsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:34: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:35: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:36: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Marshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlRootElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:31: error: cannot find symbol [WARNING] @XmlRootElement [WARNING] ^ [WARNING] symbol: class XmlRootElement [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:696: error: cannot find symbol [WARNING] private void writeXml(PrintWriter output, String[] samples, MethylStats[] methylStats) throws JAXBException { [WARNING] ^ [WARNING] symbol: class JAXBException [WARNING] location: class MethylStatsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/SimulateBisulfiteReads.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:30: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.CommandLine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:31: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.DefaultExecutor; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:32: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.PumpStreamHandler; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/TestRConnectionMode.java:25: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/PercentMismatchesQualityFilter.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:39: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:40: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelRegion; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:41: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:53: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:54: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:55: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Marshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:106: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:325: error: cannot find symbol [WARNING] protected synchronized ParallelTeam getParallelTeam() { [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:23: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlElementWrapper; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:24: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlRootElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:32: error: cannot find symbol [WARNING] @XmlRootElement(name = "info-output") [WARNING] ^ [WARNING] symbol: class XmlRootElement [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:441: error: cannot find symbol [WARNING] private void writeInfoOutput() throws JAXBException, IOException { [WARNING] ^ [WARNING] symbol: class JAXBException [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessorType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: class XmlAccessorType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessorType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: class XmlAccessorType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:283: error: cannot find symbol [WARNING] class BasenameParallelRegion extends ParallelRegion { [WARNING] ^ [WARNING] symbol: class ParallelRegion [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/FastaToCompactMode.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.PJProperties; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/BetweenGroupSequenceVariationOutputFormat.java:40: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/CompareGroupsVCFOutputFormat.java:42: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/MethylationRateVCFOutputFormat.java:45: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/FoldChangeForExonPairs.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/PlantIndels.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:24: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelRegion; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:31: error: cannot find symbol [WARNING] class BasenameParallelRegion extends ParallelRegion { [WARNING] ^ [WARNING] symbol: class ParallelRegion [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:21: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:33: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class DoInParallel [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:47: error: cannot find symbol [WARNING] protected synchronized ParallelTeam getParallelTeam() { [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class DoInParallel [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/FisherExactTestAdaptor.java:23: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/methylation/MethylSimilarityScan.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:23: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RMainLoopCallbacks; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:24: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:29: error: cannot find symbol [WARNING] class RLoggerMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ [WARNING] symbol: class RMainLoopCallbacks [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:42: error: cannot find symbol [WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:57: error: cannot find symbol [WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:77: error: cannot find symbol [WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:88: error: cannot find symbol [WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:99: error: cannot find symbol [WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:108: error: cannot find symbol [WARNING] public void rFlushConsole(final Rengine rengine) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:118: error: cannot find symbol [WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:127: error: cannot find symbol [WARNING] public void rLoadHistory(final Rengine re, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:24: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:56: error: cannot find symbol [WARNING] private Rengine rengine; [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class GobyRengine [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:127: error: cannot find symbol [WARNING] public Rengine getRengine() { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class GobyRengine [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:27: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.REXP; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:28: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RVector; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:29: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:208: error: cannot find symbol [WARNING] private static Result evaluateFisherExpression(final Rengine rengine, [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class FisherExact [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:21: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RMainLoopCallbacks; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:22: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:27: error: cannot find symbol [WARNING] class RConsoleMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ [WARNING] symbol: class RMainLoopCallbacks [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:35: error: cannot find symbol [WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:50: error: cannot find symbol [WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:70: error: cannot find symbol [WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:81: error: cannot find symbol [WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:92: error: cannot find symbol [WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:101: error: cannot find symbol [WARNING] public void rFlushConsole(final Rengine rengine) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:111: error: cannot find symbol [WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:120: error: cannot find symbol [WARNING] public void rLoadHistory(final Rengine re, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: variable XmlAccessType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:35: error: cannot find symbol [WARNING] @XmlElement(name = "al") [WARNING] ^ [WARNING] symbol: class XmlElement [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:36: error: cannot find symbol [WARNING] @XmlElementWrapper(name = "annotation-lengths") [WARNING] ^ [WARNING] symbol: class XmlElementWrapper [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: variable XmlAccessType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:39: error: cannot find symbol [WARNING] @XmlElement(name = "tc") [WARNING] ^ [WARNING] symbol: class XmlElement [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:40: error: cannot find symbol [WARNING] @XmlElementWrapper(name = "total-counts") [WARNING] ^ [WARNING] symbol: class XmlElementWrapper [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/dsv/CommonIndelArtifactFilter.java:17: warning: invalid input: '<' [WARNING] * larger than expected (P<0.05, with Poisson cumulative distribution) from prior observations (most of them are assumed to be errors). [WARNING] ^ [WARNING] 100 warnings [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1-javadoc.jar [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] Parameter 'additionalparam' is unknown for plugin 'maven-javadoc-plugin:3.10.1:jar (attach-javadocs)' [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-distribution --- [INFO] Copying 3 resources from src/main/resources to target/classes [INFO] Copying 72 resources from src/main/java to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 525 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-distribution --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 120 source files with javac [debug target 1.8] to target/test-classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-distribution --- [INFO] Tests are skipped. [INFO] [INFO] --- jar:3.3.0:jar (default-jar) @ goby-distribution --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1.jar [INFO] [INFO] >>> source:3.3.1:jar (attach-sources) > generate-sources @ goby-distribution >>> [INFO] [INFO] <<< source:3.3.1:jar (attach-sources) < generate-sources @ goby-distribution <<< [INFO] [INFO] [INFO] --- source:3.3.1:jar (attach-sources) @ goby-distribution --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1-sources.jar [INFO] [INFO] --- javadoc:3.10.1:jar (attach-javadocs) @ goby-distribution --- [INFO] Adding the --ignore-source-errors option [INFO] No previous run data found, generating javadoc. [WARNING] Javadoc Warnings [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/dsv/CommonIndelArtifactFilter.java:17: warning: invalid input: '<' [WARNING] * larger than expected (P<0.05, with Poisson cumulative distribution) from prior observations (most of them are assumed to be errors). [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticCoder.java:56: warning: reference not found: it.unimi.dsi.mg4j.io.ArithmeticDecoder [WARNING] * @see it.unimi.dsi.mg4j.io.ArithmeticDecoder (MG4J). [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoder.java:33: warning: reference not found: it.unimi.dsi.mg4j.io.ArithmeticDecoder [WARNING] * @see it.unimi.dsi.mg4j.io.ArithmeticDecoder (MG4J) [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:60: warning: @return tag cannot be used in method with void return type. [WARNING] void flush(InputBitStream ibs) throws IOException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:72: warning: reference not found: org.campagnelab.goby.aligners.LastagAligner [WARNING] * @see org.campagnelab.goby.aligners.LastagAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:79: warning: reference not found: org.campagnelab.goby.aligners.LastAligner [WARNING] * @see org.campagnelab.goby.aligners.LastAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:87: warning: reference not found: org.campagnelab.goby.aligners.BWAAligner [WARNING] * @see org.campagnelab.goby.aligners.BWAAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:95: warning: reference not found: org.campagnelab.goby.aligners.GSnapAligner [WARNING] * @see org.campagnelab.goby.aligners.GSnapAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:131: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * @return the next {@link edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/MoveToFrontCoder.java:42: warning: invalid input: '<' [WARNING] * @param symbol Symbol to encode with move to front (precondition: 0<= symbol ?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/QualityEncoding.java:41: warning: invalid input: '<' [WARNING] * !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparison.java:233: warning: @return tag cannot be used in method with void return type. [WARNING] public void setCountComparisonFailures(final boolean countComparisonFailures) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparison.java:275: warning: @return tag cannot be used in method with void return type. [WARNING] public void setAllowSourceNs(boolean allowSourceNs) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparisonInterface.java:130: warning: @return tag cannot be used in method with void return type. [WARNING] public void setAllowSourceNs(boolean allowSourceNs); [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SAMComparisonMode.java:214: warning: @return tag cannot be used in method with void return type. [WARNING] public void setCheckMate(final boolean checkMate) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SamExtractReadsMode.java:44: warning: invalid input: '<' [WARNING] * WARNING: If the file contains pairs, the source SAM/BAM file >>MUST<< be sorted by read name. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SamExtractReadsMode.java:44: warning: invalid input: '<' [WARNING] * WARNING: If the file contains pairs, the source SAM/BAM file >>MUST<< be sorted by read name. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SampleQualityScoresMode.java:176: warning: invalid input: '<' [WARNING] * Set to <= 0 to process the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '&' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '&' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '<' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SortMode.java:142: warning: invalid input: '<' [WARNING] * Set to < 0 for auto-detect number of cores. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/vcf/VCFParser.java:179: warning: invalid input: '<' [WARNING] * Set to <= 0 to scan the entire file. This must be set before calling readHeader() for the value to be used. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] 91 warnings [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1-javadoc.jar [INFO] [INFO] --- assembly:3.4.2:single (make-assembly) @ goby-distribution --- [WARNING] Parameter 'finalName' is read-only, must not be used in configuration [INFO] Reading assembly descriptor: assembly/assembly.xml [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-bin.jar [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.062 s] [INFO] Goby I/O ........................................... SUCCESS [ 25.186 s] [INFO] Goby Full Distribution ............................. SUCCESS [ 36.572 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 01:01 min [INFO] Finished at: 2026-09-08T11:36:40-12:00 [INFO] ------------------------------------------------------------------------ debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' # Create a symlink to the directory with test data for tests run from the # goby-distribution directory. ln -s ../test-data goby-distribution/test-data # The test-results directory should exist because test classes will write inside. if [ ! -e test-results ]; then mkdir test-results/; fi # Putting the JRI location in the path, as indicated in GobyRengine.java. # Also indicating R_HOME, as found in http://rforge.net/JRI/. export LD_LIBRARY_PATH="$LD_LIBRARY_PATH:/usr/lib/R/site-library/rJava/jri" && \ export R_HOME="/usr/lib/R" && \ dh_auto_test --no-parallel /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode test OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] The artifact org.apache.maven.plugins:maven-surefire-plugin:jar:2.17 has been relocated to org.apache.maven.plugins:maven-surefire-plugin:jar:2.22.3 [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-io --- [INFO] Copying 2 resources from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-io --- [INFO] Recompiling the module because of changed source code. [INFO] Compiling 260 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- antrun:3.1.0:run (default) @ goby-io --- [WARNING] Parameter 'tasks' is deprecated: Use target instead. For version 3.0.0, this parameter is only defined to break the build if you use it! [WARNING] Parameter tasks is deprecated, use target instead [INFO] Executing tasks [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2 [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/classes [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-io --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-io --- [INFO] No sources to compile [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-io --- [INFO] No tests to run. [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-distribution --- [INFO] Copying 3 resources from src/main/resources to target/classes [INFO] Copying 72 resources from src/main/java to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 525 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-distribution --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 120 source files with javac [debug target 1.8] to target/test-classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-distribution --- [INFO] [INFO] ------------------------------------------------------- [INFO] T E S T S [INFO] ------------------------------------------------------- [INFO] Running TestSuite 11:36:59.262 INFO TestPostBarcodeMatcher - Num matches = 200, Num Ambiguous = 0, Num no matches = 0 11:36:59.267 INFO TestPostBarcodeMatcher - Time to parse 8 million reads 0 seconds SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/share/java/slf4j-simple.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven-repo/ch/qos/logback/logback-classic/debian/logback-classic-debian.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/share/java/logback-classic.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. SLF4J: Actual binding is of type [org.slf4j.impl.SimpleLoggerFactory] Creating base test directory: test-results/stats [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. 11:36:59.447 INFO RLoggerMainLoopCallback - 11:36:59.448 INFO RLoggerMainLoopCallback - R version 4.5.0 (2025-04-11) -- "How About a Twenty-Six" Copyright (C) 2025 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu 11:36:59.448 INFO RLoggerMainLoopCallback - R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. 11:36:59.448 INFO RLoggerMainLoopCallback - R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. 11:36:59.448 INFO RLoggerMainLoopCallback - Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. ##fileformat=VCFv4.1 ##Goby=UNKNOWN ##FieldGroupAssociations=CHROM=genomic-coordinate,CHROM=cross-sample-field,POS=genomic-coordinate,POS=cross-sample-field,ID=external-identifiers,ID=cross-sample-field,REF=cross-sample-field,ALT=cross-sample-field,QUAL=cross-sample-field,FILTER=cross-sample-field,INFO=cross-sample-field,INFO/p-value1=cross-sample-field,INFO/p-value1=p-value,INFO/p-value2=cross-sample-field,INFO/p-value2=p-value,INFO/#Cm_Group[Group_1]=cross-sample-field,INFO/#Cm_Group[Group_1]=#Cm,FORMAT/Zygosity=zygozity,FORMAT/Zygosity=sample-data,FORMAT/Another=another,FORMAT/Another=sample-data, ##INFO= ##INFO= ##INFO= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SampleA SampleB 11:36:59.723 INFO BullardUpperQuartileNormalization - normalization denominator 55731.7 for sample B-7 11:36:59.723 INFO BullardUpperQuartileNormalization - normalization denominator 55210.1 for sample B-3 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 114146 for sample A-3 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 110048 for sample A-12 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 55508.1 for sample B-15 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 56178.7 for sample B-14 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 57370.8 for sample B-11 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 110495 for sample A-17 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 57892.4 for sample B-2 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 57668.9 for sample B-10 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 110793 for sample A-16 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 56402.2 for sample B-8 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 54316.0 for sample B-4 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 113773 for sample A-2 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 108781 for sample A-0 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 55359.1 for sample B-6 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 111687 for sample A-9 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 109899 for sample A-8 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 114071 for sample A-5 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 110569 for sample A-4 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 113177 for sample A-6 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 113102 for sample A-7 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 56923.8 for sample B-5 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 114071 for sample A-10 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 109303 for sample A-14 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 55061.1 for sample B-9 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 112059 for sample A-1 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 56029.7 for sample B-0 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 56700.3 for sample B-12 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 57147.3 for sample B-13 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 113401 for sample A-19 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 110718 for sample A-18 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 112208 for sample A-15 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 56029.7 for sample B-1 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 112953 for sample A-13 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 112581 for sample A-11 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 57668.9 for sample B-16 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 56774.8 for sample B-17 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 55880.7 for sample B-19 11:36:59.731 INFO BullardUpperQuartileNormalization - normalization denominator 57519.8 for sample B-18 11:36:59.802 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value 11:36:59.846 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. 11:36:59.846 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value 11:36:59.859 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. 11:36:59.859 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value 11:36:59.996 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. 11:37:00.046 INFO FDRAdjustment - ... statistic t-test-P-value-Bonferroni-adjusted was found, FDR adjustment executed. 11:37:00.047 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value 11:37:00.174 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. 11:37:00.192 INFO FDRAdjustment - ... statistic another-p-value-Bonferroni-adjusted was found, FDR adjustment executed. list3:element-id p-value p-value-BH-FDR-q-value [ 0 [2.354054E-7, 1.177027E-5] ] [ 1 [2.10159E-5, 4.294736666666667E-4] ] [ 2 [2.576842E-5, 4.294736666666667E-4] ] [ 3 [9.814783E-5, 9.471342857142858E-4] ] [ 4 [1.05261E-4, 9.471342857142858E-4] ] [ 5 [1.241481E-4, 9.471342857142858E-4] ] [ 6 [1.325988E-4, 9.471342857142858E-4] ] [ 7 [1.568503E-4, 9.803143750000002E-4] ] [ 8 [2.254557E-4, 0.0012525316666666666] ] [ 9 [3.79538E-4, 0.00189769] ] [ 10 [6.114943E-4, 0.0027795195454545455] ] [ 11 [0.001613954, 0.006724808333333334] ] [ 12 [0.00330243, 0.012636935714285714] ] [ 13 [0.003538342, 0.012636935714285714] ] [ 14 [0.005236997, 0.017456656666666667] ] [ 15 [0.006831909, 0.020762429411764708] ] [ 16 [0.007059226, 0.020762429411764708] ] [ 17 [0.008805129, 0.024458691666666667] ] [ 18 [0.00940104, 0.02473957894736842] ] [ 19 [0.01129798, 0.028244949999999998] ] [ 20 [0.02115017, 0.050357547619047614] ] [ 21 [0.04922736, 0.11188036363636364] ] [ 22 [0.06053298, 0.1304633125] ] [ 23 [0.06262239, 0.1304633125] ] [ 24 [0.07395153, 0.14790306] ] [ 25 [0.08281103, 0.15925198076923075] ] [ 26 [0.08633331, 0.1598765] ] [ 27 [0.1190654, 0.21261678571428572] ] [ 28 [0.1890796, 0.32599931034482754] ] [ 29 [0.2058494, 0.3430823333333333] ] [ 30 [0.2209214, 0.3563248387096774] ] [ 31 [0.2856, 0.44625000000000004] ] [ 32 [0.3048895, 0.4619537878787878] ] [ 33 [0.4660682, 0.6835770833333333] ] [ 34 [0.4830809, 0.6835770833333333] ] [ 35 [0.4921755, 0.6835770833333333] ] [ 36 [0.5319453, 0.718845] ] [ 37 [0.575155, 0.7414352564102564] ] [ 38 [0.5783195, 0.7414352564102564] ] [ 39 [0.6185894, 0.7626062790697675] ] [ 40 [0.636362, 0.7626062790697675] ] [ 41 [0.6448587, 0.7626062790697675] ] [ 42 [0.6558414, 0.7626062790697675] ] [ 43 [0.6885884, 0.7824868181818182] ] [ 44 [0.7189864, 0.7988737777777778] ] [ 45 [0.8179539, 0.8802645744680851] ] [ 46 [0.8274487, 0.8802645744680851] ] [ 47 [0.89713, 0.9304775510204082] ] [ 48 [0.911868, 0.9304775510204082] ] [ 49 [0.943789, 0.943789] ] element-id average RPKM group A(AC) average RPKM group B(AC) average log2_RPKM group A(AC) average log2_RPKM group B(AC) average count group A average count group B [ id-1 [1.0027385888732063, 0.49859021162242134, 0.003945548431445906, -1.0040735349267995, 0.0, 0.0] ] truncated fdr=3.53108e-05 original=3.53108e-05 truncated fdr=0.00128842 original=0.00128842 truncated fdr=0.00128842 original=0.00128842 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00294094 original=0.00294094 truncated fdr=0.00375760 original=0.00375760 truncated fdr=0.00569307 original=0.00569307 truncated fdr=0.00833856 original=0.00833856 truncated fdr=0.0201744 original=0.0201744 truncated fdr=0.0379108 original=0.0379108 truncated fdr=0.0379108 original=0.0379108 truncated fdr=0.0523700 original=0.0523700 truncated fdr=0.0622873 original=0.0622873 truncated fdr=0.0622873 original=0.0622873 truncated fdr=0.0733761 original=0.0733761 truncated fdr=0.0742187 original=0.0742187 truncated fdr=0.0847349 original=0.0847349 truncated fdr=0.151073 original=0.151073 truncated fdr=0.335641 original=0.335641 truncated fdr=0.391390 original=0.391390 truncated fdr=0.391390 original=0.391390 truncated fdr=0.443709 original=0.443709 truncated fdr=0.477756 original=0.477756 truncated fdr=0.479630 original=0.479630 truncated fdr=0.637850 original=0.637850 truncated fdr=0.977998 original=0.977998 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. Creating base test directory: test-results/stats-writer allele: A ref: [CC] alt: [T]11:37:12.719 WARN MessageChunksWriter - Using chunk-size=10000 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) 11:37:13.176 WARN GobyVersion - Version number UNKNOWN not recognized. Assuming this version is the most recent. [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.258 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.261 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.263 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.265 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.267 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.269 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.271 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.273 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.275 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.277 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.463 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.465 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.467 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.468 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.470 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.472 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.473 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.475 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.477 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.478 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.554 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.555 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.556 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.558 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.560 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.561 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.563 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.564 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.565 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.567 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.637 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.638 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.639 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.641 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.642 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.644 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.645 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.647 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.648 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.649 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.747 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.748 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.750 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.751 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.752 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.753 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.755 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.757 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.758 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.760 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.827 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.828 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.829 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.830 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.831 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.832 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.833 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.834 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.835 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.836 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.897 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.899 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.900 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.901 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.903 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.904 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.905 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.907 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.908 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.910 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.966 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.967 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.968 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.969 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.970 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.971 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.973 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.974 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.976 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.977 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.037 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.038 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.039 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.040 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.041 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.042 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.043 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.044 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.045 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.046 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.101 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.102 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.103 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.104 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.105 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.106 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.107 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.108 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.109 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.110 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.167 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.168 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.169 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.170 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.171 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.172 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.173 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.174 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.174 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.175 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Methylation format ignores thresholdDistinctReadIndices. Additionally, the minimum coverage needed for a site to be reported can be changed with --minimum-variation-support. Filtering reads that have these criteria: [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest_mci [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.236 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.237 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.238 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.239 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.240 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.241 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.242 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.243 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.244 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.245 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + /T q=40 s=0 info: - /T q=40 s=0 info: + /C q=10 s=0 info: + /C q=20 s=0 info: + /C q=30 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=10 s=0 info: + /C q=20 s=0 info: + /N q=30 s=0 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + /T q=40 s=1 info: + /T q=10 s=1 info: + /T q=20 s=1 info: + /T q=30 s=1 info: + /N q=40 s=1 info: + /N q=40 s=1 list: pos=-1 #bases: 33 #indels: 0 filtered: {+ ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + /C q=10 s=0, + /C q=20 s=0, + /C q=30 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=10 s=0, + /C q=20 s=0, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + /T q=40 s=1, + /T q=10 s=1, + /T q=20 s=1, + /T q=30 s=1, + /N q=40 s=1, + /N q=40 s=1} Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 1/1 ..T Loading test-data/fdr-mode/file1.vcf Loading test-data/fdr-mode/file2.vcf Loading test-data/fdr-mode/file3.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file1.vcf Combining test-data/fdr-mode/file2.vcf Combining test-data/fdr-mode/file3.vcf Loading test-data/fdr-mode/file-B-1.vcf Loading test-data/fdr-mode/file-B-2.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file-B-1.vcf Combining test-data/fdr-mode/file-B-2.vcf Loading test-data/fdr-mode/file-B-1.vcf Loading test-data/fdr-mode/file-B-2.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file-B-1.vcf Combining test-data/fdr-mode/file-B-2.vcf Loading test-data/fdr-mode/file1.vcf Loading test-data/fdr-mode/file2.vcf Loading test-data/fdr-mode/file3.vcf Combining test-data/fdr-mode/file1.vcf Combining test-data/fdr-mode/file2.vcf Combining test-data/fdr-mode/file3.vcf Scanning target file.. Target file had 1 entries. Wrote 1 target ids to alignment header. Setting quality threshold to 0.05 Total logical entries written: 2 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 0 Number of queries: 3 Number of targets: 3 Removed by quality filter: 0 Not best score: 1 Number of alignments written: 2 query_index: 0 target_index: 0 position: 14977972 score: 780.0 matching_reverse_strand: false multiplicity: 1 number_of_mismatches: 1 number_of_indels: 0 query_length: 142 query_aligned_length: 134 target_aligned_length: 134 sequence_variations { to: "T" from: "A" position: 6 to_quality: "/" read_index: 14 } fragment_index: 0 query_index_occurrences: 2 ambiguity: 1 Processing test-data/sample-qual-scores/30reads.fa Processed 0 read entries. Min quality score: 2147483647 Max quality score: -2147483648 Avg quality score: 0 Probable quality encoding scheme: fasta Processing test-data/sample-qual-scores/30reads.fq Processed 30 read entries. Min quality score: 69 Max quality score: 98 Avg quality score: 94 Probable quality encoding scheme: Illumina/Solexa TTC[27]->CGT[27] / qual=1:2:3 A[15]->G[20] / qual=20 A[15]->G[20] / qual=20 Setting quality threshold to 0.02 11:37:15.397 WARN MessageChunksWriter - Using chunk-size=1 11:37:15.402 WARN MessageChunksWriter - Using chunk-size=1 11:37:15.408 WARN MessageChunksWriter - Using chunk-size=1 11:37:15.414 WARN MessageChunksWriter - Using chunk-size=1 [main] WARN org.campagnelab.goby.alignments.BufferedSortingAlignmentWriter - Local sorting strategy failed to restore sort order. The destination has been marked as unsorted. You must sort the output manually to improve compression. 11:37:15.435 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.439 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 Scanned 5 entries 11:37:15.445 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.447 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 Scanned 2 entries 11:37:15.453 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.456 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.462 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.464 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.469 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.472 WARN MessageChunksWriter - Using chunk-size=1000 0 2 11:37:15.480 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.483 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-101 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-101 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-102 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-102 11:37:15.493 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.497 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.506 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.511 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.522 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.540 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 Scanned 5 entries 11:37:15.582 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.654 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.655 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.881 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:15.912 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.913 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.922 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 3ms; used/avail/free/total/max mem: 240.28M/20.85G/548.25M/788.53M/21.09G 11:37:15.969 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.016 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.021 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 290.59M/20.80G/497.94M/788.53M/21.09G 11:37:16.071 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.093 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.139 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.167 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.169 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.196 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.221 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.223 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item]; used/avail/free/total/max mem: 381.39M/20.71G/407.14M/788.53M/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.325 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.355 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.357 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.381 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.406 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.407 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.409 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 440.74M/20.65G/347.79M/788.53M/21.09G 11:37:16.418 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. notBestScoreCount=16.6667 % geneAmbiguityCount=33.3333 % found entry: query_index: 0 target_index: 1 position: 2 score: 31.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 0 target_index: 2 position: 3 score: 31.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 4 position: 6 score: 30.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.424 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.450 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.451 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.480 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.508 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.509 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.512 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.513 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 467.37M/20.62G/321.16M/788.53M/21.09G 11:37:16.518 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.520 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.525 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.558 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.559 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.594 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.629 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.630 WARN MessageChunksWriter - Using chunk-size=1000 Finding max number of reads... Found input file with 2 target(s) 11:37:16.633 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. Found input file with 2 target(s) 11:37:16.634 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. ... max number of reads was 10 First pass: determine which reads should be kept in the merged alignment. Scanning align-105 Scanning align-106 Found 40 logical alignment entries. Prepare merged too many hits information. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 492.80M/20.60G/295.73M/788.53M/21.09G Second pass: writing the merged alignment. 11:37:16.642 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.644 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. Wrote 20 skipped: 20 50.000000% too many hits 0.000000% notBestScore: 50.000000% Total logical entries written: 20 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 9 Number of queries: 10 Number of targets: 4 Percent aligned: 100.0 11:37:16.648 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.691 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.692 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.716 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.740 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.742 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.744 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 518.57M/20.57G/269.95M/788.53M/21.09G 11:37:16.749 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1 position: 11 score: 40.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1 position: 12 score: 41.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1 position: 13 score: 42.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1 position: 14 score: 43.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1 position: 15 score: 44.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1 position: 16 score: 45.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1 position: 17 score: 46.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1 position: 18 score: 47.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1 position: 19 score: 48.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1 position: 20 score: 49.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.753 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.838 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.843 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.878 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.922 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.935 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 5ms [2 items, 500.00 items/s, 2.00 ms/item]; used/avail/free/total/max mem: 575.80M/20.51G/212.73M/788.53M/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:17.044 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.071 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.072 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.098 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:17.123 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.135 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.138 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.141 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.167 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 217.33M/20.87G/571.20M/788.53M/21.09G 11:37:17.171 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.186 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 0 target_index: 3999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 3999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:17.219 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.222 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.225 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.228 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.231 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.233 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.236 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 Processing queryIndex=8 with description '8 perfect start of ref' Processing queryIndex=9 with description '9 perfect start of ref reverse strand' Processing queryIndex=18 with description '18 mismatch at end x1, starting at -1' Processing queryIndex=19 with description '19 mismatch at end x2, starting at -1' Processing queryIndex=20 with description '20 mismatch at end x5, starting at -1' Processing queryIndex=21 with description '21 mismatch at end x1, starting at -2' Processing queryIndex=22 with description '22 mismatch at end x2, starting at -2' Processing queryIndex=23 with description '23 mismatch at end x5, starting at -2' Processing queryIndex=12 with description '12 mismatch at beginning x1, starting at 1, with mutation at 20' Processing queryIndex=13 with description '13 mismatch at beginning x2, starting at 1, with mutation at 20' Processing queryIndex=15 with description '15 mismatch at beginning x1, starting at 2' Processing queryIndex=16 with description '16 mismatch at beginning x2, starting at 2' Processing queryIndex=14 with description '14 mismatch at beginning x5, starting at 1 (pos 4 actually does match), with mutation at 20' Processing queryIndex=17 with description '17 mismatch at beginning x5, starting at 2 (pos 4 actually does match)' Processing queryIndex=0 with description '0 perfect match' Processing queryIndex=1 with description '1 perfect match on reverse strand' Processing queryIndex=2 with description '2 mutation' Processing queryIndex=3 with description '3 mutation on reverse strand' Processing queryIndex=4 with description '4 insertion' Processing queryIndex=6 with description '6 deletion' Processing queryIndex=7 with description '7 deletion on reverse strand' Processing queryIndex=27 with description '27 padding left & right, deletion then mutation' Processing queryIndex=24 with description '24 padding left & right, mutation, deletion' Processing queryIndex=5 with description '5 insertion on reverse strand' Processing queryIndex=10 with description '10 perfect end of ref' Processing queryIndex=11 with description '11 perfect end of ref reverse strand' query_index: 0 target_index: 0 position: 0 query_position: 0 matching_reverse_strand: false query_length: 75 query_aligned_length: 75 target_aligned_length: 75 mapping_quality: 255 pair_flags: 0 fragment_index: 0 ambiguity: 1 query_index: 1 target_index: 0 position: 1 query_position: 0 matching_reverse_strand: false query_length: 75 query_aligned_length: 75 target_aligned_length: 75 mapping_quality: 255 pair_flags: 0 fragment_index: 0 ambiguity: 1 entry:query_index: 0 target_index: 0 position: 5 score: 5.0 matching_reverse_strand: false query_length: 20 query_aligned_length: 20 target_aligned_length: 20 sequence_variations { to: "CTAG" from: "----" position: 10 read_index: 10 } entry:query_index: 1 target_index: 0 position: 5 matching_reverse_strand: false query_length: 20 query_aligned_length: 20 target_aligned_length: 20 sequence_variations { to: "CTAG" from: "----" position: 10 to_quality: "((((" read_index: 10 } entry: query_index: 0 target_index: 0 position: 0 matching_reverse_strand: false query_length: 10 query_aligned_length: 10 sequence_variations { to: "AAA" from: "---" position: 3 read_index: 3 } processing entry on target 0 at position 0 processing entry on target 0 at position 5 processing entry on target 1 at position 0 processing entry on target 1 at position 5 processing entry on target 4 at position 0 processing entry on target 4 at position 5 entry:query_index: 0 target_index: 0 position: 10 matching_reverse_strand: false query_length: 50 query_aligned_length: 50 sequence_variations { to: "AAA" from: "---" position: 20 read_index: 20 } entry:query_index: 1 target_index: 0 position: 1 matching_reverse_strand: false query_length: 50 query_aligned_length: 50 sequence_variations { to: "T" from: "A" position: 20 read_index: 20 } 11:37:17.396 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.400 WARN MessageChunksWriter - Using chunk-size=1000 Total logical entries written: 20000 Total bytes written: 77210 Average bytes/logical entry: 3.8605 Min query index: 0 Max query index: 1999 Number of queries: 2000 Number of targets: 10 11:37:17.493 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.495 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.506 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.509 WARN MessageChunksWriter - Using chunk-size=1000 0 23 11:37:17.525 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.527 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.529 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.537 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.538 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.539 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.547 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.549 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.550 WARN MessageChunksWriter - Using chunk-size=1000 entry.position(): 1 entry.position(): 2 entry.position(): 3 entry.position(): 5 entry.position(): 6 entry.position(): 7 entry.position(): 8 entry.position(): 9 entry.position(): 10 entry.position(): 10 entry.position(): 12 entry.position(): 99 11:37:17.557 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.558 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.559 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.566 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.567 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.569 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.571 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-1.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-1 11:37:17.572 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-2.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-2 11:37:17.573 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-3.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-3 11:37:17.577 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.578 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.579 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.695 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 0 Total bytes written: 31 Average bytes/logical entry: Infinity Min query index: 2147483647 Max query index: -2147483648 Number of queries: 2 Number of targets: 0 97 11:37:17.703 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.709 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.712 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.715 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 read =CTCCAGAACTGTAAGATAATAAGTTGGTGTTGTTTT expected =TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT recons. ref=TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT read =TTTCCCACATTTCCCATCACCACTACTACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =TTTCCCAAATTTCACATCACTACTACACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =TAAAACCTAAAAAAAAAAAAAAACCCC expected =TAAAA--TAAAAAAAAAAAAAAACCCC recons. ref=TAAAA--TAAAAAAAAAAAAAAACCCC read =TTTTGATGAAGTCTCTGTGTCCTGGGGCATCAATGATGGTCACA expected =TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA recons. ref=TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA read =TTTCCCAAATTTCACATCACTACACTACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTATCTTTTT expected =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT recons. ref=CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT Total logical entries written: 1 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 45 field CHROM value: 0 field POS value: 145497099 field ID value: . field REF value: A field ALT value: G field QUAL value: 17.1 field FILTER value: . field INFO[DP] value: 2 field INFO[DP4] value: 0,0,2,0 field INFO[MQ] value: 25 field INFO[FQ] value: -30.8 field INFO[AF1] value: 0.9999 field INFO[CI95] value: 0.5,1 field INFO[PV4] value: field INFO[INDEL] value: INDEL field INFO[PC2] value: 3,3 field INFO[PCHI2] value: 0.752 field INFO[QCHI2] value: 1 field INFO[RP] value: field FORMAT[GT] value: field FORMAT[GQ] value: field FORMAT[GL] value: field FORMAT[DP] value: field FORMAT[SP] value: field FORMAT[PL] value: field results/IPBKRNW/IPBKRNW-replicate.bam[GT] value: 1/1 field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] value: 42 field results/IPBKRNW/IPBKRNW-replicate.bam[GL] value: field results/IPBKRNW/IPBKRNW-replicate.bam[DP] value: field results/IPBKRNW/IPBKRNW-replicate.bam[SP] value: field results/IPBKRNW/IPBKRNW-replicate.bam[PL] value: 25,3,0 field results/IPBKRNW/IPBKRNW-sorted.bam[GT] value: 1/1 field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] value: 42 field results/IPBKRNW/IPBKRNW-sorted.bam[GL] value: field results/IPBKRNW/IPBKRNW-sorted.bam[DP] value: field results/IPBKRNW/IPBKRNW-sorted.bam[SP] value: field results/IPBKRNW/IPBKRNW-sorted.bam[PL] value: 25,3,0 field CHROM gfi:0 value: 0 field POS gfi:1 value: 145497099 field ID gfi:2 value: . field REF gfi:3 value: A field ALT gfi:4 value: G field QUAL gfi:5 value: 17.1 field FILTER gfi:6 value: . field FORMAT[GT] gfi:7 value: field FORMAT[GQ] gfi:8 value: field FORMAT[GL] gfi:9 value: field FORMAT[DP] gfi:10 value: field FORMAT[SP] gfi:11 value: field FORMAT[PL] gfi:12 value: field results/IPBKRNW/IPBKRNW-replicate.bam[GT] gfi:13 value: 1/1 field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] gfi:14 value: 11 field results/IPBKRNW/IPBKRNW-replicate.bam[GL] gfi:15 value: field results/IPBKRNW/IPBKRNW-replicate.bam[DP] gfi:16 value: field results/IPBKRNW/IPBKRNW-replicate.bam[SP] gfi:17 value: field results/IPBKRNW/IPBKRNW-replicate.bam[PL] gfi:18 value: 015,4,0 field results/IPBKRNW/IPBKRNW-sorted.bam[GT] gfi:19 value: 1/1 field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] gfi:20 value: 42 field results/IPBKRNW/IPBKRNW-sorted.bam[GL] gfi:21 value: field results/IPBKRNW/IPBKRNW-sorted.bam[DP] gfi:22 value: field results/IPBKRNW/IPBKRNW-sorted.bam[SP] gfi:23 value: field results/IPBKRNW/IPBKRNW-sorted.bam[PL] gfi:24 value: 25,3,0 [ {N:15} {///////////00//0010} {N:15} {00101111001101100101111101111111/0/} |Encoded in 80 bits [ {N:15} {11111111111001100101100011111001011110011011001011111011111111} {0} {1} {1} {1} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->29 {N:15} {00101111001101100101111101111111101110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->74decoding: 0 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 1 decoding: 2 decoding: 3 decoding: 4 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 1 [ {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {0} {1} {0} {0} {1} {1} {1} {0} {0} {0} {1} {0} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {1} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {0} {1} |Encoded in 72 bits [ {00110011001100100011001001110001010010001101010110100101101001} {0} {0}decoding: 0 {1} {0}decoding: 4 {0} {0}decoding: 4 {0} {0}decoding: 4 {0}decoding: 4 {0}decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 decoding: 4 {0} {0} {0} {0} {0}decoding: 1 {0} {0} {0} {0}decoding: 2 {0} {0} {0} {0} {0}decoding: 3 decoding: 4 {0} {0} {0} {0}decoding: 3 {0} {0} {0}decoding: 1 {0} {0} {0} {0}decoding: 2 {0} {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0} {0} {0}decoding: 3 {0} {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0}decoding: 1 [ {N:2} {0010} {N:5} {011111} {N:5} {/0/00///01} {N:3} {//0/0/} {N:15} {///////////00//0010} |Encoded in 80 bits [ {N:2} {00101111010111111111011010011101111011110101110001111111111111} {1} {1} {1} {0} {0} {1} {1} | ->10 {N:5} {01111111110110100111011110111101011100011111111111111110011001} {0} {1} {1} {0} {0} {0} {0} {0} {0} | ->22 {N:5} {10100111011110111101011100011111111111111110011001011000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->38 {N:3} {11010111000111111111111111100110010110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->50 {N:15} {11111111111001100101100000000000000000000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->79decoding: 0 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 1 decoding: 2 decoding: 3 decoding: 4 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 1 Total logical entries written: 4 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 1 Max query index: 1 Number of queries: 1 Number of targets: 2 Total logical entries written: 4 Total bytes written: 62 Average bytes/logical entry: 15.5 Min query index: 1 Max query index: 1 Number of queries: 1 Number of targets: 2 Annotations loaded Annotations loaded Annotations loaded Annotations loaded Annotations loaded count perbase{0=>0, 13=>0, 11=>2, 3=>2, 5=>3} count keys [0, 3, 5, 11, 13] -1 0.0 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 overlapping count 3, 4 0.0 overlapping count 15, 17 0.0 overlapping count 9, 18 2.0 overlapping count 3, 8 2.0 overlapping count 11, 12 0.0 overlapping count 9, 10 1.0 overlapping count 8, 9 0.0 overlapping count 8, 8 0.0 overlapping count 5, 6 0.0 overlapping count 3, 3 0.0 overlapping count 3, 12 5.0 overlapping count -1, 2 0.0 overlapping count 0, 45 6.0 overlapping count 13, 15 0.0 -1 0.0 0 0.0 1 0.0 2 0.0 3 2.0 4 2.0 5 3.0 6 3.0 7 3.0 8 3.0 9 3.0 10 3.0 11 2.0 12 2.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 overlapping count 3, 4 2.0 overlapping count 2, 3 2.0 overlapping count 3, 8 4.0 overlapping count 11, 12 2.0 overlapping count 9, 10 3.0 overlapping count 8, 9 4.0 overlapping count 8, 8 3.0 overlapping count 5, 6 3.0 overlapping count 3, 3 2.0 overlapping count 3, 12 5.0 overlapping count -1, 2 0.0 overlapping count 0, 45 6.0 overlapping count 13, 15 1.0 [main] WARN org.campagnelab.goby.algorithmic.algorithm.EquivalentIndelRegionCalculator - Cannot determine sequence at position 600000000 of reference-index 2 appending (count=0,length=1) appending (count=4,length=3) appending (count=1,length=3) appending (count=0,length=2) appending (count=3,length=1) appending (count=1,length=1) appending (count=0,length=1) appending (count=4,length=3) appending (count=0,length=5) appending (count=3,length=1) appending (count=0,length=2) appending (count=2,length=1) appending (count=0,length=2) appending (count=3,length=1) appending (count=2,length=1) appending (count=0,length=1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=6 count=1 (0,1) loading transition for reader[0] position=1 length=3 count=3 (0,1)(1,4) loading transition for reader[0] position=4 length=2 count=0 (0,1)(1,4)(4,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 (0,0) loading transition for reader[0] position=1 length=1 count=1 (0,0)(1,1) loading transition for reader[0] position=2 length=4 count=0 (0,0)(1,1)(2,0) loading transition for reader[1] position=4 length=10 count=1 (0,0)(1,1)(2,0)(4,1) loading transition for reader[0] position=6 length=2 count=1 (0,0)(1,1)(2,0)(4,1)(6,2) loading transition for reader[0] position=8 length=1 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1) loading transition for reader[0] position=9 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) loading transition for reader[0] position=10 length=2 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) loading transition for reader[0] position=12 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) loading transition for reader[0] position=13 length=3 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) loading transition for reader[0] position=16 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 loading transition for reader[0] position=1 length=1 count=1 loading transition for reader[0] position=2 length=4 count=0 loading transition for reader[1] position=4 length=10 count=1 loading transition for reader[0] position=6 length=2 count=1 loading transition for reader[0] position=8 length=1 count=0 loading transition for reader[0] position=9 length=1 count=1 loading transition for reader[0] position=10 length=2 count=0 loading transition for reader[0] position=12 length=1 count=1 loading transition for reader[0] position=13 length=3 count=0 loading transition for reader[0] position=16 length=1 count=1 loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=6 count=1 (0,1) loading transition for reader[0] position=1 length=3 count=3 (0,1)(1,4) loading transition for reader[0] position=4 length=2 count=0 (0,1)(1,4)(4,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 (0,0) loading transition for reader[0] position=1 length=1 count=1 (0,0)(1,1) loading transition for reader[0] position=2 length=4 count=0 (0,0)(1,1)(2,0) loading transition for reader[1] position=4 length=10 count=1 (0,0)(1,1)(2,0)(4,1) loading transition for reader[0] position=6 length=2 count=1 (0,0)(1,1)(2,0)(4,1)(6,2) loading transition for reader[0] position=8 length=1 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1) loading transition for reader[0] position=9 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) loading transition for reader[0] position=10 length=2 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) loading transition for reader[0] position=12 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) loading transition for reader[0] position=13 length=3 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) loading transition for reader[0] position=16 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 loading transition for reader[0] position=1 length=1 count=1 loading transition for reader[0] position=2 length=4 count=0 loading transition for reader[1] position=4 length=10 count=1 loading transition for reader[0] position=6 length=2 count=1 loading transition for reader[0] position=8 length=1 count=0 loading transition for reader[0] position=9 length=1 count=1 loading transition for reader[0] position=10 length=2 count=0 loading transition for reader[0] position=12 length=1 count=1 loading transition for reader[0] position=13 length=3 count=0 loading transition for reader[0] position=16 length=1 count=1 loading transition for reader[0] position=0 length=1 count=0 (0,0) loading transition for reader[0] position=1 length=3 count=1 (0,0)(1,1) Appending count: 39901 length: 10 Appending count: 17289 length: 6 Appending count: 37817 length: 1 Appending count: 33709 length: 6 Appending count: 44089 length: 2 Appending count: 28866 length: 3 Appending count: 31179 length: 1 Appending count: 5042 length: 9 Appending count: 38546 length: 7 Appending count: 40217 length: 4 Appending count: 27078 length: 6 Appending count: 26550 length: 1 Appending count: 36152 length: 1 Appending count: 17051 length: 7 Appending count: 34867 length: 10 Appending count: 47667 length: 10 Appending count: 43469 length: 9 Appending count: 5683 length: 3 Appending count: 41404 length: 4 Appending count: 14249 length: 9 Appending count: 32710 length: 8 Appending count: 2641 length: 6 Appending count: 1505 length: 1 Appending count: 343 length: 8 Appending count: 40906 length: 6 Appending count: 42278 length: 6 Appending count: 30993 length: 2 Appending count: 31983 length: 6 Appending count: 17856 length: 6 Appending count: 40661 length: 3 position= 0 count= 39901 position= 1 count= 39901 position= 2 count= 39901 position= 3 count= 39901 position= 4 count= 39901 position= 5 count= 39901 position= 6 count= 39901 position= 7 count= 39901 position= 8 count= 39901 position= 9 count= 39901 position= 10 count= 17289 position= 11 count= 17289 position= 12 count= 17289 position= 13 count= 17289 position= 14 count= 17289 position= 15 count= 17289 position= 16 count= 37817 position= 17 count= 33709 position= 18 count= 33709 position= 19 count= 33709 position= 20 count= 33709 position= 21 count= 33709 position= 22 count= 33709 position= 23 count= 44089 position= 24 count= 44089 position= 25 count= 28866 position= 26 count= 28866 position= 27 count= 28866 position= 28 count= 31179 position= 29 count= 5042 position= 30 count= 5042 position= 31 count= 5042 position= 32 count= 5042 position= 33 count= 5042 position= 34 count= 5042 position= 35 count= 5042 position= 36 count= 5042 position= 37 count= 5042 position= 38 count= 38546 position= 39 count= 38546 position= 40 count= 38546 position= 41 count= 38546 position= 42 count= 38546 position= 43 count= 38546 position= 44 count= 38546 position= 45 count= 40217 position= 46 count= 40217 position= 47 count= 40217 position= 48 count= 40217 position= 49 count= 27078 position= 50 count= 27078 position= 51 count= 27078 position= 52 count= 27078 position= 53 count= 27078 position= 54 count= 27078 position= 55 count= 26550 position= 56 count= 36152 position= 57 count= 17051 position= 58 count= 17051 position= 59 count= 17051 position= 60 count= 17051 position= 61 count= 17051 position= 62 count= 17051 position= 63 count= 17051 position= 64 count= 34867 position= 65 count= 34867 position= 66 count= 34867 position= 67 count= 34867 position= 68 count= 34867 position= 69 count= 34867 position= 70 count= 34867 position= 71 count= 34867 position= 72 count= 34867 position= 73 count= 34867 position= 74 count= 47667 position= 75 count= 47667 position= 76 count= 47667 position= 77 count= 47667 position= 78 count= 47667 position= 79 count= 47667 position= 80 count= 47667 position= 81 count= 47667 position= 82 count= 47667 position= 83 count= 47667 position= 84 count= 43469 position= 85 count= 43469 position= 86 count= 43469 position= 87 count= 43469 position= 88 count= 43469 position= 89 count= 43469 position= 90 count= 43469 position= 91 count= 43469 position= 92 count= 43469 position= 93 count= 5683 position= 94 count= 5683 position= 95 count= 5683 position= 96 count= 41404 position= 97 count= 41404 position= 98 count= 41404 position= 99 count= 41404 position= 100 count= 14249 position= 101 count= 14249 position= 102 count= 14249 position= 103 count= 14249 position= 104 count= 14249 position= 105 count= 14249 position= 106 count= 14249 position= 107 count= 14249 position= 108 count= 14249 position= 109 count= 32710 position= 110 count= 32710 position= 111 count= 32710 position= 112 count= 32710 position= 113 count= 32710 position= 114 count= 32710 position= 115 count= 32710 position= 116 count= 32710 position= 117 count= 2641 position= 118 count= 2641 position= 119 count= 2641 position= 120 count= 2641 position= 121 count= 2641 position= 122 count= 2641 position= 123 count= 1505 position= 124 count= 343 position= 125 count= 343 position= 126 count= 343 position= 127 count= 343 position= 128 count= 343 position= 129 count= 343 position= 130 count= 343 position= 131 count= 343 position= 132 count= 40906 position= 133 count= 40906 position= 134 count= 40906 position= 135 count= 40906 position= 136 count= 40906 position= 137 count= 40906 position= 138 count= 42278 position= 139 count= 42278 position= 140 count= 42278 position= 141 count= 42278 position= 142 count= 42278 position= 143 count= 42278 position= 144 count= 30993 position= 145 count= 30993 position= 146 count= 31983 position= 147 count= 31983 position= 148 count= 31983 position= 149 count= 31983 position= 150 count= 31983 position= 151 count= 31983 position= 152 count= 17856 position= 153 count= 17856 position= 154 count= 17856 position= 155 count= 17856 position= 156 count= 17856 position= 157 count= 17856 position= 158 count= 40661 position= 159 count= 40661 position= 160 count= 40661 appending (count=10,length=4) appending (count=1,length=0) appending (count=2,length=8) Hello appending (count=10,length=4) 11:38:08.185 WARN WiggleWindow - Not writing 101 7 11:38:08.186 WARN WiggleWindow - Not writing 111 7 11:38:08.186 WARN WiggleWindow - Not writing 131 8 11:38:08.186 WARN WiggleWindow - Not writing 141 8 11:38:08.186 WARN WiggleWindow - Not writing 151 8 peak : start :5 count :13 length :100010 peak : start :100020 count :10 length :1 original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGTGT original G----GTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: G original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT mapped: GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT original G--GTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGT qPhred=1 qPhred=2 qPhred=3 qPhred=4 qPhred=5 qPhred=6 qPhred=7 qPhred=8 qPhred=9 qPhred=10 qPhred=11 qPhred=12 qPhred=13 qPhred=14 qPhred=15 qPhred=16 qPhred=17 qPhred=18 qPhred=19 qPhred=20 qPhred=21 qPhred=22 qPhred=23 qPhred=24 qPhred=25 qPhred=26 qPhred=27 qPhred=28 qPhred=29 qPhred=30 qPhred=31 qPhred=32 qPhred=33 qPhred=34 qPhred=35 qPhred=36 qPhred=37 qPhred=38 qPhred=39 qPhred=40 qPhred=41 qPhred=42 qPhred=43 qPhred=44 qPhred=45 qPhred=46 qPhred=47 qPhred=48 qPhred=49 qPhred=50 qPhred=51 qPhred=52 qPhred=53 qPhred=54 qPhred=55 qPhred=56 qPhred=57 qPhred=58 qPhred=59 qPhred=60 qPhred=61 0 AAC 3 ACC 6 ATC 9 AGC 12 AAC 15 ACC 18 ATC 21 AGC 24 AAC 27 ACC 30 ATC 33 AGC 36 AAC 39 ACC 42 ATC 45 AGC 48 AAC 51 ACC 54 ATC 57 AGC 60 AAC 63 ACC 66 ATC 69 AGC 72 AAC 75 ACC 78 ATC 81 AGC11:38:16.444 WARN MessageChunksWriter - Using chunk-size=9 11:38:16.448 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 660 Average bytes/logical entry: 16.923077 Number of bits/base 3.6590436 11:38:16.450 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 685 Average bytes/logical entry: 17.564102 Number of bits/base 3.797644 11:38:16.453 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 660 Average bytes/logical entry: 16.923077 Number of bits/base 3.6590436 >1 NNTGAATGAGACCTA [WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46, Time elapsed: 79.464 s - in TestSuite [INFO] [INFO] Results: [INFO] [WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46 [INFO] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.064 s] [INFO] Goby I/O ........................................... SUCCESS [398 d 06:23 h] [INFO] Goby Full Distribution ............................. SUCCESS [01:57 min] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 02:06 min [INFO] Finished at: 2026-09-08T11:38:48-12:00 [INFO] ------------------------------------------------------------------------ make[1]: Leaving directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Ddebian.package=libgoby-io-java -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo -Dinstall.to.usj=true org.debian.maven:debian-maven-plugin:2.6:install OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-framework --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/pom.xml.save with options: [INFO] --keep-pom-version --package=libgoby-io-java --has-package-version [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-io --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/pom.xml.save with options: [INFO] --keep-pom-version --package=libgoby-io-java [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] Install jar for goby-io into /usr/share/java [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-distribution --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/pom.xml.save with options: [INFO] --keep-pom-version --package=goby-java [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] Install jar for goby-distribution into /usr/share/java [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.866 s] [INFO] Goby I/O ........................................... SUCCESS [ 0.134 s] [INFO] Goby Full Distribution ............................. SUCCESS [ 0.149 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 1.596 s [INFO] Finished at: 2026-09-08T11:38:53-12:00 [INFO] ------------------------------------------------------------------------ mh_resolve_dependencies --non-interactive --offline --build -plibgoby-io-java --base-directory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 --non-explore Analysing pom.xml... Analysing goby-distribution/pom.xml... Checking the parent dependency in the sub project goby-distribution/pom.xml Analysing goby-io/pom.xml... Checking the parent dependency in the sub project goby-io/pom.xml > dpkg --search /usr/share/maven-repo/org/rosuda/REngine/REngine/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/rosuda/REngine/REngine Sep 08, 2026 11:39:05 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/pom.xml: Dependency not found org.rosuda.REngine:REngine:jar:debian > dpkg --search /usr/share/maven-repo/org/itadaki/bzip2/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/itadaki/bzip2 Sep 08, 2026 11:39:10 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/pom.xml: Dependency not found org.itadaki:bzip2:jar:debian ERROR: goby-distribution/pom.xml: dependency is not packaged in the Maven repository for Debian: org.rosuda.REngine:REngine:debian goby-io/pom.xml: dependency is not packaged in the Maven repository for Debian: org.itadaki:bzip2:debian -------- Some problems were found in this project, exiting... mh_unpatchpoms -plibgoby-io-java dh_install jh_installjavadoc dh_installdocs dh_installchangelogs dh_installman dh_lintian dh_perl dh_link jh_installlibs jh_classpath jh_manifest jh_exec jh_depends dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_installdeb dh_gencontrol dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${maven:Depends} used, but is not defined dpkg-gencontrol: warning: Recommends field of package goby-java: substitution variable ${maven:OptionalDepends} used, but is not defined dpkg-gencontrol: warning: package goby-java: substitution variable ${java:Depends} unused, but is defined dpkg-gencontrol: warning: Depends field of package libgoby-io-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${java:Depends} unused, but is defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${maven:CompileDepends} unused, but is defined dh_md5sums dh_builddeb dpkg-deb: building package 'libgoby-io-java' in '../libgoby-io-java_3.3.1+dfsg2-11_all.deb'. dpkg-deb: building package 'goby-java' in '../goby-java_3.3.1+dfsg2-11_all.deb'. dpkg-genbuildinfo --build=binary -O../libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo dpkg-genchanges --build=binary -O../libgoby-java_3.3.1+dfsg2-11_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/148101 and its subdirectories I: Current time: Tue Sep 8 11:39:41 -12 2026 I: pbuilder-time-stamp: 1788910781 Tue Sep 8 23:39:41 UTC 2026 I: Signing ./b1/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo as libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc Tue Sep 8 23:39:41 UTC 2026 I: Signed ./b1/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo as ./b1/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc Tue Sep 8 23:39:41 UTC 2026 - build #1 for libgoby-java/trixie/amd64 on ionos5-amd64 done. Starting cleanup. All cleanup done. Tue Sep 8 23:39:41 UTC 2026 - reproducible_build.sh stopped running as /tmp/jenkins-script-rPDQ7M4C, removing. /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC: total 20 drwxr-xr-x 2 jenkins jenkins 4096 Aug 6 17:16 b1 drwxr-xr-x 2 jenkins jenkins 4096 Aug 6 17:03 b2 -rw-r--r-- 1 jenkins jenkins 3008 May 14 2024 libgoby-java_3.3.1+dfsg2-11.dsc -rw------- 1 jenkins jenkins 4178 Aug 6 17:03 rbuildlog.c9JyM1f /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b1: total 3020 -rw-r--r-- 1 jenkins jenkins 446103 Aug 6 17:16 build.log -rw-r--r-- 1 jenkins jenkins 1575696 Aug 6 17:16 goby-java_3.3.1+dfsg2-11_all.deb -rw-r--r-- 1 jenkins jenkins 978952 Aug 6 17:16 libgoby-io-java_3.3.1+dfsg2-11_all.deb -rw-r--r-- 1 jenkins jenkins 29428 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11.debian.tar.xz -rw-r--r-- 1 jenkins jenkins 3008 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11.dsc -rw-r--r-- 1 jenkins jenkins 19140 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo -rw-r--r-- 1 jenkins jenkins 20022 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc -rw-r--r-- 1 jenkins jenkins 1651 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_amd64.changes -rw-r--r-- 1 jenkins jenkins 1494 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_source.changes /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b2: total 0 Wed Aug 6 17:16:42 UTC 2025 I: Deleting $TMPDIR on ionos5-amd64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Tue Sep 8 11:26:14 -12 2026 I: pbuilder-time-stamp: 1788909974 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [libgoby-java_3.3.1+dfsg2-11.dsc] I: copying [./libgoby-java_3.3.1+dfsg2.orig.tar.xz] I: copying [./libgoby-java_3.3.1+dfsg2-11.debian.tar.xz] I: Extracting source dpkg-source: warning: cannot verify inline signature for ./libgoby-java_3.3.1+dfsg2-11.dsc: no acceptable signature found dpkg-source: info: extracting libgoby-java in libgoby-java-3.3.1+dfsg2 dpkg-source: info: unpacking libgoby-java_3.3.1+dfsg2.orig.tar.xz dpkg-source: info: unpacking libgoby-java_3.3.1+dfsg2-11.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying protoc.patch dpkg-source: info: applying adding_dependencies.patch dpkg-source: info: applying using_jbzip2.patch dpkg-source: info: applying adapting_to_old_fastutil.patch dpkg-source: info: applying using_GeneratedMessageV3.patch dpkg-source: info: applying using_commons-cli.patch dpkg-source: info: applying using_correct_SamReader_api.patch dpkg-source: info: applying inclusions_in_SplitTranscriptsMode.patch dpkg-source: info: applying catch_IOException_LineIterator.patch dpkg-source: info: applying computing_fisher_pvalue_hypergeom.patch dpkg-source: info: applying exclude_not_runnable_tests.patch dpkg-source: info: applying goby_script.patch dpkg-source: info: applying path_of_goby_jar_for_Debian.patch dpkg-source: info: applying jaxb_dependency.patch dpkg-source: info: applying using_pcre2.patch dpkg-source: info: applying omit_test_failing_randomly.patch dpkg-source: info: applying adding_opens_arg_for_tests.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/148101/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' DISTRIBUTION='trixie' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='bc99d0441e3e4105aeab9c12f7429242' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='148101' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/pbuilderrc_6g3v --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b1 --logfile b1/build.log libgoby-java_3.3.1+dfsg2-11.dsc' SUDO_GID='110' SUDO_UID='105' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://213.165.73.152:3128' I: uname -a Linux ionos5-amd64 6.12.33+deb12-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.12.33-1~bpo12+1 (2025-07-09) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 May 12 2025 /bin -> usr/bin I: user script /srv/workspace/pbuilder/148101/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), maven-debian-helper, javahelper, default-jdk, ant, ant-contrib, libjbzip2-java, libcommons-collections3-java, libcommons-configuration-java, libcommons-exec-java, libcommons-io-java, libcommons-lang-java, libcommons-logging-java, libcommons-math-java, libcommons-cli-java, libdistlib-java, liblog4j1.2-java, libexec-maven-plugin-java, libjaxb-api-java, libmaven-assembly-plugin-java, libmaven-antrun-plugin-java, libbuild-helper-maven-plugin-java, libmaven-dependency-plugin-java, libmaven-source-plugin-java, libmaven-javadoc-plugin-java, libprotobuf-java, libhtsjdk-java, libfastutil-java, protobuf-compiler, libjsap-java, libdsiutils-java, libicb-utils-java, libreflections-java, libpj-java, libprotobuf-dev, pkgconf, r-cran-rjava, libeasymock-java, junit4, testng, libpicard-java dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19851 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on maven-debian-helper; however: Package maven-debian-helper is not installed. pbuilder-satisfydepends-dummy depends on javahelper; however: Package javahelper is not installed. pbuilder-satisfydepends-dummy depends on default-jdk; however: Package default-jdk is not installed. pbuilder-satisfydepends-dummy depends on ant; however: Package ant is not installed. pbuilder-satisfydepends-dummy depends on ant-contrib; however: Package ant-contrib is not installed. pbuilder-satisfydepends-dummy depends on libjbzip2-java; however: Package libjbzip2-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-collections3-java; however: Package libcommons-collections3-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-configuration-java; however: Package libcommons-configuration-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-exec-java; however: Package libcommons-exec-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-io-java; however: Package libcommons-io-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-lang-java; however: Package libcommons-lang-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-logging-java; however: Package libcommons-logging-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-math-java; however: Package libcommons-math-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-cli-java; however: Package libcommons-cli-java is not installed. pbuilder-satisfydepends-dummy depends on libdistlib-java; however: Package libdistlib-java is not installed. pbuilder-satisfydepends-dummy depends on liblog4j1.2-java; however: Package liblog4j1.2-java is not installed. pbuilder-satisfydepends-dummy depends on libexec-maven-plugin-java; however: Package libexec-maven-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libjaxb-api-java; however: Package libjaxb-api-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-assembly-plugin-java; however: Package libmaven-assembly-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-antrun-plugin-java; however: Package libmaven-antrun-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libbuild-helper-maven-plugin-java; however: Package libbuild-helper-maven-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-dependency-plugin-java; however: Package libmaven-dependency-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-source-plugin-java; however: Package libmaven-source-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-javadoc-plugin-java; however: Package libmaven-javadoc-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libprotobuf-java; however: Package libprotobuf-java is not installed. pbuilder-satisfydepends-dummy depends on libhtsjdk-java; however: Package libhtsjdk-java is not installed. pbuilder-satisfydepends-dummy depends on libfastutil-java; however: Package libfastutil-java is not installed. pbuilder-satisfydepends-dummy depends on protobuf-compiler; however: Package protobuf-compiler is not installed. pbuilder-satisfydepends-dummy depends on libjsap-java; however: Package libjsap-java is not installed. pbuilder-satisfydepends-dummy depends on libdsiutils-java; however: Package libdsiutils-java is not installed. pbuilder-satisfydepends-dummy depends on libicb-utils-java; however: Package libicb-utils-java is not installed. pbuilder-satisfydepends-dummy depends on libreflections-java; however: Package libreflections-java is not installed. pbuilder-satisfydepends-dummy depends on libpj-java; however: Package libpj-java is not installed. pbuilder-satisfydepends-dummy depends on libprotobuf-dev; however: Package libprotobuf-dev is not installed. pbuilder-satisfydepends-dummy depends on pkgconf; however: Package pkgconf is not installed. pbuilder-satisfydepends-dummy depends on r-cran-rjava; however: Package r-cran-rjava is not installed. pbuilder-satisfydepends-dummy depends on libeasymock-java; however: Package libeasymock-java is not installed. pbuilder-satisfydepends-dummy depends on junit4; however: Package junit4 is not installed. pbuilder-satisfydepends-dummy depends on testng; however: Package testng is not installed. pbuilder-satisfydepends-dummy depends on libpicard-java; however: Package libpicard-java is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: adwaita-icon-theme{a} ant{a} ant-contrib{a} at-spi2-common{a} autoconf{a} automake{a} autopoint{a} autotools-dev{a} binfmt-support{a} bsdextrautils{a} ca-certificates{a} ca-certificates-java{a} dbus{a} dbus-bin{a} dbus-daemon{a} dbus-session-bus-common{a} dbus-system-bus-common{a} dbus-user-session{a} dconf-gsettings-backend{a} dconf-service{a} dctrl-tools{a} debhelper{a} default-jdk{a} default-jdk-headless{a} default-jre{a} default-jre-headless{a} devscripts{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} fastjar{a} file{a} fontconfig{a} fontconfig-config{a} fonts-dejavu-core{a} fonts-dejavu-mono{a} gettext{a} gettext-base{a} gpg{a} gpg-agent{a} gpgconf{a} gpgv{a} groff-base{a} gtk-update-icon-cache{a} hicolor-icon-theme{a} intltool-debian{a} jarwrapper{a} java-common{a} javahelper{a} junit4{a} junit5{a} libactivation-java{a} libaopalliance-java{a} libapache-pom-java{a} libapiguardian-java{a} libapparmor1{a} libarchive-zip-perl{a} libasm-java{a} libasound2-data{a} libasound2t64{a} libassuan9{a} libatinject-jsr330-api-java{a} libatk-bridge2.0-0t64{a} libatk1.0-0t64{a} libatspi2.0-0t64{a} libavahi-client3{a} libavahi-common-data{a} libavahi-common3{a} libb-hooks-op-check-perl{a} libbarclay-java{a} libblas3{a} libbrotli1{a} libbsh-java{a} libbuild-helper-maven-plugin-java{a} libbyte-buddy-java{a} libcairo-gobject2{a} libcairo2{a} libcdi-api-java{a} libclass-method-modifiers-perl{a} libclass-xsaccessor-perl{a} libclone-perl{a} libcloudproviders0{a} libcolord2{a} libcolt-free-java{a} libcom-err2{a} libcommons-beanutils-java{a} libcommons-cli-java{a} libcommons-codec-java{a} libcommons-collections3-java{a} libcommons-collections4-java{a} libcommons-compress-java{a} libcommons-configuration-java{a} libcommons-digester-java{a} libcommons-exec-java{a} libcommons-io-java{a} libcommons-jexl2-java{a} libcommons-lang-java{a} libcommons-lang3-java{a} libcommons-logging-java{a} libcommons-math-java{a} libcommons-math3-java{a} libcommons-parent-java{a} libcommons-text-java{a} libcommons-validator-java{a} libcups2t64{a} libcurl4t64{a} libdatrie1{a} libdbus-1-3{a} libdconf1{a} libdebhelper-perl{a} libdeflate0{a} libdevel-callchecker-perl{a} libdistlib-java{a} libdom4j-java{a} libdoxia-core-java{a} libdoxia-java{a} libdoxia-sitetools-java{a} libdrm-amdgpu1{a} libdrm-common{a} libdrm-intel1{a} libdrm2{a} libdsiutils-java{a} libdynaloader-functions-perl{a} libeasymock-java{a} libedit2{a} libel-api-java{a} libelf1t64{a} libencode-locale-perl{a} libepoxy0{a} liberror-prone-java{a} libexec-maven-plugin-java{a} libexpat1{a} libezmorph-java{a} libfastutil-java{a} libffi8{a} libfile-dirlist-perl{a} libfile-homedir-perl{a} libfile-listing-perl{a} libfile-stripnondeterminism-perl{a} libfile-touch-perl{a} libfile-which-perl{a} libfontconfig1{a} libfreemarker-java{a} libfreetype6{a} libfribidi0{a} libgatk-native-bindings-java{a} libgbm1{a} libgcrypt20{a} libgdk-pixbuf-2.0-0{a} libgdk-pixbuf2.0-common{a} libgeronimo-annotation-1.3-spec-java{a} libgeronimo-interceptor-3.0-spec-java{a} libgfortran5{a} libgif7{a} libgkl-java{a} libgl1{a} libgl1-mesa-dri{a} libglib2.0-0t64{a} libglvnd0{a} libglx-mesa0{a} libglx0{a} libgnutls30t64{a} libgoogle-gson-java{a} libgpg-error0{a} libgraphite2-3{a} libgssapi-krb5-2{a} libgtk-3-0t64{a} libgtk-3-common{a} libguava-java{a} libguice-java{a} libhamcrest-java{a} libharfbuzz0b{a} libhtml-parser-perl{a} libhtml-tagset-perl{a} libhtml-tree-perl{a} libhtsjdk-java{a} libhttp-cookies-perl{a} libhttp-date-perl{a} libhttp-message-perl{a} libhttp-negotiate-perl{a} libhttpclient-java{a} libhttpcore-java{a} libicb-utils-java{a} libice6{a} libicu4j-java{a} libicu76{a} libidn2-0{a} libimport-into-perl{a} libio-html-perl{a} libio-socket-ssl-perl{a} libjansi-java{a} libjavassist-java{a} libjaxb-api-java{a} libjaxen-java{a} libjbig0{a} libjboss-logging-java{a} libjboss-vfs-java{a} libjbzip2-java{a} libjcommander-java{a} libjetty9-java{a} libjoptsimple-java{a} libjpeg62-turbo{a} libjsap-java{a} libjson-java{a} libjsoup-java{a} libjsp-api-java{a} libjsr305-java{a} libjtidy-java{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libksba8{a} liblapack3{a} liblcms2-2{a} libldap2{a} liblerc4{a} liblightcouch-java{a} libllvm19{a} liblog4j1.2-java{a} liblog4j2-java{a} liblogback-java{a} liblwp-mediatypes-perl{a} liblwp-protocol-https-perl{a} libmagic-mgc{a} libmagic1t64{a} libmaven-antrun-plugin-java{a} libmaven-archiver-java{a} libmaven-artifact-transfer-java{a} libmaven-assembly-plugin-java{a} libmaven-clean-plugin-java{a} libmaven-common-artifact-filters-java{a} libmaven-compiler-plugin-java{a} libmaven-dependency-analyzer-java{a} libmaven-dependency-plugin-java{a} libmaven-dependency-tree-java{a} libmaven-file-management-java{a} libmaven-filtering-java{a} libmaven-invoker-java{a} libmaven-jar-plugin-java{a} libmaven-javadoc-plugin-java{a} libmaven-parent-java{a} libmaven-plugin-tools-java{a} libmaven-reporting-api-java{a} libmaven-reporting-exec-java{a} libmaven-reporting-impl-java{a} libmaven-resolver-java{a} libmaven-resources-plugin-java{a} libmaven-shared-incremental-java{a} libmaven-shared-io-java{a} libmaven-shared-utils-java{a} libmaven-site-plugin-java{a} libmaven-source-plugin-java{a} libmaven3-core-java{a} libmbedcrypto16{a} libmbedtls21{a} libmbedx509-7{a} libmodule-runtime-perl{a} libmongodb-java{a} libmoo-perl{a} libncbi-ngs3{a} libncbi-vdb3{a} libnet-http-perl{a} libnet-ssleay-perl{a} libnghttp2-14{a} libnghttp3-9{a} libngs-java{a} libngs-jni{a} libnpth0t64{a} libnspr4{a} libnss3{a} libobjenesis-java{a} libopentest4j-java{a} libopentest4j-reporting-java{a} liboro-java{a} libp11-kit0{a} libpam-systemd{a} libpango-1.0-0{a} libpangocairo-1.0-0{a} libpangoft2-1.0-0{a} libpaper-utils{a} libpaper2{a} libparams-classify-perl{a} libpciaccess0{a} libpcsclite1{a} libpicard-java{a} libpicocli-java{a} libpipeline1{a} libpixman-1-0{a} libpj-java{a} libpkgconf3{a} libplexus-ant-factory-java{a} libplexus-archiver-java{a} libplexus-bsh-factory-java{a} libplexus-build-api-java{a} libplexus-cipher-java{a} libplexus-classworlds-java{a} libplexus-compiler-java{a} libplexus-component-annotations-java{a} libplexus-container-default-java{a} libplexus-container-default1.5-java{a} libplexus-i18n-java{a} libplexus-interactivity-api-java{a} libplexus-interpolation-java{a} libplexus-io-java{a} libplexus-languages-java{a} libplexus-sec-dispatcher-java{a} libplexus-utils2-java{a} libplexus-velocity-java{a} libplexus-xml-java{a} libpng16-16t64{a} libproc2-0{a} libprotobuf-dev{a} libprotobuf-java{a} libprotobuf-lite32t64{a} libprotobuf32t64{a} libprotoc32t64{a} libpsl5t64{a} libpython3-stdlib{a} libpython3.13-minimal{a} libpython3.13-stdlib{a} libqdox2-java{a} libreadline8t64{a} libreflections-java{a} librhino-java{a} librole-tiny-perl{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libsensors-config{a} libsensors5{a} libservlet-api-java{a} libsharpyuv0{a} libsisu-inject-java{a} libsisu-plexus-java{a} libslf4j-java{a} libsm6{a} libsnappy-java{a} libsnappy-jni{a} libsnappy1v5{a} libssh2-1t64{a} libsub-quote-perl{a} libsurefire-java{a} libsystemd-shared{a} libtasn1-6{a} libtcl8.6{a} libtext-charwidth-perl{a} libtext-wrapi18n-perl{a} libthai-data{a} libthai0{a} libtiff6{a} libtimedate-perl{a} libtirpc-common{a} libtirpc3t64{a} libtk8.6{a} libtool{a} libtry-tiny-perl{a} libuchardet0{a} libunistring5{a} libunivocity-parsers-java{a} liburi-perl{a} libvelocity-tools-java{a} libvulkan1{a} libwagon-file-java{a} libwagon-http-java{a} libwagon-provider-api-java{a} libwayland-client0{a} libwayland-cursor0{a} libwayland-egl1{a} libwayland-server0{a} libwebp7{a} libwebsocket-api-java{a} libwww-perl{a} libwww-robotrules-perl{a} libx11-6{a} libx11-data{a} libx11-xcb1{a} libxau6{a} libxbean-reflect-java{a} libxcb-dri3-0{a} libxcb-glx0{a} libxcb-present0{a} libxcb-randr0{a} libxcb-render0{a} libxcb-shm0{a} libxcb-sync1{a} libxcb-xfixes0{a} libxcb1{a} libxcomposite1{a} libxcursor1{a} libxdamage1{a} libxdmcp6{a} libxerces2-java{a} libxext6{a} libxfixes3{a} libxft2{a} libxi6{a} libxinerama1{a} libxkbcommon0{a} libxml-commons-external-java{a} libxml-commons-resolver1.1-java{a} libxml2{a} libxml2-utils{a} libxom-java{a} libxpp3-java{a} libxrandr2{a} libxrender1{a} libxshmfence1{a} libxss1{a} libxstream-java{a} libxt6t64{a} libxtst6{a} libxxf86vm1{a} libxz-java{a} libz3-4{a} m4{a} man-db{a} maven{a} maven-debian-helper{a} maven-repo-helper{a} media-types{a} mesa-libgallium{a} ncbi-vdb-data{a} netbase{a} openjdk-21-jdk{a} openjdk-21-jdk-headless{a} openjdk-21-jre{a} openjdk-21-jre-headless{a} openssl{a} patchutils{a} perl-openssl-defaults{a} pinentry-curses{a} pkgconf{a} pkgconf-bin{a} po-debconf{a} procps{a} protobuf-compiler{a} python3{a} python3-minimal{a} python3.13{a} python3.13-minimal{a} r-base-core{a} r-cran-rjava{a} readline-common{a} sensible-utils{a} sgml-base{a} shared-mime-info{a} sopv-gpgv{a} systemd{a} systemd-sysv{a} testng{a} tzdata{a} ucf{a} unzip{a} velocity{a} wdiff{a} x11-common{a} xdg-utils{a} xkb-data{a} zip{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: alsa-topology-conf alsa-ucm-conf ant-optional at-spi2-core chrony curl debian-keyring debian-tag2upload-keyring dput dput-ng dupload equivs fonts-dejavu-extra gnupg krb5-locales libarchive-cpio-perl libatk-wrapper-java-jni libdata-dump-perl libdistro-info-perl libfile-mimeinfo-perl libgdk-pixbuf2.0-bin libgit-wrapper-perl libgitlab-api-v4-perl libgkl-jni libglib2.0-data libgpg-error-l10n libgtk-3-bin libhtml-form-perl libhtml-format-perl libhttp-daemon-perl libio-compress-brotli-perl libjline3-java libjson-perl libkmod2 libldap-common liblist-compare-perl libltdl-dev libmail-sendmail-perl libmailtools-perl libnamespace-clean-perl libnet-dbus-perl libnss-systemd librsvg2-common libsasl2-modules libsoap-lite-perl libstring-shellquote-perl libx11-protocol-perl libxstring-perl libxt-dev libyaml-snake-java licensecheck lintian linux-sysctl-defaults lynx lzip mesa-vulkan-drivers ntpsec openntpd pristine-tar psmisc publicsuffix python3-apt python3-argcomplete python3-debian python3-magic python3-requests python3-unidiff python3-xdg r-base-dev r-doc-html r-recommended sopv-doc strace systemd-cryptsetup systemd-timesyncd wget x11-utils x11-xserver-utils xdg-user-dirs 0 packages upgraded, 461 newly installed, 0 to remove and 0 not upgraded. Need to get 386 MB of archives. After unpacking 1012 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main amd64 libsystemd-shared amd64 257.7-1 [2151 kB] Get: 2 http://deb.debian.org/debian trixie/main amd64 libapparmor1 amd64 4.1.0-1 [43.7 kB] Get: 3 http://deb.debian.org/debian trixie/main amd64 systemd amd64 257.7-1 [3099 kB] Get: 4 http://deb.debian.org/debian trixie/main amd64 systemd-sysv amd64 257.7-1 [64.2 kB] Get: 5 http://deb.debian.org/debian trixie/main amd64 libdbus-1-3 amd64 1.16.2-2 [178 kB] Get: 6 http://deb.debian.org/debian trixie/main amd64 dbus-bin amd64 1.16.2-2 [80.0 kB] Get: 7 http://deb.debian.org/debian trixie/main amd64 dbus-session-bus-common all 1.16.2-2 [52.3 kB] Get: 8 http://deb.debian.org/debian trixie/main amd64 libexpat1 amd64 2.7.1-2 [108 kB] Get: 9 http://deb.debian.org/debian trixie/main amd64 dbus-daemon amd64 1.16.2-2 [159 kB] Get: 10 http://deb.debian.org/debian trixie/main amd64 dbus-system-bus-common all 1.16.2-2 [53.5 kB] Get: 11 http://deb.debian.org/debian trixie/main amd64 dbus amd64 1.16.2-2 [71.6 kB] Get: 12 http://deb.debian.org/debian trixie/main amd64 libpipeline1 amd64 1.5.8-1 [42.0 kB] Get: 13 http://deb.debian.org/debian trixie/main amd64 binfmt-support amd64 2.2.2-7 [64.3 kB] Get: 14 http://deb.debian.org/debian trixie/main amd64 libpython3.13-minimal amd64 3.13.5-2 [862 kB] Get: 15 http://deb.debian.org/debian trixie/main amd64 python3.13-minimal amd64 3.13.5-2 [2224 kB] Get: 16 http://deb.debian.org/debian trixie/main amd64 python3-minimal amd64 3.13.5-1 [27.2 kB] Get: 17 http://deb.debian.org/debian trixie/main amd64 media-types all 13.0.0 [29.3 kB] Get: 18 http://deb.debian.org/debian trixie/main amd64 netbase all 6.5 [12.4 kB] Get: 19 http://deb.debian.org/debian trixie/main amd64 tzdata all 2025b-4 [260 kB] Get: 20 http://deb.debian.org/debian trixie/main amd64 libffi8 amd64 3.4.8-2 [24.1 kB] Get: 21 http://deb.debian.org/debian trixie/main amd64 readline-common all 8.2-6 [69.4 kB] Get: 22 http://deb.debian.org/debian trixie/main amd64 libreadline8t64 amd64 8.2-6 [169 kB] Get: 23 http://deb.debian.org/debian trixie/main amd64 libpython3.13-stdlib amd64 3.13.5-2 [1956 kB] Get: 24 http://deb.debian.org/debian trixie/main amd64 python3.13 amd64 3.13.5-2 [757 kB] Get: 25 http://deb.debian.org/debian trixie/main amd64 libpython3-stdlib amd64 3.13.5-1 [10.2 kB] Get: 26 http://deb.debian.org/debian trixie/main amd64 python3 amd64 3.13.5-1 [28.2 kB] Get: 27 http://deb.debian.org/debian trixie/main amd64 libproc2-0 amd64 2:4.0.4-9 [65.6 kB] Get: 28 http://deb.debian.org/debian trixie/main amd64 procps amd64 2:4.0.4-9 [882 kB] Get: 29 http://deb.debian.org/debian trixie/main amd64 sensible-utils all 0.0.25 [25.0 kB] Get: 30 http://deb.debian.org/debian trixie/main amd64 openssl amd64 3.5.1-1 [1494 kB] Get: 31 http://deb.debian.org/debian trixie/main amd64 ca-certificates all 20250419 [162 kB] Get: 32 http://deb.debian.org/debian trixie/main amd64 libmagic-mgc amd64 1:5.46-5 [338 kB] Get: 33 http://deb.debian.org/debian trixie/main amd64 libmagic1t64 amd64 1:5.46-5 [109 kB] Get: 34 http://deb.debian.org/debian trixie/main amd64 file amd64 1:5.46-5 [43.6 kB] Get: 35 http://deb.debian.org/debian trixie/main amd64 gettext-base amd64 0.23.1-2 [243 kB] Get: 36 http://deb.debian.org/debian trixie/main amd64 libuchardet0 amd64 0.0.8-1+b2 [68.9 kB] Get: 37 http://deb.debian.org/debian trixie/main amd64 groff-base amd64 1.23.0-9 [1187 kB] Get: 38 http://deb.debian.org/debian trixie/main amd64 libpam-systemd amd64 257.7-1 [297 kB] Get: 39 http://deb.debian.org/debian trixie/main amd64 bsdextrautils amd64 2.41-5 [94.6 kB] Get: 40 http://deb.debian.org/debian trixie/main amd64 man-db amd64 2.13.1-1 [1469 kB] Get: 41 http://deb.debian.org/debian trixie/main amd64 libtext-charwidth-perl amd64 0.04-11+b4 [9476 B] Get: 42 http://deb.debian.org/debian trixie/main amd64 libtext-wrapi18n-perl all 0.06-10 [8808 B] Get: 43 http://deb.debian.org/debian trixie/main amd64 ucf all 3.0052 [43.3 kB] Get: 44 http://deb.debian.org/debian trixie/main amd64 libgdk-pixbuf2.0-common all 2.42.12+dfsg-4 [311 kB] Get: 45 http://deb.debian.org/debian trixie/main amd64 libglib2.0-0t64 amd64 2.84.3-1 [1515 kB] Get: 46 http://deb.debian.org/debian trixie/main amd64 libxml2 amd64 2.12.7+dfsg+really2.9.14-2.1 [698 kB] Get: 47 http://deb.debian.org/debian trixie/main amd64 shared-mime-info amd64 2.4-5+b2 [760 kB] Get: 48 http://deb.debian.org/debian trixie/main amd64 libjpeg62-turbo amd64 1:2.1.5-4 [168 kB] Get: 49 http://deb.debian.org/debian trixie/main amd64 libpng16-16t64 amd64 1.6.48-1 [282 kB] Get: 50 http://deb.debian.org/debian trixie/main amd64 libdeflate0 amd64 1.23-2 [47.3 kB] Get: 51 http://deb.debian.org/debian trixie/main amd64 libjbig0 amd64 2.1-6.1+b2 [32.1 kB] Get: 52 http://deb.debian.org/debian trixie/main amd64 liblerc4 amd64 4.0.0+ds-5 [183 kB] Get: 53 http://deb.debian.org/debian trixie/main amd64 libsharpyuv0 amd64 1.5.0-0.1 [116 kB] Get: 54 http://deb.debian.org/debian trixie/main amd64 libwebp7 amd64 1.5.0-0.1 [318 kB] Get: 55 http://deb.debian.org/debian trixie/main amd64 libtiff6 amd64 4.7.0-3 [346 kB] Get: 56 http://deb.debian.org/debian trixie/main amd64 libgdk-pixbuf-2.0-0 amd64 2.42.12+dfsg-4 [141 kB] Get: 57 http://deb.debian.org/debian trixie/main amd64 gtk-update-icon-cache amd64 4.18.6+ds-2 [52.7 kB] Get: 58 http://deb.debian.org/debian trixie/main amd64 hicolor-icon-theme all 0.18-2 [11.8 kB] Get: 59 http://deb.debian.org/debian trixie/main amd64 adwaita-icon-theme all 48.1-1 [504 kB] Get: 60 http://deb.debian.org/debian trixie/main amd64 ca-certificates-java all 20240118 [11.6 kB] Get: 61 http://deb.debian.org/debian trixie/main amd64 java-common all 0.76 [6776 B] Get: 62 http://deb.debian.org/debian trixie/main amd64 liblcms2-2 amd64 2.16-2 [160 kB] Get: 63 http://deb.debian.org/debian trixie/main amd64 libnspr4 amd64 2:4.36-1 [110 kB] Get: 64 http://deb.debian.org/debian trixie/main amd64 libnss3 amd64 2:3.110-1 [1393 kB] Get: 65 http://deb.debian.org/debian trixie/main amd64 libpcsclite1 amd64 2.3.3-1 [55.2 kB] Get: 66 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jre-headless amd64 21.0.8+9-1 [41.8 MB] Get: 67 http://deb.debian.org/debian trixie/main amd64 default-jre-headless amd64 2:1.21-76 [3192 B] Get: 68 http://deb.debian.org/debian trixie/main amd64 ant all 1.10.15-1 [2163 kB] Get: 69 http://deb.debian.org/debian trixie/main amd64 ant-contrib all 1.0~b3+svn177-12 [262 kB] Get: 70 http://deb.debian.org/debian trixie/main amd64 at-spi2-common all 2.56.2-1 [171 kB] Get: 71 http://deb.debian.org/debian trixie/main amd64 m4 amd64 1.4.19-8 [294 kB] Get: 72 http://deb.debian.org/debian trixie/main amd64 autoconf all 2.72-3.1 [494 kB] Get: 73 http://deb.debian.org/debian trixie/main amd64 autotools-dev all 20240727.1 [60.2 kB] Get: 74 http://deb.debian.org/debian trixie/main amd64 automake all 1:1.17-4 [862 kB] Get: 75 http://deb.debian.org/debian trixie/main amd64 autopoint all 0.23.1-2 [770 kB] Get: 76 http://deb.debian.org/debian trixie/main amd64 dbus-user-session amd64 1.16.2-2 [52.1 kB] Get: 77 http://deb.debian.org/debian trixie/main amd64 libdconf1 amd64 0.40.0-5 [41.8 kB] Get: 78 http://deb.debian.org/debian trixie/main amd64 dconf-service amd64 0.40.0-5 [32.4 kB] Get: 79 http://deb.debian.org/debian trixie/main amd64 dconf-gsettings-backend amd64 0.40.0-5 [28.6 kB] Get: 80 http://deb.debian.org/debian trixie/main amd64 dctrl-tools amd64 2.24-3+b1 [104 kB] Get: 81 http://deb.debian.org/debian trixie/main amd64 libdebhelper-perl all 13.24.2 [90.9 kB] Get: 82 http://deb.debian.org/debian trixie/main amd64 libtool all 2.5.4-4 [539 kB] Get: 83 http://deb.debian.org/debian trixie/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 84 http://deb.debian.org/debian trixie/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 85 http://deb.debian.org/debian trixie/main amd64 libfile-stripnondeterminism-perl all 1.14.1-2 [19.7 kB] Get: 86 http://deb.debian.org/debian trixie/main amd64 dh-strip-nondeterminism all 1.14.1-2 [8620 B] Get: 87 http://deb.debian.org/debian trixie/main amd64 libelf1t64 amd64 0.192-4 [189 kB] Get: 88 http://deb.debian.org/debian trixie/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 89 http://deb.debian.org/debian trixie/main amd64 libunistring5 amd64 1.3-2 [477 kB] Get: 90 http://deb.debian.org/debian trixie/main amd64 gettext amd64 0.23.1-2 [1680 kB] Get: 91 http://deb.debian.org/debian trixie/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 92 http://deb.debian.org/debian trixie/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 93 http://deb.debian.org/debian trixie/main amd64 debhelper all 13.24.2 [919 kB] Get: 94 http://deb.debian.org/debian trixie/main amd64 libatk1.0-0t64 amd64 2.56.2-1 [51.9 kB] Get: 95 http://deb.debian.org/debian trixie/main amd64 libxau6 amd64 1:1.0.11-1 [20.4 kB] Get: 96 http://deb.debian.org/debian trixie/main amd64 libxdmcp6 amd64 1:1.1.5-1 [27.8 kB] Get: 97 http://deb.debian.org/debian trixie/main amd64 libxcb1 amd64 1.17.0-2+b1 [144 kB] Get: 98 http://deb.debian.org/debian trixie/main amd64 libx11-data all 2:1.8.12-1 [343 kB] Get: 99 http://deb.debian.org/debian trixie/main amd64 libx11-6 amd64 2:1.8.12-1 [815 kB] Get: 100 http://deb.debian.org/debian trixie/main amd64 libxext6 amd64 2:1.3.4-1+b3 [50.4 kB] Get: 101 http://deb.debian.org/debian trixie/main amd64 libxi6 amd64 2:1.8.2-1 [78.9 kB] Get: 102 http://deb.debian.org/debian trixie/main amd64 libatspi2.0-0t64 amd64 2.56.2-1 [80.7 kB] Get: 103 http://deb.debian.org/debian trixie/main amd64 libatk-bridge2.0-0t64 amd64 2.56.2-1 [68.5 kB] Get: 104 http://deb.debian.org/debian trixie/main amd64 libbrotli1 amd64 1.1.0-2+b7 [307 kB] Get: 105 http://deb.debian.org/debian trixie/main amd64 libfreetype6 amd64 2.13.3+dfsg-1 [452 kB] Get: 106 http://deb.debian.org/debian trixie/main amd64 fonts-dejavu-mono all 2.37-8 [489 kB] Get: 107 http://deb.debian.org/debian trixie/main amd64 fonts-dejavu-core all 2.37-8 [840 kB] Get: 108 http://deb.debian.org/debian trixie/main amd64 fontconfig-config amd64 2.15.0-2.3 [318 kB] Get: 109 http://deb.debian.org/debian trixie/main amd64 libfontconfig1 amd64 2.15.0-2.3 [392 kB] Get: 110 http://deb.debian.org/debian trixie/main amd64 libpixman-1-0 amd64 0.44.0-3 [248 kB] Get: 111 http://deb.debian.org/debian trixie/main amd64 libxcb-render0 amd64 1.17.0-2+b1 [115 kB] Get: 112 http://deb.debian.org/debian trixie/main amd64 libxcb-shm0 amd64 1.17.0-2+b1 [105 kB] Get: 113 http://deb.debian.org/debian trixie/main amd64 libxrender1 amd64 1:0.9.12-1 [27.9 kB] Get: 114 http://deb.debian.org/debian trixie/main amd64 libcairo2 amd64 1.18.4-1+b1 [538 kB] Get: 115 http://deb.debian.org/debian trixie/main amd64 libcairo-gobject2 amd64 1.18.4-1+b1 [130 kB] Get: 116 http://deb.debian.org/debian trixie/main amd64 libcloudproviders0 amd64 0.3.6-2 [29.2 kB] Get: 117 http://deb.debian.org/debian trixie/main amd64 libcolord2 amd64 1.4.7-3 [139 kB] Get: 118 http://deb.debian.org/debian trixie/main amd64 libavahi-common-data amd64 0.8-16 [112 kB] Get: 119 http://deb.debian.org/debian trixie/main amd64 libavahi-common3 amd64 0.8-16 [44.2 kB] Get: 120 http://deb.debian.org/debian trixie/main amd64 libavahi-client3 amd64 0.8-16 [48.4 kB] Get: 121 http://deb.debian.org/debian trixie/main amd64 libidn2-0 amd64 2.3.8-2 [109 kB] Get: 122 http://deb.debian.org/debian trixie/main amd64 libp11-kit0 amd64 0.25.5-3 [425 kB] Get: 123 http://deb.debian.org/debian trixie/main amd64 libtasn1-6 amd64 4.20.0-2 [49.9 kB] Get: 124 http://deb.debian.org/debian trixie/main amd64 libgnutls30t64 amd64 3.8.9-3 [1465 kB] Get: 125 http://deb.debian.org/debian trixie/main amd64 libkrb5support0 amd64 1.21.3-5 [33.0 kB] Get: 126 http://deb.debian.org/debian trixie/main amd64 libcom-err2 amd64 1.47.2-3+b3 [25.0 kB] Get: 127 http://deb.debian.org/debian trixie/main amd64 libk5crypto3 amd64 1.21.3-5 [81.5 kB] Get: 128 http://deb.debian.org/debian trixie/main amd64 libkeyutils1 amd64 1.6.3-6 [9456 B] Get: 129 http://deb.debian.org/debian trixie/main amd64 libkrb5-3 amd64 1.21.3-5 [326 kB] Get: 130 http://deb.debian.org/debian trixie/main amd64 libgssapi-krb5-2 amd64 1.21.3-5 [138 kB] Get: 131 http://deb.debian.org/debian trixie/main amd64 libcups2t64 amd64 2.4.10-3 [251 kB] Get: 132 http://deb.debian.org/debian trixie/main amd64 libepoxy0 amd64 1.5.10-2 [193 kB] Get: 133 http://deb.debian.org/debian trixie/main amd64 libfribidi0 amd64 1.0.16-1 [26.5 kB] Get: 134 http://deb.debian.org/debian trixie/main amd64 libgraphite2-3 amd64 1.3.14-2+b1 [75.4 kB] Get: 135 http://deb.debian.org/debian trixie/main amd64 libharfbuzz0b amd64 10.2.0-1+b1 [479 kB] Get: 136 http://deb.debian.org/debian trixie/main amd64 fontconfig amd64 2.15.0-2.3 [463 kB] Get: 137 http://deb.debian.org/debian trixie/main amd64 libthai-data all 0.1.29-2 [168 kB] Get: 138 http://deb.debian.org/debian trixie/main amd64 libdatrie1 amd64 0.2.13-3+b1 [38.1 kB] Get: 139 http://deb.debian.org/debian trixie/main amd64 libthai0 amd64 0.1.29-2+b1 [49.4 kB] Get: 140 http://deb.debian.org/debian trixie/main amd64 libpango-1.0-0 amd64 1.56.3-1 [226 kB] Get: 141 http://deb.debian.org/debian trixie/main amd64 libpangoft2-1.0-0 amd64 1.56.3-1 [55.6 kB] Get: 142 http://deb.debian.org/debian trixie/main amd64 libpangocairo-1.0-0 amd64 1.56.3-1 [35.7 kB] Get: 143 http://deb.debian.org/debian trixie/main amd64 libwayland-client0 amd64 1.23.1-3 [26.8 kB] Get: 144 http://deb.debian.org/debian trixie/main amd64 libwayland-cursor0 amd64 1.23.1-3 [11.9 kB] Get: 145 http://deb.debian.org/debian trixie/main amd64 libwayland-egl1 amd64 1.23.1-3 [5860 B] Get: 146 http://deb.debian.org/debian trixie/main amd64 libxcomposite1 amd64 1:0.4.6-1 [16.3 kB] Get: 147 http://deb.debian.org/debian trixie/main amd64 libxfixes3 amd64 1:6.0.0-2+b4 [20.2 kB] Get: 148 http://deb.debian.org/debian trixie/main amd64 libxcursor1 amd64 1:1.2.3-1 [39.7 kB] Get: 149 http://deb.debian.org/debian trixie/main amd64 libxdamage1 amd64 1:1.1.6-1+b2 [15.5 kB] Get: 150 http://deb.debian.org/debian trixie/main amd64 libxinerama1 amd64 2:1.1.4-3+b4 [16.0 kB] Get: 151 http://deb.debian.org/debian trixie/main amd64 xkb-data all 2.42-1 [790 kB] Get: 152 http://deb.debian.org/debian trixie/main amd64 libxkbcommon0 amd64 1.7.0-2 [113 kB] Get: 153 http://deb.debian.org/debian trixie/main amd64 libxrandr2 amd64 2:1.5.4-1+b3 [36.3 kB] Get: 154 http://deb.debian.org/debian trixie/main amd64 libgtk-3-common all 3.24.49-3 [4908 kB] Get: 155 http://deb.debian.org/debian trixie/main amd64 libgtk-3-0t64 amd64 3.24.49-3 [2769 kB] Get: 156 http://deb.debian.org/debian trixie/main amd64 libglvnd0 amd64 1.7.0-1+b2 [52.0 kB] Get: 157 http://deb.debian.org/debian trixie/main amd64 libdrm-common all 2.4.124-2 [8288 B] Get: 158 http://deb.debian.org/debian trixie/main amd64 libdrm2 amd64 2.4.124-2 [39.0 kB] Get: 159 http://deb.debian.org/debian trixie/main amd64 libx11-xcb1 amd64 2:1.8.12-1 [247 kB] Get: 160 http://deb.debian.org/debian trixie/main amd64 libxcb-dri3-0 amd64 1.17.0-2+b1 [107 kB] Get: 161 http://deb.debian.org/debian trixie/main amd64 libxcb-glx0 amd64 1.17.0-2+b1 [122 kB] Get: 162 http://deb.debian.org/debian trixie/main amd64 libxcb-present0 amd64 1.17.0-2+b1 [106 kB] Get: 163 http://deb.debian.org/debian trixie/main amd64 libxcb-xfixes0 amd64 1.17.0-2+b1 [109 kB] Get: 164 http://deb.debian.org/debian trixie/main amd64 libxxf86vm1 amd64 1:1.1.4-1+b4 [19.3 kB] Get: 165 http://deb.debian.org/debian trixie/main amd64 libdrm-amdgpu1 amd64 2.4.124-2 [22.6 kB] Get: 166 http://deb.debian.org/debian trixie/main amd64 libpciaccess0 amd64 0.17-3+b3 [51.9 kB] Get: 167 http://deb.debian.org/debian trixie/main amd64 libdrm-intel1 amd64 2.4.124-2 [64.1 kB] Get: 168 http://deb.debian.org/debian trixie/main amd64 libedit2 amd64 3.1-20250104-1 [93.8 kB] Get: 169 http://deb.debian.org/debian trixie/main amd64 libz3-4 amd64 4.13.3-1 [8560 kB] Get: 170 http://deb.debian.org/debian trixie/main amd64 libllvm19 amd64 1:19.1.7-3+b1 [26.0 MB] Get: 171 http://deb.debian.org/debian trixie/main amd64 libsensors-config all 1:3.6.2-2 [16.2 kB] Get: 172 http://deb.debian.org/debian trixie/main amd64 libsensors5 amd64 1:3.6.2-2 [37.5 kB] Get: 173 http://deb.debian.org/debian trixie/main amd64 libxcb-randr0 amd64 1.17.0-2+b1 [117 kB] Get: 174 http://deb.debian.org/debian trixie/main amd64 libxcb-sync1 amd64 1.17.0-2+b1 [109 kB] Get: 175 http://deb.debian.org/debian trixie/main amd64 libxshmfence1 amd64 1.3.3-1 [10.9 kB] Get: 176 http://deb.debian.org/debian trixie/main amd64 mesa-libgallium amd64 25.0.7-2 [9629 kB] Get: 177 http://deb.debian.org/debian trixie/main amd64 libwayland-server0 amd64 1.23.1-3 [34.4 kB] Get: 178 http://deb.debian.org/debian trixie/main amd64 libgbm1 amd64 25.0.7-2 [44.4 kB] Get: 179 http://deb.debian.org/debian trixie/main amd64 libvulkan1 amd64 1.4.309.0-1 [130 kB] Get: 180 http://deb.debian.org/debian trixie/main amd64 libgl1-mesa-dri amd64 25.0.7-2 [46.1 kB] Get: 181 http://deb.debian.org/debian trixie/main amd64 libglx-mesa0 amd64 25.0.7-2 [143 kB] Get: 182 http://deb.debian.org/debian trixie/main amd64 libglx0 amd64 1.7.0-1+b2 [34.9 kB] Get: 183 http://deb.debian.org/debian trixie/main amd64 libgl1 amd64 1.7.0-1+b2 [89.5 kB] Get: 184 http://deb.debian.org/debian trixie/main amd64 libasound2-data all 1.2.14-1 [21.1 kB] Get: 185 http://deb.debian.org/debian trixie/main amd64 libasound2t64 amd64 1.2.14-1 [381 kB] Get: 186 http://deb.debian.org/debian trixie/main amd64 libgif7 amd64 5.2.2-1+b1 [44.2 kB] Get: 187 http://deb.debian.org/debian trixie/main amd64 x11-common all 1:7.7+24 [217 kB] Get: 188 http://deb.debian.org/debian trixie/main amd64 libxtst6 amd64 2:1.2.5-1 [25.8 kB] Get: 189 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jre amd64 21.0.8+9-1 [205 kB] Get: 190 http://deb.debian.org/debian trixie/main amd64 default-jre amd64 2:1.21-76 [1068 B] Get: 191 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jdk-headless amd64 21.0.8+9-1 [82.9 MB] Get: 192 http://deb.debian.org/debian trixie/main amd64 default-jdk-headless amd64 2:1.21-76 [1124 B] Get: 193 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jdk amd64 21.0.8+9-1 [3624 kB] Get: 194 http://deb.debian.org/debian trixie/main amd64 default-jdk amd64 2:1.21-76 [1076 B] Get: 195 http://deb.debian.org/debian trixie/main amd64 libgpg-error0 amd64 1.51-4 [82.1 kB] Get: 196 http://deb.debian.org/debian trixie/main amd64 libassuan9 amd64 3.0.2-2 [61.5 kB] Get: 197 http://deb.debian.org/debian trixie/main amd64 libgcrypt20 amd64 1.11.0-7 [843 kB] Get: 198 http://deb.debian.org/debian trixie/main amd64 gpgconf amd64 2.4.7-21+b3 [129 kB] Get: 199 http://deb.debian.org/debian trixie/main amd64 libksba8 amd64 1.6.7-2+b1 [136 kB] Get: 200 http://deb.debian.org/debian trixie/main amd64 libnpth0t64 amd64 1.8-3 [23.2 kB] Get: 201 http://deb.debian.org/debian trixie/main amd64 gpg amd64 2.4.7-21+b3 [634 kB] Get: 202 http://deb.debian.org/debian trixie/main amd64 pinentry-curses amd64 1.3.1-2 [86.4 kB] Get: 203 http://deb.debian.org/debian trixie/main amd64 gpg-agent amd64 2.4.7-21+b3 [271 kB] Get: 204 http://deb.debian.org/debian trixie/main amd64 libfile-dirlist-perl all 0.05-3 [7600 B] Get: 205 http://deb.debian.org/debian trixie/main amd64 libfile-which-perl all 1.27-2 [15.1 kB] Get: 206 http://deb.debian.org/debian trixie/main amd64 libfile-homedir-perl all 1.006-2 [42.4 kB] Get: 207 http://deb.debian.org/debian trixie/main amd64 libfile-touch-perl all 0.12-2 [8816 B] Get: 208 http://deb.debian.org/debian trixie/main amd64 libclass-method-modifiers-perl all 2.15-1 [18.0 kB] Get: 209 http://deb.debian.org/debian trixie/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b5 [36.1 kB] Get: 210 http://deb.debian.org/debian trixie/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b2 [10.6 kB] Get: 211 http://deb.debian.org/debian trixie/main amd64 libdynaloader-functions-perl all 0.004-2 [12.2 kB] Get: 212 http://deb.debian.org/debian trixie/main amd64 libdevel-callchecker-perl amd64 0.009-2 [15.6 kB] Get: 213 http://deb.debian.org/debian trixie/main amd64 libparams-classify-perl amd64 0.015-2+b4 [22.5 kB] Get: 214 http://deb.debian.org/debian trixie/main amd64 libmodule-runtime-perl all 0.018-1 [17.8 kB] Get: 215 http://deb.debian.org/debian trixie/main amd64 libimport-into-perl all 1.002005-2 [11.3 kB] Get: 216 http://deb.debian.org/debian trixie/main amd64 librole-tiny-perl all 2.002004-1 [21.4 kB] Get: 217 http://deb.debian.org/debian trixie/main amd64 libsub-quote-perl all 2.006008-1 [21.8 kB] Get: 218 http://deb.debian.org/debian trixie/main amd64 libmoo-perl all 2.005005-1 [58.0 kB] Get: 219 http://deb.debian.org/debian trixie/main amd64 libencode-locale-perl all 1.05-3 [12.9 kB] Get: 220 http://deb.debian.org/debian trixie/main amd64 libtimedate-perl all 2.3300-2 [39.3 kB] Get: 221 http://deb.debian.org/debian trixie/main amd64 libhttp-date-perl all 6.06-1 [10.7 kB] Get: 222 http://deb.debian.org/debian trixie/main amd64 libfile-listing-perl all 6.16-1 [12.4 kB] Get: 223 http://deb.debian.org/debian trixie/main amd64 libhtml-tagset-perl all 3.24-1 [14.7 kB] Get: 224 http://deb.debian.org/debian trixie/main amd64 liburi-perl all 5.30-1 [105 kB] Get: 225 http://deb.debian.org/debian trixie/main amd64 libhtml-parser-perl amd64 3.83-1+b2 [99.7 kB] Get: 226 http://deb.debian.org/debian trixie/main amd64 libhtml-tree-perl all 5.07-3 [211 kB] Get: 227 http://deb.debian.org/debian trixie/main amd64 libclone-perl amd64 0.47-1+b1 [13.9 kB] Get: 228 http://deb.debian.org/debian trixie/main amd64 libio-html-perl all 1.004-3 [16.2 kB] Get: 229 http://deb.debian.org/debian trixie/main amd64 liblwp-mediatypes-perl all 6.04-2 [20.2 kB] Get: 230 http://deb.debian.org/debian trixie/main amd64 libhttp-message-perl all 7.00-2 [79.8 kB] Get: 231 http://deb.debian.org/debian trixie/main amd64 libhttp-cookies-perl all 6.11-1 [19.1 kB] Get: 232 http://deb.debian.org/debian trixie/main amd64 libhttp-negotiate-perl all 6.01-2 [13.1 kB] Get: 233 http://deb.debian.org/debian trixie/main amd64 perl-openssl-defaults amd64 7+b2 [6724 B] Get: 234 http://deb.debian.org/debian trixie/main amd64 libnet-ssleay-perl amd64 1.94-3 [339 kB] Get: 235 http://deb.debian.org/debian trixie/main amd64 libio-socket-ssl-perl all 2.089-1 [223 kB] Get: 236 http://deb.debian.org/debian trixie/main amd64 libnet-http-perl all 6.23-1 [23.9 kB] Get: 237 http://deb.debian.org/debian trixie/main amd64 liblwp-protocol-https-perl all 6.14-1 [10.8 kB] Get: 238 http://deb.debian.org/debian trixie/main amd64 libtry-tiny-perl all 0.32-1 [22.9 kB] Get: 239 http://deb.debian.org/debian trixie/main amd64 libwww-robotrules-perl all 6.02-1 [12.9 kB] Get: 240 http://deb.debian.org/debian trixie/main amd64 libwww-perl all 6.78-1 [183 kB] Get: 241 http://deb.debian.org/debian trixie/main amd64 patchutils amd64 0.4.2-1 [77.5 kB] Get: 242 http://deb.debian.org/debian trixie/main amd64 gpgv amd64 2.4.7-21+b3 [241 kB] Get: 243 http://deb.debian.org/debian trixie/main amd64 sopv-gpgv all 0.1.4-1 [11.3 kB] Get: 244 http://deb.debian.org/debian trixie/main amd64 wdiff amd64 1.2.2-9 [122 kB] Get: 245 http://deb.debian.org/debian trixie/main amd64 devscripts all 2.25.15 [1067 kB] Get: 246 http://deb.debian.org/debian trixie/main amd64 fastjar amd64 2:0.98-7 [80.1 kB] Get: 247 http://deb.debian.org/debian trixie/main amd64 jarwrapper all 0.80 [9692 B] Get: 248 http://deb.debian.org/debian trixie/main amd64 javahelper all 0.80 [80.4 kB] Get: 249 http://deb.debian.org/debian trixie/main amd64 libhamcrest-java all 2.2-2 [121 kB] Get: 250 http://deb.debian.org/debian trixie/main amd64 junit4 all 4.13.2-5 [350 kB] Get: 251 http://deb.debian.org/debian trixie/main amd64 libapiguardian-java all 1.1.2-1 [4656 B] Get: 252 http://deb.debian.org/debian trixie/main amd64 libopentest4j-java all 1.2.0-4 [9516 B] Get: 253 http://deb.debian.org/debian trixie/main amd64 libopentest4j-reporting-java all 0.1.0-M1-2 [49.0 kB] Get: 254 http://deb.debian.org/debian trixie/main amd64 libpicocli-java all 4.6.2-2 [390 kB] Get: 255 http://deb.debian.org/debian trixie/main amd64 libunivocity-parsers-java all 2.9.1-1 [397 kB] Get: 256 http://deb.debian.org/debian trixie/main amd64 junit5 all 5.10.3-1 [2459 kB] Get: 257 http://deb.debian.org/debian trixie/main amd64 libactivation-java all 1.2.0-2 [84.7 kB] Get: 258 http://deb.debian.org/debian trixie/main amd64 libaopalliance-java all 20070526-7 [8572 B] Get: 259 http://deb.debian.org/debian trixie/main amd64 libapache-pom-java all 33-2 [5852 B] Get: 260 http://deb.debian.org/debian trixie/main amd64 libasm-java all 9.8-1 [392 kB] Get: 261 http://deb.debian.org/debian trixie/main amd64 libatinject-jsr330-api-java all 1.0+ds1-6 [5112 B] Get: 262 http://deb.debian.org/debian trixie/main amd64 libcommons-parent-java all 56-1 [10.8 kB] Get: 263 http://deb.debian.org/debian trixie/main amd64 libcommons-lang3-java all 3.17.0-1 [641 kB] Get: 264 http://deb.debian.org/debian trixie/main amd64 libfreemarker-java all 2.3.32-2.1 [1525 kB] Get: 265 http://deb.debian.org/debian trixie/main amd64 libgoogle-gson-java all 2.10.1-1 [262 kB] Get: 266 http://deb.debian.org/debian trixie/main amd64 libjoptsimple-java all 5.0.4-7 [73.7 kB] Get: 267 http://deb.debian.org/debian trixie/main amd64 libcommons-codec-java all 1.18.0-1 [304 kB] Get: 268 http://deb.debian.org/debian trixie/main amd64 libcommons-logging-java all 1.3.0-2 [68.6 kB] Get: 269 http://deb.debian.org/debian trixie/main amd64 libhttpcore-java all 4.4.16-1 [636 kB] Get: 270 http://deb.debian.org/debian trixie/main amd64 libhttpclient-java all 4.5.14-1 [1247 kB] Get: 271 http://deb.debian.org/debian trixie/main amd64 liblightcouch-java all 0.2.0-1 [75.0 kB] Get: 272 http://deb.debian.org/debian trixie/main amd64 libmongodb-java all 3.6.3-2 [1901 kB] Get: 273 http://deb.debian.org/debian trixie/main amd64 libslf4j-java all 1.7.32-2 [142 kB] Get: 274 http://deb.debian.org/debian trixie/main amd64 liblog4j2-java all 2.19.0-2 [2310 kB] Get: 275 http://deb.debian.org/debian trixie/main amd64 libbarclay-java all 5.0.0+dfsg-1 [108 kB] Get: 276 http://deb.debian.org/debian trixie/main amd64 libblas3 amd64 3.12.1-4 [160 kB] Get: 277 http://deb.debian.org/debian trixie/main amd64 libbsh-java all 2.0b4-20 [291 kB] Get: 278 http://deb.debian.org/debian trixie/main amd64 libcommons-io-java all 2.19.0-1 [524 kB] Get: 279 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-utils-java all 3.4.2-1 [137 kB] Get: 280 http://deb.debian.org/debian trixie/main amd64 libcommons-cli-java all 1.6.0-1 [60.4 kB] Get: 281 http://deb.debian.org/debian trixie/main amd64 libgeronimo-annotation-1.3-spec-java all 1.3-1 [11.1 kB] Get: 282 http://deb.debian.org/debian trixie/main amd64 liberror-prone-java all 2.18.0-1 [22.5 kB] Get: 283 http://deb.debian.org/debian trixie/main amd64 libjsr305-java all 0.1~+svn49-12 [26.6 kB] Get: 284 http://deb.debian.org/debian trixie/main amd64 libguava-java all 32.0.1-1 [2708 kB] Get: 285 http://deb.debian.org/debian trixie/main amd64 libguice-java all 5.1.0-1 [932 kB] Get: 286 http://deb.debian.org/debian trixie/main amd64 libmaven-parent-java all 43-2 [6252 B] Get: 287 http://deb.debian.org/debian trixie/main amd64 libplexus-utils2-java all 3.4.2-1 [258 kB] Get: 288 http://deb.debian.org/debian trixie/main amd64 libwagon-provider-api-java all 3.5.3-2 [48.3 kB] Get: 289 http://deb.debian.org/debian trixie/main amd64 libmaven-resolver-java all 1.9.22-1 [729 kB] Get: 290 http://deb.debian.org/debian trixie/main amd64 libplexus-cipher-java all 2.0-1 [14.9 kB] Get: 291 http://deb.debian.org/debian trixie/main amd64 libplexus-classworlds-java all 2.7.0-1 [50.6 kB] Get: 292 http://deb.debian.org/debian trixie/main amd64 libplexus-component-annotations-java all 2.1.1-1 [7660 B] Get: 293 http://deb.debian.org/debian trixie/main amd64 libplexus-interpolation-java all 1.27-1 [76.8 kB] Get: 294 http://deb.debian.org/debian trixie/main amd64 libplexus-sec-dispatcher-java all 2.0-3 [28.3 kB] Get: 295 http://deb.debian.org/debian trixie/main amd64 libgeronimo-interceptor-3.0-spec-java all 1.0.1-5 [8444 B] Get: 296 http://deb.debian.org/debian trixie/main amd64 libcdi-api-java all 1.2-4 [55.3 kB] Get: 297 http://deb.debian.org/debian trixie/main amd64 libsisu-inject-java all 0.3.5-1 [352 kB] Get: 298 http://deb.debian.org/debian trixie/main amd64 libsisu-plexus-java all 0.3.5-1 [183 kB] Get: 299 http://deb.debian.org/debian trixie/main amd64 libmaven3-core-java all 3.9.9-1 [1661 kB] Get: 300 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-io-java all 3.0.0-4 [33.2 kB] Get: 301 http://deb.debian.org/debian trixie/main amd64 libmaven-file-management-java all 3.0.0-2 [35.1 kB] Get: 302 http://deb.debian.org/debian trixie/main amd64 libbuild-helper-maven-plugin-java all 3.3.0-1 [59.5 kB] Get: 303 http://deb.debian.org/debian trixie/main amd64 libbyte-buddy-java all 1.14.19-1 [4756 kB] Get: 304 http://deb.debian.org/debian trixie/main amd64 libcolt-free-java all 1.2.0+dfsg-8 [440 kB] Get: 305 http://deb.debian.org/debian trixie/main amd64 libcommons-collections3-java all 3.2.2-3 [530 kB] Get: 306 http://deb.debian.org/debian trixie/main amd64 libcommons-beanutils-java all 1.10.1-1.1 [231 kB] Get: 307 http://deb.debian.org/debian trixie/main amd64 libcommons-collections4-java all 4.4-2 [682 kB] Get: 308 http://deb.debian.org/debian trixie/main amd64 libcommons-compress-java all 1.27.1-2 [641 kB] Get: 309 http://deb.debian.org/debian trixie/main amd64 libcommons-lang-java all 2.6-10 [273 kB] Get: 310 http://deb.debian.org/debian trixie/main amd64 libcommons-configuration-java all 1.10-7 [348 kB] Get: 311 http://deb.debian.org/debian trixie/main amd64 libcommons-digester-java all 1.8.1-7 [138 kB] Get: 312 http://deb.debian.org/debian trixie/main amd64 libcommons-exec-java all 1.3-3 [48.4 kB] Get: 313 http://deb.debian.org/debian trixie/main amd64 libcommons-jexl2-java all 2.1.1-6 [256 kB] Get: 314 http://deb.debian.org/debian trixie/main amd64 libcommons-math-java all 2.2-9 [933 kB] Get: 315 http://deb.debian.org/debian trixie/main amd64 libcommons-math3-java all 3.6.1-4 [2040 kB] Get: 316 http://deb.debian.org/debian trixie/main amd64 libplexus-io-java all 3.3.1-2 [65.3 kB] Get: 317 http://deb.debian.org/debian trixie/main amd64 libsnappy1v5 amd64 1.2.2-1 [29.3 kB] Get: 318 http://deb.debian.org/debian trixie/main amd64 libsnappy-jni amd64 1.1.10.7-1 [6492 B] Get: 319 http://deb.debian.org/debian trixie/main amd64 libsnappy-java all 1.1.10.7-1 [87.6 kB] Get: 320 http://deb.debian.org/debian trixie/main amd64 libxz-java all 1.9-1 [143 kB] Get: 321 http://deb.debian.org/debian trixie/main amd64 libplexus-archiver-java all 4.6.1-1 [187 kB] Get: 322 http://deb.debian.org/debian trixie/main amd64 libmaven-archiver-java all 3.6.2-1 [26.1 kB] Get: 323 http://deb.debian.org/debian trixie/main amd64 libmaven-jar-plugin-java all 3.3.0-2 [24.0 kB] Get: 324 http://deb.debian.org/debian trixie/main amd64 libcommons-text-java all 1.13.1-1 [228 kB] Get: 325 http://deb.debian.org/debian trixie/main amd64 sgml-base all 1.31+nmu1 [10.9 kB] Get: 326 http://deb.debian.org/debian trixie/main amd64 libcommons-validator-java all 1:1.9.0-1 [191 kB] Get: 327 http://deb.debian.org/debian trixie/main amd64 libsasl2-modules-db amd64 2.1.28+dfsg1-9 [19.8 kB] Get: 328 http://deb.debian.org/debian trixie/main amd64 libsasl2-2 amd64 2.1.28+dfsg1-9 [57.5 kB] Get: 329 http://deb.debian.org/debian trixie/main amd64 libldap2 amd64 2.6.10+dfsg-1 [194 kB] Get: 330 http://deb.debian.org/debian trixie/main amd64 libnghttp2-14 amd64 1.64.0-1.1 [76.0 kB] Get: 331 http://deb.debian.org/debian trixie/main amd64 libnghttp3-9 amd64 1.8.0-1 [67.7 kB] Get: 332 http://deb.debian.org/debian trixie/main amd64 libpsl5t64 amd64 0.21.2-1.1+b1 [57.2 kB] Get: 333 http://deb.debian.org/debian trixie/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2+b5 [58.8 kB] Get: 334 http://deb.debian.org/debian trixie/main amd64 libssh2-1t64 amd64 1.11.1-1 [245 kB] Get: 335 http://deb.debian.org/debian trixie/main amd64 libcurl4t64 amd64 8.14.1-2 [391 kB] Get: 336 http://deb.debian.org/debian trixie/main amd64 libdistlib-java all 1.0-5 [72.5 kB] Get: 337 http://deb.debian.org/debian trixie/main amd64 libjaxen-java all 1.1.6-5 [214 kB] Get: 338 http://deb.debian.org/debian trixie/main amd64 libdom4j-java all 2.1.4-1 [312 kB] Get: 339 http://deb.debian.org/debian trixie/main amd64 libdoxia-core-java all 2.0.0-1 [149 kB] Get: 340 http://deb.debian.org/debian trixie/main amd64 libplexus-xml-java all 3.0.1-2 [93.7 kB] Get: 341 http://deb.debian.org/debian trixie/main amd64 libdoxia-java all 2.0.0-1 [113 kB] Get: 342 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-api-java all 4.0.0-1 [6724 B] Get: 343 http://deb.debian.org/debian trixie/main amd64 libxbean-reflect-java all 4.5-9 [132 kB] Get: 344 http://deb.debian.org/debian trixie/main amd64 libplexus-container-default-java all 2.1.1-1 [193 kB] Get: 345 http://deb.debian.org/debian trixie/main amd64 libplexus-i18n-java all 1.0-beta-10-6 [13.4 kB] Get: 346 http://deb.debian.org/debian trixie/main amd64 velocity all 1.7-7 [431 kB] Get: 347 http://deb.debian.org/debian trixie/main amd64 libplexus-velocity-java all 1.2-4 [9676 B] Get: 348 http://deb.debian.org/debian trixie/main amd64 liboro-java all 2.0.8a-15 [69.3 kB] Get: 349 http://deb.debian.org/debian trixie/main amd64 libvelocity-tools-java all 2.0-9 [311 kB] Get: 350 http://deb.debian.org/debian trixie/main amd64 libdoxia-sitetools-java all 2.0.0-1 [176 kB] Get: 351 http://deb.debian.org/debian trixie/main amd64 libfastutil-java all 8.5.15+dfsg-1 [20.0 MB] Get: 352 http://deb.debian.org/debian trixie/main amd64 libxpp3-java all 1.1.4c-4 [294 kB] Get: 353 http://deb.debian.org/debian trixie/main amd64 libxstream-java all 1.4.21-1 [567 kB] Get: 354 http://deb.debian.org/debian trixie/main amd64 libjsap-java all 2.1-5 [102 kB] Get: 355 http://deb.debian.org/debian trixie/main amd64 liblogback-java all 1:1.2.11-6 [701 kB] Get: 356 http://deb.debian.org/debian trixie/main amd64 libdsiutils-java all 2.7.3+dfsg-1 [524 kB] Get: 357 http://deb.debian.org/debian trixie/main amd64 libobjenesis-java all 3.4-2 [41.3 kB] Get: 358 http://deb.debian.org/debian trixie/main amd64 libeasymock-java all 5.5.0-1 [134 kB] Get: 359 http://deb.debian.org/debian trixie/main amd64 libel-api-java all 3.0.0-3 [64.9 kB] Get: 360 http://deb.debian.org/debian trixie/main amd64 libexec-maven-plugin-java all 3.1.0-2 [66.7 kB] Get: 361 http://deb.debian.org/debian trixie/main amd64 libezmorph-java all 1.0.6-4 [75.9 kB] Get: 362 http://deb.debian.org/debian trixie/main amd64 libgatk-native-bindings-java all 1.0.0+dfsg-2 [8024 B] Get: 363 http://deb.debian.org/debian trixie/main amd64 libgfortran5 amd64 14.2.0-19 [836 kB] Get: 364 http://deb.debian.org/debian trixie/main amd64 libxml-commons-external-java all 1.4.01-6 [240 kB] Get: 365 http://deb.debian.org/debian trixie/main amd64 libxml-commons-resolver1.1-java all 1.2-11 [98.3 kB] Get: 366 http://deb.debian.org/debian trixie/main amd64 libxerces2-java all 2.12.2-1 [1440 kB] Get: 367 http://deb.debian.org/debian trixie/main amd64 libxom-java all 1.3.9-1 [174 kB] Get: 368 http://deb.debian.org/debian trixie/main amd64 libjson-java all 3.1.0+dfsg-2 [142 kB] Get: 369 http://deb.debian.org/debian trixie/main amd64 libmbedcrypto16 amd64 3.6.4-2 [360 kB] Get: 370 http://deb.debian.org/debian trixie/main amd64 libmbedx509-7 amd64 3.6.4-2 [151 kB] Get: 371 http://deb.debian.org/debian trixie/main amd64 libmbedtls21 amd64 3.6.4-2 [242 kB] Get: 372 http://deb.debian.org/debian trixie/main amd64 ncbi-vdb-data all 3.2.1+dfsg-2 [88.5 kB] Get: 373 http://deb.debian.org/debian trixie/main amd64 libncbi-vdb3 amd64 3.2.1+dfsg-2 [1164 kB] Get: 374 http://deb.debian.org/debian trixie/main amd64 libncbi-ngs3 amd64 3.2.1+dfsg-4 [159 kB] Get: 375 http://deb.debian.org/debian trixie/main amd64 libngs-jni amd64 3.2.1+dfsg-4 [27.7 kB] Get: 376 http://deb.debian.org/debian trixie/main amd64 libngs-java amd64 3.2.1+dfsg-4 [114 kB] Get: 377 http://deb.debian.org/debian trixie/main amd64 librhino-java all 1.7.15-1 [1382 kB] Get: 378 http://deb.debian.org/debian trixie/main amd64 libhtsjdk-java all 4.1.3+dfsg-2 [1841 kB] Get: 379 http://deb.debian.org/debian trixie/main amd64 libgkl-java all 0.8.11+dfsg-2 [24.7 kB] Get: 380 http://deb.debian.org/debian trixie/main amd64 libicu4j-java all 73.2-1 [16.4 MB] Get: 381 http://deb.debian.org/debian trixie/main amd64 liblog4j1.2-java all 1.2.17-11 [444 kB] Get: 382 http://deb.debian.org/debian trixie/main amd64 libicb-utils-java all 2.0.1+git20161002.afee1d9-5 [81.5 kB] Get: 383 http://deb.debian.org/debian trixie/main amd64 libice6 amd64 2:1.1.1-1 [65.4 kB] Get: 384 http://deb.debian.org/debian trixie/main amd64 libicu76 amd64 76.1-4 [9722 kB] Get: 385 http://deb.debian.org/debian trixie/main amd64 libjansi-java all 2.4.1-2 [100 kB] Get: 386 http://deb.debian.org/debian trixie/main amd64 libjavassist-java all 1:3.27.0-1 [731 kB] Get: 387 http://deb.debian.org/debian trixie/main amd64 libjaxb-api-java all 2.3.1-1 [119 kB] Get: 388 http://deb.debian.org/debian trixie/main amd64 libjboss-logging-java all 3.5.3-1 [56.2 kB] Get: 389 http://deb.debian.org/debian trixie/main amd64 libjboss-vfs-java all 3.2.15.Final-3 [130 kB] Get: 390 http://deb.debian.org/debian trixie/main amd64 libjbzip2-java all 0.9.1-8 [42.7 kB] Get: 391 http://deb.debian.org/debian trixie/main amd64 libjcommander-java all 1.71-4 [73.0 kB] Get: 392 http://deb.debian.org/debian trixie/main amd64 libjsp-api-java all 2.3.4-3 [53.7 kB] Get: 393 http://deb.debian.org/debian trixie/main amd64 libservlet-api-java all 4.0.1-2 [81.0 kB] Get: 394 http://deb.debian.org/debian trixie/main amd64 libwebsocket-api-java all 1.1-2 [40.1 kB] Get: 395 http://deb.debian.org/debian trixie/main amd64 libjetty9-java all 9.4.57-1 [2965 kB] Get: 396 http://deb.debian.org/debian trixie/main amd64 libjsoup-java all 1.15.3-1 [431 kB] Get: 397 http://deb.debian.org/debian trixie/main amd64 libjtidy-java all 7+svn20110807-6 [251 kB] Get: 398 http://deb.debian.org/debian trixie/main amd64 liblapack3 amd64 3.12.1-4 [2447 kB] Get: 399 http://deb.debian.org/debian trixie/main amd64 libmaven-antrun-plugin-java all 3.1.0-1 [36.9 kB] Get: 400 http://deb.debian.org/debian trixie/main amd64 libmaven-common-artifact-filters-java all 3.4.0-1 [47.7 kB] Get: 401 http://deb.debian.org/debian trixie/main amd64 libmaven-artifact-transfer-java all 0.13.1-3 [158 kB] Get: 402 http://deb.debian.org/debian trixie/main amd64 libplexus-build-api-java all 0.0.7-4 [10.3 kB] Get: 403 http://deb.debian.org/debian trixie/main amd64 libmaven-filtering-java all 3.4.0-1 [51.4 kB] Get: 404 http://deb.debian.org/debian trixie/main amd64 libmaven-assembly-plugin-java all 3.4.2-2 [242 kB] Get: 405 http://deb.debian.org/debian trixie/main amd64 libmaven-clean-plugin-java all 3.2.0-2 [32.2 kB] Get: 406 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-incremental-java all 1.1-6 [9916 B] Get: 407 http://deb.debian.org/debian trixie/main amd64 libplexus-compiler-java all 2.13.0-1 [99.5 kB] Get: 408 http://deb.debian.org/debian trixie/main amd64 libqdox2-java all 2.0.3-1 [296 kB] Get: 409 http://deb.debian.org/debian trixie/main amd64 libplexus-languages-java all 1.1.1-3 [47.8 kB] Get: 410 http://deb.debian.org/debian trixie/main amd64 libmaven-compiler-plugin-java all 3.13.0-1 [78.8 kB] Get: 411 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-analyzer-java all 1.15.1-1 [38.5 kB] Get: 412 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-tree-java all 3.3.0-1 [35.0 kB] Get: 413 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-impl-java all 4.0.0-1 [17.6 kB] Get: 414 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-plugin-java all 3.8.1-1 [191 kB] Get: 415 http://deb.debian.org/debian trixie/main amd64 libmaven-invoker-java all 3.3.0-1 [29.1 kB] Get: 416 http://deb.debian.org/debian trixie/main amd64 libplexus-interactivity-api-java all 1.3-1 [11.6 kB] Get: 417 http://deb.debian.org/debian trixie/main amd64 libmaven-javadoc-plugin-java all 3.10.1-2 [451 kB] Get: 418 http://deb.debian.org/debian trixie/main amd64 libplexus-ant-factory-java all 1.0~alpha2.1-5 [11.7 kB] Get: 419 http://deb.debian.org/debian trixie/main amd64 libplexus-container-default1.5-java all 2.1.1-1 [4476 B] Get: 420 http://deb.debian.org/debian trixie/main amd64 libplexus-bsh-factory-java all 1.0~alpha7-5 [8360 B] Get: 421 http://deb.debian.org/debian trixie/main amd64 libmaven-plugin-tools-java all 3.10.2-2 [245 kB] Get: 422 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-exec-java all 2.0.0-1 [23.9 kB] Get: 423 http://deb.debian.org/debian trixie/main amd64 libmaven-resources-plugin-java all 3.3.1-1 [27.5 kB] Get: 424 http://deb.debian.org/debian trixie/main amd64 libmaven-site-plugin-java all 3.21.0-1 [106 kB] Get: 425 http://deb.debian.org/debian trixie/main amd64 libmaven-source-plugin-java all 3.3.1-1 [27.7 kB] Get: 426 http://deb.debian.org/debian trixie/main amd64 libpaper2 amd64 2.2.5-0.3+b2 [16.7 kB] Get: 427 http://deb.debian.org/debian trixie/main amd64 libpaper-utils amd64 2.2.5-0.3+b2 [16.5 kB] Get: 428 http://deb.debian.org/debian trixie/main amd64 libpicard-java all 3.3.0+dfsg-2 [1778 kB] Get: 429 http://deb.debian.org/debian trixie/main amd64 libpj-java all 0.0~20150107+dfsg-5 [1389 kB] Get: 430 http://deb.debian.org/debian trixie/main amd64 libpkgconf3 amd64 1.8.1-4 [36.4 kB] Get: 431 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] Get: 432 http://deb.debian.org/debian trixie/main amd64 libprotobuf32t64 amd64 3.21.12-11 [983 kB] Get: 433 http://deb.debian.org/debian trixie/main amd64 libprotobuf-lite32t64 amd64 3.21.12-11 [274 kB] Get: 434 http://deb.debian.org/debian trixie/main amd64 libprotobuf-dev amd64 3.21.12-11 [1328 kB] Get: 435 http://deb.debian.org/debian trixie/main amd64 libprotobuf-java all 3.21.12-11 [1267 kB] Get: 436 http://deb.debian.org/debian trixie/main amd64 libprotoc32t64 amd64 3.21.12-11 [922 kB] Get: 437 http://deb.debian.org/debian trixie/main amd64 libreflections-java all 0.10.2+dfsg-2 [125 kB] Get: 438 http://deb.debian.org/debian trixie/main amd64 libsm6 amd64 2:1.2.6-1 [37.3 kB] Get: 439 http://deb.debian.org/debian trixie/main amd64 libsurefire-java all 2.22.3-4 [1391 kB] Get: 440 http://deb.debian.org/debian trixie/main amd64 libtcl8.6 amd64 8.6.16+dfsg-1 [1042 kB] Get: 441 http://deb.debian.org/debian trixie/main amd64 libtirpc-common all 1.3.6+ds-1 [11.0 kB] Get: 442 http://deb.debian.org/debian trixie/main amd64 libtirpc3t64 amd64 1.3.6+ds-1 [83.3 kB] Get: 443 http://deb.debian.org/debian trixie/main amd64 libxft2 amd64 2.3.6-1+b4 [54.5 kB] Get: 444 http://deb.debian.org/debian trixie/main amd64 libxss1 amd64 1:1.2.3-1+b3 [17.0 kB] Get: 445 http://deb.debian.org/debian trixie/main amd64 libtk8.6 amd64 8.6.16-1 [793 kB] Get: 446 http://deb.debian.org/debian trixie/main amd64 libwagon-file-java all 3.5.3-2 [8452 B] Get: 447 http://deb.debian.org/debian trixie/main amd64 libwagon-http-java all 3.5.3-2 [49.6 kB] Get: 448 http://deb.debian.org/debian trixie/main amd64 libxml2-utils amd64 2.12.7+dfsg+really2.9.14-2.1 [100 kB] Get: 449 http://deb.debian.org/debian trixie/main amd64 libxt6t64 amd64 1:1.2.1-1.2+b2 [188 kB] Get: 450 http://deb.debian.org/debian trixie/main amd64 maven all 3.9.9-1 [19.7 kB] Get: 451 http://deb.debian.org/debian trixie/main amd64 maven-repo-helper all 1.11 [142 kB] Get: 452 http://deb.debian.org/debian trixie/main amd64 unzip amd64 6.0-29 [173 kB] Get: 453 http://deb.debian.org/debian trixie/main amd64 maven-debian-helper all 2.6.7 [108 kB] Get: 454 http://deb.debian.org/debian trixie/main amd64 pkgconf-bin amd64 1.8.1-4 [30.2 kB] Get: 455 http://deb.debian.org/debian trixie/main amd64 pkgconf amd64 1.8.1-4 [26.2 kB] Get: 456 http://deb.debian.org/debian trixie/main amd64 protobuf-compiler amd64 3.21.12-11 [84.7 kB] Get: 457 http://deb.debian.org/debian trixie/main amd64 zip amd64 3.0-15 [235 kB] Get: 458 http://deb.debian.org/debian trixie/main amd64 xdg-utils all 1.2.1-2 [75.8 kB] Get: 459 http://deb.debian.org/debian trixie/main amd64 r-base-core amd64 4.5.0-3 [28.6 MB] Get: 460 http://deb.debian.org/debian trixie/main amd64 r-cran-rjava amd64 1.0-11-2 [713 kB] Get: 461 http://deb.debian.org/debian trixie/main amd64 testng all 6.9.12-4 [795 kB] Fetched 386 MB in 5s (71.2 MB/s) Preconfiguring packages ... Selecting previously unselected package libsystemd-shared:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19851 files and directories currently installed.) Preparing to unpack .../libsystemd-shared_257.7-1_amd64.deb ... Unpacking libsystemd-shared:amd64 (257.7-1) ... Selecting previously unselected package libapparmor1:amd64. Preparing to unpack .../libapparmor1_4.1.0-1_amd64.deb ... Unpacking libapparmor1:amd64 (4.1.0-1) ... Setting up libsystemd-shared:amd64 (257.7-1) ... Selecting previously unselected package systemd. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19864 files and directories currently installed.) Preparing to unpack .../systemd_257.7-1_amd64.deb ... Unpacking systemd (257.7-1) ... Setting up libapparmor1:amd64 (4.1.0-1) ... Setting up systemd (257.7-1) ... Created symlink '/etc/systemd/system/getty.target.wants/getty@tty1.service' -> '/usr/lib/systemd/system/getty@.service'. Created symlink '/etc/systemd/system/multi-user.target.wants/remote-fs.target' -> '/usr/lib/systemd/system/remote-fs.target'. Created symlink '/etc/systemd/system/sysinit.target.wants/systemd-pstore.service' -> '/usr/lib/systemd/system/systemd-pstore.service'. Initializing machine ID from random generator. Creating group 'systemd-journal' with GID 999. Creating group 'systemd-network' with GID 998. Creating user 'systemd-network' (systemd Network Management) with UID 998 and GID 998. /usr/lib/tmpfiles.d/legacy.conf:14: Duplicate line for path "/run/lock", ignoring. Selecting previously unselected package systemd-sysv. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20802 files and directories currently installed.) Preparing to unpack .../00-systemd-sysv_257.7-1_amd64.deb ... Unpacking systemd-sysv (257.7-1) ... Selecting previously unselected package libdbus-1-3:amd64. Preparing to unpack .../01-libdbus-1-3_1.16.2-2_amd64.deb ... Unpacking libdbus-1-3:amd64 (1.16.2-2) ... Selecting previously unselected package dbus-bin. Preparing to unpack .../02-dbus-bin_1.16.2-2_amd64.deb ... Unpacking dbus-bin (1.16.2-2) ... Selecting previously unselected package dbus-session-bus-common. Preparing to unpack .../03-dbus-session-bus-common_1.16.2-2_all.deb ... Unpacking dbus-session-bus-common (1.16.2-2) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../04-libexpat1_2.7.1-2_amd64.deb ... Unpacking libexpat1:amd64 (2.7.1-2) ... Selecting previously unselected package dbus-daemon. Preparing to unpack .../05-dbus-daemon_1.16.2-2_amd64.deb ... Unpacking dbus-daemon (1.16.2-2) ... Selecting previously unselected package dbus-system-bus-common. Preparing to unpack .../06-dbus-system-bus-common_1.16.2-2_all.deb ... Unpacking dbus-system-bus-common (1.16.2-2) ... Selecting previously unselected package dbus. Preparing to unpack .../07-dbus_1.16.2-2_amd64.deb ... Unpacking dbus (1.16.2-2) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../08-libpipeline1_1.5.8-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-1) ... Selecting previously unselected package binfmt-support. Preparing to unpack .../09-binfmt-support_2.2.2-7_amd64.deb ... Unpacking binfmt-support (2.2.2-7) ... Selecting previously unselected package libpython3.13-minimal:amd64. Preparing to unpack .../10-libpython3.13-minimal_3.13.5-2_amd64.deb ... Unpacking libpython3.13-minimal:amd64 (3.13.5-2) ... Selecting previously unselected package python3.13-minimal. Preparing to unpack .../11-python3.13-minimal_3.13.5-2_amd64.deb ... Unpacking python3.13-minimal (3.13.5-2) ... Setting up libpython3.13-minimal:amd64 (3.13.5-2) ... Setting up libexpat1:amd64 (2.7.1-2) ... Setting up python3.13-minimal (3.13.5-2) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21251 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.13.5-1_amd64.deb ... Unpacking python3-minimal (3.13.5-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_13.0.0_all.deb ... Unpacking media-types (13.0.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.5_all.deb ... Unpacking netbase (6.5) ... Selecting previously unselected package tzdata. Preparing to unpack .../3-tzdata_2025b-4_all.deb ... Unpacking tzdata (2025b-4) ... Selecting previously unselected package libffi8:amd64. Preparing to unpack .../4-libffi8_3.4.8-2_amd64.deb ... Unpacking libffi8:amd64 (3.4.8-2) ... Selecting previously unselected package readline-common. Preparing to unpack .../5-readline-common_8.2-6_all.deb ... Unpacking readline-common (8.2-6) ... Selecting previously unselected package libreadline8t64:amd64. Preparing to unpack .../6-libreadline8t64_8.2-6_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8 to /lib/x86_64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8.2 to /lib/x86_64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8 to /lib/x86_64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8.2 to /lib/x86_64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:amd64 (8.2-6) ... Selecting previously unselected package libpython3.13-stdlib:amd64. Preparing to unpack .../7-libpython3.13-stdlib_3.13.5-2_amd64.deb ... Unpacking libpython3.13-stdlib:amd64 (3.13.5-2) ... Selecting previously unselected package python3.13. Preparing to unpack .../8-python3.13_3.13.5-2_amd64.deb ... Unpacking python3.13 (3.13.5-2) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../9-libpython3-stdlib_3.13.5-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.13.5-1) ... Setting up python3-minimal (3.13.5-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 22266 files and directories currently installed.) Preparing to unpack .../000-python3_3.13.5-1_amd64.deb ... Unpacking python3 (3.13.5-1) ... Selecting previously unselected package libproc2-0:amd64. Preparing to unpack .../001-libproc2-0_2%3a4.0.4-9_amd64.deb ... Unpacking libproc2-0:amd64 (2:4.0.4-9) ... Selecting previously unselected package procps. Preparing to unpack .../002-procps_2%3a4.0.4-9_amd64.deb ... Unpacking procps (2:4.0.4-9) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../003-sensible-utils_0.0.25_all.deb ... Unpacking sensible-utils (0.0.25) ... Selecting previously unselected package openssl. Preparing to unpack .../004-openssl_3.5.1-1_amd64.deb ... Unpacking openssl (3.5.1-1) ... Selecting previously unselected package ca-certificates. Preparing to unpack .../005-ca-certificates_20250419_all.deb ... Unpacking ca-certificates (20250419) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../006-libmagic-mgc_1%3a5.46-5_amd64.deb ... Unpacking libmagic-mgc (1:5.46-5) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../007-libmagic1t64_1%3a5.46-5_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.46-5) ... Selecting previously unselected package file. Preparing to unpack .../008-file_1%3a5.46-5_amd64.deb ... Unpacking file (1:5.46-5) ... Selecting previously unselected package gettext-base. Preparing to unpack .../009-gettext-base_0.23.1-2_amd64.deb ... Unpacking gettext-base (0.23.1-2) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../010-libuchardet0_0.0.8-1+b2_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../011-groff-base_1.23.0-9_amd64.deb ... Unpacking groff-base (1.23.0-9) ... Selecting previously unselected package libpam-systemd:amd64. Preparing to unpack .../012-libpam-systemd_257.7-1_amd64.deb ... Unpacking libpam-systemd:amd64 (257.7-1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../013-bsdextrautils_2.41-5_amd64.deb ... Unpacking bsdextrautils (2.41-5) ... Selecting previously unselected package man-db. Preparing to unpack .../014-man-db_2.13.1-1_amd64.deb ... Unpacking man-db (2.13.1-1) ... Selecting previously unselected package libtext-charwidth-perl:amd64. Preparing to unpack .../015-libtext-charwidth-perl_0.04-11+b4_amd64.deb ... Unpacking libtext-charwidth-perl:amd64 (0.04-11+b4) ... Selecting previously unselected package libtext-wrapi18n-perl. Preparing to unpack .../016-libtext-wrapi18n-perl_0.06-10_all.deb ... Unpacking libtext-wrapi18n-perl (0.06-10) ... Selecting previously unselected package ucf. Preparing to unpack .../017-ucf_3.0052_all.deb ... Moving old data out of the way Unpacking ucf (3.0052) ... Selecting previously unselected package libgdk-pixbuf2.0-common. Preparing to unpack .../018-libgdk-pixbuf2.0-common_2.42.12+dfsg-4_all.deb ... Unpacking libgdk-pixbuf2.0-common (2.42.12+dfsg-4) ... Selecting previously unselected package libglib2.0-0t64:amd64. Preparing to unpack .../019-libglib2.0-0t64_2.84.3-1_amd64.deb ... Unpacking libglib2.0-0t64:amd64 (2.84.3-1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../020-libxml2_2.12.7+dfsg+really2.9.14-2.1_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg+really2.9.14-2.1) ... Selecting previously unselected package shared-mime-info. Preparing to unpack .../021-shared-mime-info_2.4-5+b2_amd64.deb ... Unpacking shared-mime-info (2.4-5+b2) ... Selecting previously unselected package libjpeg62-turbo:amd64. Preparing to unpack .../022-libjpeg62-turbo_1%3a2.1.5-4_amd64.deb ... Unpacking libjpeg62-turbo:amd64 (1:2.1.5-4) ... Selecting previously unselected package libpng16-16t64:amd64. Preparing to unpack .../023-libpng16-16t64_1.6.48-1_amd64.deb ... Unpacking libpng16-16t64:amd64 (1.6.48-1) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../024-libdeflate0_1.23-2_amd64.deb ... Unpacking libdeflate0:amd64 (1.23-2) ... Selecting previously unselected package libjbig0:amd64. Preparing to unpack .../025-libjbig0_2.1-6.1+b2_amd64.deb ... Unpacking libjbig0:amd64 (2.1-6.1+b2) ... Selecting previously unselected package liblerc4:amd64. Preparing to unpack .../026-liblerc4_4.0.0+ds-5_amd64.deb ... Unpacking liblerc4:amd64 (4.0.0+ds-5) ... Selecting previously unselected package libsharpyuv0:amd64. Preparing to unpack .../027-libsharpyuv0_1.5.0-0.1_amd64.deb ... Unpacking libsharpyuv0:amd64 (1.5.0-0.1) ... Selecting previously unselected package libwebp7:amd64. Preparing to unpack .../028-libwebp7_1.5.0-0.1_amd64.deb ... Unpacking libwebp7:amd64 (1.5.0-0.1) ... Selecting previously unselected package libtiff6:amd64. Preparing to unpack .../029-libtiff6_4.7.0-3_amd64.deb ... Unpacking libtiff6:amd64 (4.7.0-3) ... Selecting previously unselected package libgdk-pixbuf-2.0-0:amd64. Preparing to unpack .../030-libgdk-pixbuf-2.0-0_2.42.12+dfsg-4_amd64.deb ... Unpacking libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-4) ... Selecting previously unselected package gtk-update-icon-cache. Preparing to unpack .../031-gtk-update-icon-cache_4.18.6+ds-2_amd64.deb ... No diversion 'diversion of /usr/sbin/update-icon-caches to /usr/sbin/update-icon-caches.gtk2 by libgtk-3-bin', none removed. No diversion 'diversion of /usr/share/man/man8/update-icon-caches.8.gz to /usr/share/man/man8/update-icon-caches.gtk2.8.gz by libgtk-3-bin', none removed. Unpacking gtk-update-icon-cache (4.18.6+ds-2) ... Selecting previously unselected package hicolor-icon-theme. Preparing to unpack .../032-hicolor-icon-theme_0.18-2_all.deb ... Unpacking hicolor-icon-theme (0.18-2) ... Selecting previously unselected package adwaita-icon-theme. Preparing to unpack .../033-adwaita-icon-theme_48.1-1_all.deb ... Unpacking adwaita-icon-theme (48.1-1) ... Selecting previously unselected package ca-certificates-java. Preparing to unpack .../034-ca-certificates-java_20240118_all.deb ... Unpacking ca-certificates-java (20240118) ... Selecting previously unselected package java-common. Preparing to unpack .../035-java-common_0.76_all.deb ... Unpacking java-common (0.76) ... Selecting previously unselected package liblcms2-2:amd64. Preparing to unpack .../036-liblcms2-2_2.16-2_amd64.deb ... Unpacking liblcms2-2:amd64 (2.16-2) ... Selecting previously unselected package libnspr4:amd64. Preparing to unpack .../037-libnspr4_2%3a4.36-1_amd64.deb ... Unpacking libnspr4:amd64 (2:4.36-1) ... Selecting previously unselected package libnss3:amd64. Preparing to unpack .../038-libnss3_2%3a3.110-1_amd64.deb ... Unpacking libnss3:amd64 (2:3.110-1) ... Selecting previously unselected package libpcsclite1:amd64. Preparing to unpack .../039-libpcsclite1_2.3.3-1_amd64.deb ... Unpacking libpcsclite1:amd64 (2.3.3-1) ... Selecting previously unselected package openjdk-21-jre-headless:amd64. Preparing to unpack .../040-openjdk-21-jre-headless_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jre-headless:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jre-headless. Preparing to unpack .../041-default-jre-headless_2%3a1.21-76_amd64.deb ... Unpacking default-jre-headless (2:1.21-76) ... Selecting previously unselected package ant. Preparing to unpack .../042-ant_1.10.15-1_all.deb ... Unpacking ant (1.10.15-1) ... Selecting previously unselected package ant-contrib. Preparing to unpack .../043-ant-contrib_1.0~b3+svn177-12_all.deb ... Unpacking ant-contrib (1.0~b3+svn177-12) ... Selecting previously unselected package at-spi2-common. Preparing to unpack .../044-at-spi2-common_2.56.2-1_all.deb ... Unpacking at-spi2-common (2.56.2-1) ... Selecting previously unselected package m4. Preparing to unpack .../045-m4_1.4.19-8_amd64.deb ... Unpacking m4 (1.4.19-8) ... Selecting previously unselected package autoconf. Preparing to unpack .../046-autoconf_2.72-3.1_all.deb ... Unpacking autoconf (2.72-3.1) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../047-autotools-dev_20240727.1_all.deb ... Unpacking autotools-dev (20240727.1) ... Selecting previously unselected package automake. Preparing to unpack .../048-automake_1%3a1.17-4_all.deb ... Unpacking automake (1:1.17-4) ... Selecting previously unselected package autopoint. Preparing to unpack .../049-autopoint_0.23.1-2_all.deb ... Unpacking autopoint (0.23.1-2) ... Selecting previously unselected package dbus-user-session. Preparing to unpack .../050-dbus-user-session_1.16.2-2_amd64.deb ... Unpacking dbus-user-session (1.16.2-2) ... Selecting previously unselected package libdconf1:amd64. Preparing to unpack .../051-libdconf1_0.40.0-5_amd64.deb ... Unpacking libdconf1:amd64 (0.40.0-5) ... Selecting previously unselected package dconf-service. Preparing to unpack .../052-dconf-service_0.40.0-5_amd64.deb ... Unpacking dconf-service (0.40.0-5) ... Selecting previously unselected package dconf-gsettings-backend:amd64. Preparing to unpack .../053-dconf-gsettings-backend_0.40.0-5_amd64.deb ... Unpacking dconf-gsettings-backend:amd64 (0.40.0-5) ... Selecting previously unselected package dctrl-tools. Preparing to unpack .../054-dctrl-tools_2.24-3+b1_amd64.deb ... Unpacking dctrl-tools (2.24-3+b1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../055-libdebhelper-perl_13.24.2_all.deb ... Unpacking libdebhelper-perl (13.24.2) ... Selecting previously unselected package libtool. Preparing to unpack .../056-libtool_2.5.4-4_all.deb ... Unpacking libtool (2.5.4-4) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../057-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../058-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../059-libfile-stripnondeterminism-perl_1.14.1-2_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.1-2) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../060-dh-strip-nondeterminism_1.14.1-2_all.deb ... Unpacking dh-strip-nondeterminism (1.14.1-2) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../061-libelf1t64_0.192-4_amd64.deb ... Unpacking libelf1t64:amd64 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../062-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libunistring5:amd64. Preparing to unpack .../063-libunistring5_1.3-2_amd64.deb ... Unpacking libunistring5:amd64 (1.3-2) ... Selecting previously unselected package gettext. Preparing to unpack .../064-gettext_0.23.1-2_amd64.deb ... Unpacking gettext (0.23.1-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../065-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../066-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../067-debhelper_13.24.2_all.deb ... Unpacking debhelper (13.24.2) ... Selecting previously unselected package libatk1.0-0t64:amd64. Preparing to unpack .../068-libatk1.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatk1.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libxau6:amd64. Preparing to unpack .../069-libxau6_1%3a1.0.11-1_amd64.deb ... Unpacking libxau6:amd64 (1:1.0.11-1) ... Selecting previously unselected package libxdmcp6:amd64. Preparing to unpack .../070-libxdmcp6_1%3a1.1.5-1_amd64.deb ... Unpacking libxdmcp6:amd64 (1:1.1.5-1) ... Selecting previously unselected package libxcb1:amd64. Preparing to unpack .../071-libxcb1_1.17.0-2+b1_amd64.deb ... Unpacking libxcb1:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libx11-data. Preparing to unpack .../072-libx11-data_2%3a1.8.12-1_all.deb ... Unpacking libx11-data (2:1.8.12-1) ... Selecting previously unselected package libx11-6:amd64. Preparing to unpack .../073-libx11-6_2%3a1.8.12-1_amd64.deb ... Unpacking libx11-6:amd64 (2:1.8.12-1) ... Selecting previously unselected package libxext6:amd64. Preparing to unpack .../074-libxext6_2%3a1.3.4-1+b3_amd64.deb ... Unpacking libxext6:amd64 (2:1.3.4-1+b3) ... Selecting previously unselected package libxi6:amd64. Preparing to unpack .../075-libxi6_2%3a1.8.2-1_amd64.deb ... Unpacking libxi6:amd64 (2:1.8.2-1) ... Selecting previously unselected package libatspi2.0-0t64:amd64. Preparing to unpack .../076-libatspi2.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatspi2.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libatk-bridge2.0-0t64:amd64. Preparing to unpack .../077-libatk-bridge2.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatk-bridge2.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../078-libbrotli1_1.1.0-2+b7_amd64.deb ... Unpacking libbrotli1:amd64 (1.1.0-2+b7) ... Selecting previously unselected package libfreetype6:amd64. Preparing to unpack .../079-libfreetype6_2.13.3+dfsg-1_amd64.deb ... Unpacking libfreetype6:amd64 (2.13.3+dfsg-1) ... Selecting previously unselected package fonts-dejavu-mono. Preparing to unpack .../080-fonts-dejavu-mono_2.37-8_all.deb ... Unpacking fonts-dejavu-mono (2.37-8) ... Selecting previously unselected package fonts-dejavu-core. Preparing to unpack .../081-fonts-dejavu-core_2.37-8_all.deb ... Unpacking fonts-dejavu-core (2.37-8) ... Selecting previously unselected package fontconfig-config. Preparing to unpack .../082-fontconfig-config_2.15.0-2.3_amd64.deb ... Unpacking fontconfig-config (2.15.0-2.3) ... Selecting previously unselected package libfontconfig1:amd64. Preparing to unpack .../083-libfontconfig1_2.15.0-2.3_amd64.deb ... Unpacking libfontconfig1:amd64 (2.15.0-2.3) ... Selecting previously unselected package libpixman-1-0:amd64. Preparing to unpack .../084-libpixman-1-0_0.44.0-3_amd64.deb ... Unpacking libpixman-1-0:amd64 (0.44.0-3) ... Selecting previously unselected package libxcb-render0:amd64. Preparing to unpack .../085-libxcb-render0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-render0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-shm0:amd64. Preparing to unpack .../086-libxcb-shm0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-shm0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxrender1:amd64. Preparing to unpack .../087-libxrender1_1%3a0.9.12-1_amd64.deb ... Unpacking libxrender1:amd64 (1:0.9.12-1) ... Selecting previously unselected package libcairo2:amd64. Preparing to unpack .../088-libcairo2_1.18.4-1+b1_amd64.deb ... Unpacking libcairo2:amd64 (1.18.4-1+b1) ... Selecting previously unselected package libcairo-gobject2:amd64. Preparing to unpack .../089-libcairo-gobject2_1.18.4-1+b1_amd64.deb ... Unpacking libcairo-gobject2:amd64 (1.18.4-1+b1) ... Selecting previously unselected package libcloudproviders0:amd64. Preparing to unpack .../090-libcloudproviders0_0.3.6-2_amd64.deb ... Unpacking libcloudproviders0:amd64 (0.3.6-2) ... Selecting previously unselected package libcolord2:amd64. Preparing to unpack .../091-libcolord2_1.4.7-3_amd64.deb ... Unpacking libcolord2:amd64 (1.4.7-3) ... Selecting previously unselected package libavahi-common-data:amd64. Preparing to unpack .../092-libavahi-common-data_0.8-16_amd64.deb ... Unpacking libavahi-common-data:amd64 (0.8-16) ... Selecting previously unselected package libavahi-common3:amd64. Preparing to unpack .../093-libavahi-common3_0.8-16_amd64.deb ... Unpacking libavahi-common3:amd64 (0.8-16) ... Selecting previously unselected package libavahi-client3:amd64. Preparing to unpack .../094-libavahi-client3_0.8-16_amd64.deb ... Unpacking libavahi-client3:amd64 (0.8-16) ... Selecting previously unselected package libidn2-0:amd64. Preparing to unpack .../095-libidn2-0_2.3.8-2_amd64.deb ... Unpacking libidn2-0:amd64 (2.3.8-2) ... Selecting previously unselected package libp11-kit0:amd64. Preparing to unpack .../096-libp11-kit0_0.25.5-3_amd64.deb ... Unpacking libp11-kit0:amd64 (0.25.5-3) ... Selecting previously unselected package libtasn1-6:amd64. Preparing to unpack .../097-libtasn1-6_4.20.0-2_amd64.deb ... Unpacking libtasn1-6:amd64 (4.20.0-2) ... Selecting previously unselected package libgnutls30t64:amd64. Preparing to unpack .../098-libgnutls30t64_3.8.9-3_amd64.deb ... Unpacking libgnutls30t64:amd64 (3.8.9-3) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../099-libkrb5support0_1.21.3-5_amd64.deb ... Unpacking libkrb5support0:amd64 (1.21.3-5) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../100-libcom-err2_1.47.2-3+b3_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.2-3+b3) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../101-libk5crypto3_1.21.3-5_amd64.deb ... Unpacking libk5crypto3:amd64 (1.21.3-5) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../102-libkeyutils1_1.6.3-6_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-6) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../103-libkrb5-3_1.21.3-5_amd64.deb ... Unpacking libkrb5-3:amd64 (1.21.3-5) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../104-libgssapi-krb5-2_1.21.3-5_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.21.3-5) ... Selecting previously unselected package libcups2t64:amd64. Preparing to unpack .../105-libcups2t64_2.4.10-3_amd64.deb ... Unpacking libcups2t64:amd64 (2.4.10-3) ... Selecting previously unselected package libepoxy0:amd64. Preparing to unpack .../106-libepoxy0_1.5.10-2_amd64.deb ... Unpacking libepoxy0:amd64 (1.5.10-2) ... Selecting previously unselected package libfribidi0:amd64. Preparing to unpack .../107-libfribidi0_1.0.16-1_amd64.deb ... Unpacking libfribidi0:amd64 (1.0.16-1) ... Selecting previously unselected package libgraphite2-3:amd64. Preparing to unpack .../108-libgraphite2-3_1.3.14-2+b1_amd64.deb ... Unpacking libgraphite2-3:amd64 (1.3.14-2+b1) ... Selecting previously unselected package libharfbuzz0b:amd64. Preparing to unpack .../109-libharfbuzz0b_10.2.0-1+b1_amd64.deb ... Unpacking libharfbuzz0b:amd64 (10.2.0-1+b1) ... Selecting previously unselected package fontconfig. Preparing to unpack .../110-fontconfig_2.15.0-2.3_amd64.deb ... Unpacking fontconfig (2.15.0-2.3) ... Selecting previously unselected package libthai-data. Preparing to unpack .../111-libthai-data_0.1.29-2_all.deb ... Unpacking libthai-data (0.1.29-2) ... Selecting previously unselected package libdatrie1:amd64. Preparing to unpack .../112-libdatrie1_0.2.13-3+b1_amd64.deb ... Unpacking libdatrie1:amd64 (0.2.13-3+b1) ... Selecting previously unselected package libthai0:amd64. Preparing to unpack .../113-libthai0_0.1.29-2+b1_amd64.deb ... Unpacking libthai0:amd64 (0.1.29-2+b1) ... Selecting previously unselected package libpango-1.0-0:amd64. Preparing to unpack .../114-libpango-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpango-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libpangoft2-1.0-0:amd64. Preparing to unpack .../115-libpangoft2-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpangoft2-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libpangocairo-1.0-0:amd64. Preparing to unpack .../116-libpangocairo-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpangocairo-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libwayland-client0:amd64. Preparing to unpack .../117-libwayland-client0_1.23.1-3_amd64.deb ... Unpacking libwayland-client0:amd64 (1.23.1-3) ... Selecting previously unselected package libwayland-cursor0:amd64. Preparing to unpack .../118-libwayland-cursor0_1.23.1-3_amd64.deb ... Unpacking libwayland-cursor0:amd64 (1.23.1-3) ... Selecting previously unselected package libwayland-egl1:amd64. Preparing to unpack .../119-libwayland-egl1_1.23.1-3_amd64.deb ... Unpacking libwayland-egl1:amd64 (1.23.1-3) ... Selecting previously unselected package libxcomposite1:amd64. Preparing to unpack .../120-libxcomposite1_1%3a0.4.6-1_amd64.deb ... Unpacking libxcomposite1:amd64 (1:0.4.6-1) ... Selecting previously unselected package libxfixes3:amd64. Preparing to unpack .../121-libxfixes3_1%3a6.0.0-2+b4_amd64.deb ... Unpacking libxfixes3:amd64 (1:6.0.0-2+b4) ... Selecting previously unselected package libxcursor1:amd64. Preparing to unpack .../122-libxcursor1_1%3a1.2.3-1_amd64.deb ... Unpacking libxcursor1:amd64 (1:1.2.3-1) ... Selecting previously unselected package libxdamage1:amd64. Preparing to unpack .../123-libxdamage1_1%3a1.1.6-1+b2_amd64.deb ... Unpacking libxdamage1:amd64 (1:1.1.6-1+b2) ... Selecting previously unselected package libxinerama1:amd64. Preparing to unpack .../124-libxinerama1_2%3a1.1.4-3+b4_amd64.deb ... Unpacking libxinerama1:amd64 (2:1.1.4-3+b4) ... Selecting previously unselected package xkb-data. Preparing to unpack .../125-xkb-data_2.42-1_all.deb ... Unpacking xkb-data (2.42-1) ... Selecting previously unselected package libxkbcommon0:amd64. Preparing to unpack .../126-libxkbcommon0_1.7.0-2_amd64.deb ... Unpacking libxkbcommon0:amd64 (1.7.0-2) ... Selecting previously unselected package libxrandr2:amd64. Preparing to unpack .../127-libxrandr2_2%3a1.5.4-1+b3_amd64.deb ... Unpacking libxrandr2:amd64 (2:1.5.4-1+b3) ... Selecting previously unselected package libgtk-3-common. Preparing to unpack .../128-libgtk-3-common_3.24.49-3_all.deb ... Unpacking libgtk-3-common (3.24.49-3) ... Selecting previously unselected package libgtk-3-0t64:amd64. Preparing to unpack .../129-libgtk-3-0t64_3.24.49-3_amd64.deb ... Unpacking libgtk-3-0t64:amd64 (3.24.49-3) ... Selecting previously unselected package libglvnd0:amd64. Preparing to unpack .../130-libglvnd0_1.7.0-1+b2_amd64.deb ... Unpacking libglvnd0:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libdrm-common. Preparing to unpack .../131-libdrm-common_2.4.124-2_all.deb ... Unpacking libdrm-common (2.4.124-2) ... Selecting previously unselected package libdrm2:amd64. Preparing to unpack .../132-libdrm2_2.4.124-2_amd64.deb ... Unpacking libdrm2:amd64 (2.4.124-2) ... Selecting previously unselected package libx11-xcb1:amd64. Preparing to unpack .../133-libx11-xcb1_2%3a1.8.12-1_amd64.deb ... Unpacking libx11-xcb1:amd64 (2:1.8.12-1) ... Selecting previously unselected package libxcb-dri3-0:amd64. Preparing to unpack .../134-libxcb-dri3-0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-dri3-0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-glx0:amd64. Preparing to unpack .../135-libxcb-glx0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-glx0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-present0:amd64. Preparing to unpack .../136-libxcb-present0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-present0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-xfixes0:amd64. Preparing to unpack .../137-libxcb-xfixes0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-xfixes0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxxf86vm1:amd64. Preparing to unpack .../138-libxxf86vm1_1%3a1.1.4-1+b4_amd64.deb ... Unpacking libxxf86vm1:amd64 (1:1.1.4-1+b4) ... Selecting previously unselected package libdrm-amdgpu1:amd64. Preparing to unpack .../139-libdrm-amdgpu1_2.4.124-2_amd64.deb ... Unpacking libdrm-amdgpu1:amd64 (2.4.124-2) ... Selecting previously unselected package libpciaccess0:amd64. Preparing to unpack .../140-libpciaccess0_0.17-3+b3_amd64.deb ... Unpacking libpciaccess0:amd64 (0.17-3+b3) ... Selecting previously unselected package libdrm-intel1:amd64. Preparing to unpack .../141-libdrm-intel1_2.4.124-2_amd64.deb ... Unpacking libdrm-intel1:amd64 (2.4.124-2) ... Selecting previously unselected package libedit2:amd64. Preparing to unpack .../142-libedit2_3.1-20250104-1_amd64.deb ... Unpacking libedit2:amd64 (3.1-20250104-1) ... Selecting previously unselected package libz3-4:amd64. Preparing to unpack .../143-libz3-4_4.13.3-1_amd64.deb ... Unpacking libz3-4:amd64 (4.13.3-1) ... Selecting previously unselected package libllvm19:amd64. Preparing to unpack .../144-libllvm19_1%3a19.1.7-3+b1_amd64.deb ... Unpacking libllvm19:amd64 (1:19.1.7-3+b1) ... Selecting previously unselected package libsensors-config. Preparing to unpack .../145-libsensors-config_1%3a3.6.2-2_all.deb ... Unpacking libsensors-config (1:3.6.2-2) ... Selecting previously unselected package libsensors5:amd64. Preparing to unpack .../146-libsensors5_1%3a3.6.2-2_amd64.deb ... Unpacking libsensors5:amd64 (1:3.6.2-2) ... Selecting previously unselected package libxcb-randr0:amd64. Preparing to unpack .../147-libxcb-randr0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-randr0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-sync1:amd64. Preparing to unpack .../148-libxcb-sync1_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-sync1:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxshmfence1:amd64. Preparing to unpack .../149-libxshmfence1_1.3.3-1_amd64.deb ... Unpacking libxshmfence1:amd64 (1.3.3-1) ... Selecting previously unselected package mesa-libgallium:amd64. Preparing to unpack .../150-mesa-libgallium_25.0.7-2_amd64.deb ... Unpacking mesa-libgallium:amd64 (25.0.7-2) ... Selecting previously unselected package libwayland-server0:amd64. Preparing to unpack .../151-libwayland-server0_1.23.1-3_amd64.deb ... Unpacking libwayland-server0:amd64 (1.23.1-3) ... Selecting previously unselected package libgbm1:amd64. Preparing to unpack .../152-libgbm1_25.0.7-2_amd64.deb ... Unpacking libgbm1:amd64 (25.0.7-2) ... Selecting previously unselected package libvulkan1:amd64. Preparing to unpack .../153-libvulkan1_1.4.309.0-1_amd64.deb ... Unpacking libvulkan1:amd64 (1.4.309.0-1) ... Selecting previously unselected package libgl1-mesa-dri:amd64. Preparing to unpack .../154-libgl1-mesa-dri_25.0.7-2_amd64.deb ... Unpacking libgl1-mesa-dri:amd64 (25.0.7-2) ... Selecting previously unselected package libglx-mesa0:amd64. Preparing to unpack .../155-libglx-mesa0_25.0.7-2_amd64.deb ... Unpacking libglx-mesa0:amd64 (25.0.7-2) ... Selecting previously unselected package libglx0:amd64. Preparing to unpack .../156-libglx0_1.7.0-1+b2_amd64.deb ... Unpacking libglx0:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libgl1:amd64. Preparing to unpack .../157-libgl1_1.7.0-1+b2_amd64.deb ... Unpacking libgl1:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libasound2-data. Preparing to unpack .../158-libasound2-data_1.2.14-1_all.deb ... Unpacking libasound2-data (1.2.14-1) ... Selecting previously unselected package libasound2t64:amd64. Preparing to unpack .../159-libasound2t64_1.2.14-1_amd64.deb ... Unpacking libasound2t64:amd64 (1.2.14-1) ... Selecting previously unselected package libgif7:amd64. Preparing to unpack .../160-libgif7_5.2.2-1+b1_amd64.deb ... Unpacking libgif7:amd64 (5.2.2-1+b1) ... Selecting previously unselected package x11-common. Preparing to unpack .../161-x11-common_1%3a7.7+24_all.deb ... Unpacking x11-common (1:7.7+24) ... Selecting previously unselected package libxtst6:amd64. Preparing to unpack .../162-libxtst6_2%3a1.2.5-1_amd64.deb ... Unpacking libxtst6:amd64 (2:1.2.5-1) ... Selecting previously unselected package openjdk-21-jre:amd64. Preparing to unpack .../163-openjdk-21-jre_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jre:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jre. Preparing to unpack .../164-default-jre_2%3a1.21-76_amd64.deb ... Unpacking default-jre (2:1.21-76) ... Selecting previously unselected package openjdk-21-jdk-headless:amd64. Preparing to unpack .../165-openjdk-21-jdk-headless_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jdk-headless:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jdk-headless. Preparing to unpack .../166-default-jdk-headless_2%3a1.21-76_amd64.deb ... Unpacking default-jdk-headless (2:1.21-76) ... Selecting previously unselected package openjdk-21-jdk:amd64. Preparing to unpack .../167-openjdk-21-jdk_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jdk:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jdk. Preparing to unpack .../168-default-jdk_2%3a1.21-76_amd64.deb ... Unpacking default-jdk (2:1.21-76) ... Selecting previously unselected package libgpg-error0:amd64. Preparing to unpack .../169-libgpg-error0_1.51-4_amd64.deb ... Unpacking libgpg-error0:amd64 (1.51-4) ... Selecting previously unselected package libassuan9:amd64. Preparing to unpack .../170-libassuan9_3.0.2-2_amd64.deb ... Unpacking libassuan9:amd64 (3.0.2-2) ... Selecting previously unselected package libgcrypt20:amd64. Preparing to unpack .../171-libgcrypt20_1.11.0-7_amd64.deb ... Unpacking libgcrypt20:amd64 (1.11.0-7) ... Selecting previously unselected package gpgconf. Preparing to unpack .../172-gpgconf_2.4.7-21+b3_amd64.deb ... Unpacking gpgconf (2.4.7-21+b3) ... Selecting previously unselected package libksba8:amd64. Preparing to unpack .../173-libksba8_1.6.7-2+b1_amd64.deb ... Unpacking libksba8:amd64 (1.6.7-2+b1) ... Selecting previously unselected package libnpth0t64:amd64. Preparing to unpack .../174-libnpth0t64_1.8-3_amd64.deb ... Unpacking libnpth0t64:amd64 (1.8-3) ... Selecting previously unselected package gpg. Preparing to unpack .../175-gpg_2.4.7-21+b3_amd64.deb ... Unpacking gpg (2.4.7-21+b3) ... Selecting previously unselected package pinentry-curses. Preparing to unpack .../176-pinentry-curses_1.3.1-2_amd64.deb ... Unpacking pinentry-curses (1.3.1-2) ... Selecting previously unselected package gpg-agent. Preparing to unpack .../177-gpg-agent_2.4.7-21+b3_amd64.deb ... Unpacking gpg-agent (2.4.7-21+b3) ... Selecting previously unselected package libfile-dirlist-perl. Preparing to unpack .../178-libfile-dirlist-perl_0.05-3_all.deb ... Unpacking libfile-dirlist-perl (0.05-3) ... Selecting previously unselected package libfile-which-perl. Preparing to unpack .../179-libfile-which-perl_1.27-2_all.deb ... Unpacking libfile-which-perl (1.27-2) ... Selecting previously unselected package libfile-homedir-perl. Preparing to unpack .../180-libfile-homedir-perl_1.006-2_all.deb ... Unpacking libfile-homedir-perl (1.006-2) ... Selecting previously unselected package libfile-touch-perl. Preparing to unpack .../181-libfile-touch-perl_0.12-2_all.deb ... Unpacking libfile-touch-perl (0.12-2) ... Selecting previously unselected package libclass-method-modifiers-perl. Preparing to unpack .../182-libclass-method-modifiers-perl_2.15-1_all.deb ... Unpacking libclass-method-modifiers-perl (2.15-1) ... Selecting previously unselected package libclass-xsaccessor-perl. Preparing to unpack .../183-libclass-xsaccessor-perl_1.19-4+b5_amd64.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b5) ... Selecting previously unselected package libb-hooks-op-check-perl:amd64. Preparing to unpack .../184-libb-hooks-op-check-perl_0.22-3+b2_amd64.deb ... Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Selecting previously unselected package libdynaloader-functions-perl. Preparing to unpack .../185-libdynaloader-functions-perl_0.004-2_all.deb ... Unpacking libdynaloader-functions-perl (0.004-2) ... Selecting previously unselected package libdevel-callchecker-perl:amd64. Preparing to unpack .../186-libdevel-callchecker-perl_0.009-2_amd64.deb ... Unpacking libdevel-callchecker-perl:amd64 (0.009-2) ... Selecting previously unselected package libparams-classify-perl:amd64. Preparing to unpack .../187-libparams-classify-perl_0.015-2+b4_amd64.deb ... Unpacking libparams-classify-perl:amd64 (0.015-2+b4) ... Selecting previously unselected package libmodule-runtime-perl. Preparing to unpack .../188-libmodule-runtime-perl_0.018-1_all.deb ... Unpacking libmodule-runtime-perl (0.018-1) ... Selecting previously unselected package libimport-into-perl. Preparing to unpack .../189-libimport-into-perl_1.002005-2_all.deb ... Unpacking libimport-into-perl (1.002005-2) ... Selecting previously unselected package librole-tiny-perl. Preparing to unpack .../190-librole-tiny-perl_2.002004-1_all.deb ... Unpacking librole-tiny-perl (2.002004-1) ... Selecting previously unselected package libsub-quote-perl. Preparing to unpack .../191-libsub-quote-perl_2.006008-1_all.deb ... Unpacking libsub-quote-perl (2.006008-1) ... Selecting previously unselected package libmoo-perl. Preparing to unpack .../192-libmoo-perl_2.005005-1_all.deb ... Unpacking libmoo-perl (2.005005-1) ... Selecting previously unselected package libencode-locale-perl. Preparing to unpack .../193-libencode-locale-perl_1.05-3_all.deb ... Unpacking libencode-locale-perl (1.05-3) ... Selecting previously unselected package libtimedate-perl. Preparing to unpack .../194-libtimedate-perl_2.3300-2_all.deb ... Unpacking libtimedate-perl (2.3300-2) ... Selecting previously unselected package libhttp-date-perl. Preparing to unpack .../195-libhttp-date-perl_6.06-1_all.deb ... Unpacking libhttp-date-perl (6.06-1) ... Selecting previously unselected package libfile-listing-perl. Preparing to unpack .../196-libfile-listing-perl_6.16-1_all.deb ... Unpacking libfile-listing-perl (6.16-1) ... Selecting previously unselected package libhtml-tagset-perl. Preparing to unpack .../197-libhtml-tagset-perl_3.24-1_all.deb ... Unpacking libhtml-tagset-perl (3.24-1) ... Selecting previously unselected package liburi-perl. Preparing to unpack .../198-liburi-perl_5.30-1_all.deb ... Unpacking liburi-perl (5.30-1) ... Selecting previously unselected package libhtml-parser-perl:amd64. Preparing to unpack .../199-libhtml-parser-perl_3.83-1+b2_amd64.deb ... Unpacking libhtml-parser-perl:amd64 (3.83-1+b2) ... Selecting previously unselected package libhtml-tree-perl. Preparing to unpack .../200-libhtml-tree-perl_5.07-3_all.deb ... Unpacking libhtml-tree-perl (5.07-3) ... Selecting previously unselected package libclone-perl:amd64. Preparing to unpack .../201-libclone-perl_0.47-1+b1_amd64.deb ... Unpacking libclone-perl:amd64 (0.47-1+b1) ... Selecting previously unselected package libio-html-perl. Preparing to unpack .../202-libio-html-perl_1.004-3_all.deb ... Unpacking libio-html-perl (1.004-3) ... Selecting previously unselected package liblwp-mediatypes-perl. Preparing to unpack .../203-liblwp-mediatypes-perl_6.04-2_all.deb ... Unpacking liblwp-mediatypes-perl (6.04-2) ... Selecting previously unselected package libhttp-message-perl. Preparing to unpack .../204-libhttp-message-perl_7.00-2_all.deb ... Unpacking libhttp-message-perl (7.00-2) ... Selecting previously unselected package libhttp-cookies-perl. Preparing to unpack .../205-libhttp-cookies-perl_6.11-1_all.deb ... Unpacking libhttp-cookies-perl (6.11-1) ... Selecting previously unselected package libhttp-negotiate-perl. Preparing to unpack .../206-libhttp-negotiate-perl_6.01-2_all.deb ... Unpacking libhttp-negotiate-perl (6.01-2) ... Selecting previously unselected package perl-openssl-defaults:amd64. Preparing to unpack .../207-perl-openssl-defaults_7+b2_amd64.deb ... Unpacking perl-openssl-defaults:amd64 (7+b2) ... Selecting previously unselected package libnet-ssleay-perl:amd64. Preparing to unpack .../208-libnet-ssleay-perl_1.94-3_amd64.deb ... Unpacking libnet-ssleay-perl:amd64 (1.94-3) ... Selecting previously unselected package libio-socket-ssl-perl. Preparing to unpack .../209-libio-socket-ssl-perl_2.089-1_all.deb ... Unpacking libio-socket-ssl-perl (2.089-1) ... Selecting previously unselected package libnet-http-perl. Preparing to unpack .../210-libnet-http-perl_6.23-1_all.deb ... Unpacking libnet-http-perl (6.23-1) ... Selecting previously unselected package liblwp-protocol-https-perl. Preparing to unpack .../211-liblwp-protocol-https-perl_6.14-1_all.deb ... Unpacking liblwp-protocol-https-perl (6.14-1) ... Selecting previously unselected package libtry-tiny-perl. Preparing to unpack .../212-libtry-tiny-perl_0.32-1_all.deb ... Unpacking libtry-tiny-perl (0.32-1) ... Selecting previously unselected package libwww-robotrules-perl. Preparing to unpack .../213-libwww-robotrules-perl_6.02-1_all.deb ... Unpacking libwww-robotrules-perl (6.02-1) ... Selecting previously unselected package libwww-perl. Preparing to unpack .../214-libwww-perl_6.78-1_all.deb ... Unpacking libwww-perl (6.78-1) ... Selecting previously unselected package patchutils. Preparing to unpack .../215-patchutils_0.4.2-1_amd64.deb ... Unpacking patchutils (0.4.2-1) ... Selecting previously unselected package gpgv. Preparing to unpack .../216-gpgv_2.4.7-21+b3_amd64.deb ... Unpacking gpgv (2.4.7-21+b3) ... Selecting previously unselected package sopv-gpgv. Preparing to unpack .../217-sopv-gpgv_0.1.4-1_all.deb ... Unpacking sopv-gpgv (0.1.4-1) ... Selecting previously unselected package wdiff. Preparing to unpack .../218-wdiff_1.2.2-9_amd64.deb ... Unpacking wdiff (1.2.2-9) ... Selecting previously unselected package devscripts. Preparing to unpack .../219-devscripts_2.25.15_all.deb ... Unpacking devscripts (2.25.15) ... Selecting previously unselected package fastjar. Preparing to unpack .../220-fastjar_2%3a0.98-7_amd64.deb ... Unpacking fastjar (2:0.98-7) ... Selecting previously unselected package jarwrapper. Preparing to unpack .../221-jarwrapper_0.80_all.deb ... Unpacking jarwrapper (0.80) ... Selecting previously unselected package javahelper. Preparing to unpack .../222-javahelper_0.80_all.deb ... Unpacking javahelper (0.80) ... Selecting previously unselected package libhamcrest-java. Preparing to unpack .../223-libhamcrest-java_2.2-2_all.deb ... Unpacking libhamcrest-java (2.2-2) ... Selecting previously unselected package junit4. Preparing to unpack .../224-junit4_4.13.2-5_all.deb ... Unpacking junit4 (4.13.2-5) ... Selecting previously unselected package libapiguardian-java. Preparing to unpack .../225-libapiguardian-java_1.1.2-1_all.deb ... Unpacking libapiguardian-java (1.1.2-1) ... Selecting previously unselected package libopentest4j-java. Preparing to unpack .../226-libopentest4j-java_1.2.0-4_all.deb ... Unpacking libopentest4j-java (1.2.0-4) ... Selecting previously unselected package libopentest4j-reporting-java. Preparing to unpack .../227-libopentest4j-reporting-java_0.1.0-M1-2_all.deb ... Unpacking libopentest4j-reporting-java (0.1.0-M1-2) ... Selecting previously unselected package libpicocli-java. Preparing to unpack .../228-libpicocli-java_4.6.2-2_all.deb ... Unpacking libpicocli-java (4.6.2-2) ... Selecting previously unselected package libunivocity-parsers-java. Preparing to unpack .../229-libunivocity-parsers-java_2.9.1-1_all.deb ... Unpacking libunivocity-parsers-java (2.9.1-1) ... Selecting previously unselected package junit5. Preparing to unpack .../230-junit5_5.10.3-1_all.deb ... Unpacking junit5 (5.10.3-1) ... Selecting previously unselected package libactivation-java. Preparing to unpack .../231-libactivation-java_1.2.0-2_all.deb ... Unpacking libactivation-java (1.2.0-2) ... Selecting previously unselected package libaopalliance-java. Preparing to unpack .../232-libaopalliance-java_20070526-7_all.deb ... Unpacking libaopalliance-java (20070526-7) ... Selecting previously unselected package libapache-pom-java. Preparing to unpack .../233-libapache-pom-java_33-2_all.deb ... Unpacking libapache-pom-java (33-2) ... Selecting previously unselected package libasm-java. Preparing to unpack .../234-libasm-java_9.8-1_all.deb ... Unpacking libasm-java (9.8-1) ... Selecting previously unselected package libatinject-jsr330-api-java. Preparing to unpack .../235-libatinject-jsr330-api-java_1.0+ds1-6_all.deb ... Unpacking libatinject-jsr330-api-java (1.0+ds1-6) ... Selecting previously unselected package libcommons-parent-java. Preparing to unpack .../236-libcommons-parent-java_56-1_all.deb ... Unpacking libcommons-parent-java (56-1) ... Selecting previously unselected package libcommons-lang3-java. Preparing to unpack .../237-libcommons-lang3-java_3.17.0-1_all.deb ... Unpacking libcommons-lang3-java (3.17.0-1) ... Selecting previously unselected package libfreemarker-java. Preparing to unpack .../238-libfreemarker-java_2.3.32-2.1_all.deb ... Unpacking libfreemarker-java (2.3.32-2.1) ... Selecting previously unselected package libgoogle-gson-java. Preparing to unpack .../239-libgoogle-gson-java_2.10.1-1_all.deb ... Unpacking libgoogle-gson-java (2.10.1-1) ... Selecting previously unselected package libjoptsimple-java. Preparing to unpack .../240-libjoptsimple-java_5.0.4-7_all.deb ... Unpacking libjoptsimple-java (5.0.4-7) ... Selecting previously unselected package libcommons-codec-java. Preparing to unpack .../241-libcommons-codec-java_1.18.0-1_all.deb ... Unpacking libcommons-codec-java (1.18.0-1) ... Selecting previously unselected package libcommons-logging-java. Preparing to unpack .../242-libcommons-logging-java_1.3.0-2_all.deb ... Unpacking libcommons-logging-java (1.3.0-2) ... Selecting previously unselected package libhttpcore-java. Preparing to unpack .../243-libhttpcore-java_4.4.16-1_all.deb ... Unpacking libhttpcore-java (4.4.16-1) ... Selecting previously unselected package libhttpclient-java. Preparing to unpack .../244-libhttpclient-java_4.5.14-1_all.deb ... Unpacking libhttpclient-java (4.5.14-1) ... Selecting previously unselected package liblightcouch-java. Preparing to unpack .../245-liblightcouch-java_0.2.0-1_all.deb ... Unpacking liblightcouch-java (0.2.0-1) ... Selecting previously unselected package libmongodb-java. Preparing to unpack .../246-libmongodb-java_3.6.3-2_all.deb ... Unpacking libmongodb-java (3.6.3-2) ... Selecting previously unselected package libslf4j-java. Preparing to unpack .../247-libslf4j-java_1.7.32-2_all.deb ... Unpacking libslf4j-java (1.7.32-2) ... Selecting previously unselected package liblog4j2-java. Preparing to unpack .../248-liblog4j2-java_2.19.0-2_all.deb ... Unpacking liblog4j2-java (2.19.0-2) ... Selecting previously unselected package libbarclay-java. Preparing to unpack .../249-libbarclay-java_5.0.0+dfsg-1_all.deb ... Unpacking libbarclay-java (5.0.0+dfsg-1) ... Selecting previously unselected package libblas3:amd64. Preparing to unpack .../250-libblas3_3.12.1-4_amd64.deb ... Unpacking libblas3:amd64 (3.12.1-4) ... Selecting previously unselected package libbsh-java. Preparing to unpack .../251-libbsh-java_2.0b4-20_all.deb ... Unpacking libbsh-java (2.0b4-20) ... Selecting previously unselected package libcommons-io-java. Preparing to unpack .../252-libcommons-io-java_2.19.0-1_all.deb ... Unpacking libcommons-io-java (2.19.0-1) ... Selecting previously unselected package libmaven-shared-utils-java. Preparing to unpack .../253-libmaven-shared-utils-java_3.4.2-1_all.deb ... Unpacking libmaven-shared-utils-java (3.4.2-1) ... Selecting previously unselected package libcommons-cli-java. Preparing to unpack .../254-libcommons-cli-java_1.6.0-1_all.deb ... Unpacking libcommons-cli-java (1.6.0-1) ... Selecting previously unselected package libgeronimo-annotation-1.3-spec-java. Preparing to unpack .../255-libgeronimo-annotation-1.3-spec-java_1.3-1_all.deb ... Unpacking libgeronimo-annotation-1.3-spec-java (1.3-1) ... Selecting previously unselected package liberror-prone-java. Preparing to unpack .../256-liberror-prone-java_2.18.0-1_all.deb ... Unpacking liberror-prone-java (2.18.0-1) ... Selecting previously unselected package libjsr305-java. Preparing to unpack .../257-libjsr305-java_0.1~+svn49-12_all.deb ... Unpacking libjsr305-java (0.1~+svn49-12) ... Selecting previously unselected package libguava-java. Preparing to unpack .../258-libguava-java_32.0.1-1_all.deb ... Unpacking libguava-java (32.0.1-1) ... Selecting previously unselected package libguice-java. Preparing to unpack .../259-libguice-java_5.1.0-1_all.deb ... Unpacking libguice-java (5.1.0-1) ... Selecting previously unselected package libmaven-parent-java. Preparing to unpack .../260-libmaven-parent-java_43-2_all.deb ... Unpacking libmaven-parent-java (43-2) ... Selecting previously unselected package libplexus-utils2-java. Preparing to unpack .../261-libplexus-utils2-java_3.4.2-1_all.deb ... Unpacking libplexus-utils2-java (3.4.2-1) ... Selecting previously unselected package libwagon-provider-api-java. Preparing to unpack .../262-libwagon-provider-api-java_3.5.3-2_all.deb ... Unpacking libwagon-provider-api-java (3.5.3-2) ... Selecting previously unselected package libmaven-resolver-java. Preparing to unpack .../263-libmaven-resolver-java_1.9.22-1_all.deb ... Unpacking libmaven-resolver-java (1.9.22-1) ... Selecting previously unselected package libplexus-cipher-java. Preparing to unpack .../264-libplexus-cipher-java_2.0-1_all.deb ... Unpacking libplexus-cipher-java (2.0-1) ... Selecting previously unselected package libplexus-classworlds-java. Preparing to unpack .../265-libplexus-classworlds-java_2.7.0-1_all.deb ... Unpacking libplexus-classworlds-java (2.7.0-1) ... Selecting previously unselected package libplexus-component-annotations-java. Preparing to unpack .../266-libplexus-component-annotations-java_2.1.1-1_all.deb ... Unpacking libplexus-component-annotations-java (2.1.1-1) ... Selecting previously unselected package libplexus-interpolation-java. Preparing to unpack .../267-libplexus-interpolation-java_1.27-1_all.deb ... Unpacking libplexus-interpolation-java (1.27-1) ... Selecting previously unselected package libplexus-sec-dispatcher-java. Preparing to unpack .../268-libplexus-sec-dispatcher-java_2.0-3_all.deb ... Unpacking libplexus-sec-dispatcher-java (2.0-3) ... Selecting previously unselected package libgeronimo-interceptor-3.0-spec-java. Preparing to unpack .../269-libgeronimo-interceptor-3.0-spec-java_1.0.1-5_all.deb ... Unpacking libgeronimo-interceptor-3.0-spec-java (1.0.1-5) ... Selecting previously unselected package libcdi-api-java. Preparing to unpack .../270-libcdi-api-java_1.2-4_all.deb ... Unpacking libcdi-api-java (1.2-4) ... Selecting previously unselected package libsisu-inject-java. Preparing to unpack .../271-libsisu-inject-java_0.3.5-1_all.deb ... Unpacking libsisu-inject-java (0.3.5-1) ... Selecting previously unselected package libsisu-plexus-java. Preparing to unpack .../272-libsisu-plexus-java_0.3.5-1_all.deb ... Unpacking libsisu-plexus-java (0.3.5-1) ... Selecting previously unselected package libmaven3-core-java. Preparing to unpack .../273-libmaven3-core-java_3.9.9-1_all.deb ... Unpacking libmaven3-core-java (3.9.9-1) ... Selecting previously unselected package libmaven-shared-io-java. Preparing to unpack .../274-libmaven-shared-io-java_3.0.0-4_all.deb ... Unpacking libmaven-shared-io-java (3.0.0-4) ... Selecting previously unselected package libmaven-file-management-java. Preparing to unpack .../275-libmaven-file-management-java_3.0.0-2_all.deb ... Unpacking libmaven-file-management-java (3.0.0-2) ... Selecting previously unselected package libbuild-helper-maven-plugin-java. Preparing to unpack .../276-libbuild-helper-maven-plugin-java_3.3.0-1_all.deb ... Unpacking libbuild-helper-maven-plugin-java (3.3.0-1) ... Selecting previously unselected package libbyte-buddy-java. Preparing to unpack .../277-libbyte-buddy-java_1.14.19-1_all.deb ... Unpacking libbyte-buddy-java (1.14.19-1) ... Selecting previously unselected package libcolt-free-java. Preparing to unpack .../278-libcolt-free-java_1.2.0+dfsg-8_all.deb ... Unpacking libcolt-free-java (1.2.0+dfsg-8) ... Selecting previously unselected package libcommons-collections3-java. Preparing to unpack .../279-libcommons-collections3-java_3.2.2-3_all.deb ... Unpacking libcommons-collections3-java (3.2.2-3) ... Selecting previously unselected package libcommons-beanutils-java. Preparing to unpack .../280-libcommons-beanutils-java_1.10.1-1.1_all.deb ... Unpacking libcommons-beanutils-java (1.10.1-1.1) ... Selecting previously unselected package libcommons-collections4-java. Preparing to unpack .../281-libcommons-collections4-java_4.4-2_all.deb ... Unpacking libcommons-collections4-java (4.4-2) ... Selecting previously unselected package libcommons-compress-java. Preparing to unpack .../282-libcommons-compress-java_1.27.1-2_all.deb ... Unpacking libcommons-compress-java (1.27.1-2) ... Selecting previously unselected package libcommons-lang-java. Preparing to unpack .../283-libcommons-lang-java_2.6-10_all.deb ... Unpacking libcommons-lang-java (2.6-10) ... Selecting previously unselected package libcommons-configuration-java. Preparing to unpack .../284-libcommons-configuration-java_1.10-7_all.deb ... Unpacking libcommons-configuration-java (1.10-7) ... Selecting previously unselected package libcommons-digester-java. Preparing to unpack .../285-libcommons-digester-java_1.8.1-7_all.deb ... Unpacking libcommons-digester-java (1.8.1-7) ... Selecting previously unselected package libcommons-exec-java. Preparing to unpack .../286-libcommons-exec-java_1.3-3_all.deb ... Unpacking libcommons-exec-java (1.3-3) ... Selecting previously unselected package libcommons-jexl2-java. Preparing to unpack .../287-libcommons-jexl2-java_2.1.1-6_all.deb ... Unpacking libcommons-jexl2-java (2.1.1-6) ... Selecting previously unselected package libcommons-math-java. Preparing to unpack .../288-libcommons-math-java_2.2-9_all.deb ... Unpacking libcommons-math-java (2.2-9) ... Selecting previously unselected package libcommons-math3-java. Preparing to unpack .../289-libcommons-math3-java_3.6.1-4_all.deb ... Unpacking libcommons-math3-java (3.6.1-4) ... Selecting previously unselected package libplexus-io-java. Preparing to unpack .../290-libplexus-io-java_3.3.1-2_all.deb ... Unpacking libplexus-io-java (3.3.1-2) ... Selecting previously unselected package libsnappy1v5:amd64. Preparing to unpack .../291-libsnappy1v5_1.2.2-1_amd64.deb ... Unpacking libsnappy1v5:amd64 (1.2.2-1) ... Selecting previously unselected package libsnappy-jni. Preparing to unpack .../292-libsnappy-jni_1.1.10.7-1_amd64.deb ... Unpacking libsnappy-jni (1.1.10.7-1) ... Selecting previously unselected package libsnappy-java. Preparing to unpack .../293-libsnappy-java_1.1.10.7-1_all.deb ... Unpacking libsnappy-java (1.1.10.7-1) ... Selecting previously unselected package libxz-java. Preparing to unpack .../294-libxz-java_1.9-1_all.deb ... Unpacking libxz-java (1.9-1) ... Selecting previously unselected package libplexus-archiver-java. Preparing to unpack .../295-libplexus-archiver-java_4.6.1-1_all.deb ... Unpacking libplexus-archiver-java (4.6.1-1) ... Selecting previously unselected package libmaven-archiver-java. Preparing to unpack .../296-libmaven-archiver-java_3.6.2-1_all.deb ... Unpacking libmaven-archiver-java (3.6.2-1) ... Selecting previously unselected package libmaven-jar-plugin-java. Preparing to unpack .../297-libmaven-jar-plugin-java_3.3.0-2_all.deb ... Unpacking libmaven-jar-plugin-java (3.3.0-2) ... Selecting previously unselected package libcommons-text-java. Preparing to unpack .../298-libcommons-text-java_1.13.1-1_all.deb ... Unpacking libcommons-text-java (1.13.1-1) ... Selecting previously unselected package sgml-base. Preparing to unpack .../299-sgml-base_1.31+nmu1_all.deb ... Unpacking sgml-base (1.31+nmu1) ... Selecting previously unselected package libcommons-validator-java. Preparing to unpack .../300-libcommons-validator-java_1%3a1.9.0-1_all.deb ... Unpacking libcommons-validator-java (1:1.9.0-1) ... Selecting previously unselected package libsasl2-modules-db:amd64. Preparing to unpack .../301-libsasl2-modules-db_2.1.28+dfsg1-9_amd64.deb ... Unpacking libsasl2-modules-db:amd64 (2.1.28+dfsg1-9) ... Selecting previously unselected package libsasl2-2:amd64. Preparing to unpack .../302-libsasl2-2_2.1.28+dfsg1-9_amd64.deb ... Unpacking libsasl2-2:amd64 (2.1.28+dfsg1-9) ... Selecting previously unselected package libldap2:amd64. Preparing to unpack .../303-libldap2_2.6.10+dfsg-1_amd64.deb ... Unpacking libldap2:amd64 (2.6.10+dfsg-1) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../304-libnghttp2-14_1.64.0-1.1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.64.0-1.1) ... Selecting previously unselected package libnghttp3-9:amd64. Preparing to unpack .../305-libnghttp3-9_1.8.0-1_amd64.deb ... Unpacking libnghttp3-9:amd64 (1.8.0-1) ... Selecting previously unselected package libpsl5t64:amd64. Preparing to unpack .../306-libpsl5t64_0.21.2-1.1+b1_amd64.deb ... Unpacking libpsl5t64:amd64 (0.21.2-1.1+b1) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../307-librtmp1_2.4+20151223.gitfa8646d.1-2+b5_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b5) ... Selecting previously unselected package libssh2-1t64:amd64. Preparing to unpack .../308-libssh2-1t64_1.11.1-1_amd64.deb ... Unpacking libssh2-1t64:amd64 (1.11.1-1) ... Selecting previously unselected package libcurl4t64:amd64. Preparing to unpack .../309-libcurl4t64_8.14.1-2_amd64.deb ... Unpacking libcurl4t64:amd64 (8.14.1-2) ... Selecting previously unselected package libdistlib-java. Preparing to unpack .../310-libdistlib-java_1.0-5_all.deb ... Unpacking libdistlib-java (1.0-5) ... Selecting previously unselected package libjaxen-java. Preparing to unpack .../311-libjaxen-java_1.1.6-5_all.deb ... Unpacking libjaxen-java (1.1.6-5) ... Selecting previously unselected package libdom4j-java. Preparing to unpack .../312-libdom4j-java_2.1.4-1_all.deb ... Unpacking libdom4j-java (2.1.4-1) ... Selecting previously unselected package libdoxia-core-java. Preparing to unpack .../313-libdoxia-core-java_2.0.0-1_all.deb ... Unpacking libdoxia-core-java (2.0.0-1) ... Selecting previously unselected package libplexus-xml-java. Preparing to unpack .../314-libplexus-xml-java_3.0.1-2_all.deb ... Unpacking libplexus-xml-java (3.0.1-2) ... Selecting previously unselected package libdoxia-java. Preparing to unpack .../315-libdoxia-java_2.0.0-1_all.deb ... Unpacking libdoxia-java (2.0.0-1) ... Selecting previously unselected package libmaven-reporting-api-java. Preparing to unpack .../316-libmaven-reporting-api-java_4.0.0-1_all.deb ... Unpacking libmaven-reporting-api-java (4.0.0-1) ... Selecting previously unselected package libxbean-reflect-java. Preparing to unpack .../317-libxbean-reflect-java_4.5-9_all.deb ... Unpacking libxbean-reflect-java (4.5-9) ... Selecting previously unselected package libplexus-container-default-java. Preparing to unpack .../318-libplexus-container-default-java_2.1.1-1_all.deb ... Unpacking libplexus-container-default-java (2.1.1-1) ... Selecting previously unselected package libplexus-i18n-java. Preparing to unpack .../319-libplexus-i18n-java_1.0-beta-10-6_all.deb ... Unpacking libplexus-i18n-java (1.0-beta-10-6) ... Selecting previously unselected package velocity. Preparing to unpack .../320-velocity_1.7-7_all.deb ... Unpacking velocity (1.7-7) ... Selecting previously unselected package libplexus-velocity-java. Preparing to unpack .../321-libplexus-velocity-java_1.2-4_all.deb ... Unpacking libplexus-velocity-java (1.2-4) ... Selecting previously unselected package liboro-java. Preparing to unpack .../322-liboro-java_2.0.8a-15_all.deb ... Unpacking liboro-java (2.0.8a-15) ... Selecting previously unselected package libvelocity-tools-java. Preparing to unpack .../323-libvelocity-tools-java_2.0-9_all.deb ... Unpacking libvelocity-tools-java (2.0-9) ... Selecting previously unselected package libdoxia-sitetools-java. Preparing to unpack .../324-libdoxia-sitetools-java_2.0.0-1_all.deb ... Unpacking libdoxia-sitetools-java (2.0.0-1) ... Selecting previously unselected package libfastutil-java. Preparing to unpack .../325-libfastutil-java_8.5.15+dfsg-1_all.deb ... Unpacking libfastutil-java (8.5.15+dfsg-1) ... Selecting previously unselected package libxpp3-java. Preparing to unpack .../326-libxpp3-java_1.1.4c-4_all.deb ... Unpacking libxpp3-java (1.1.4c-4) ... Selecting previously unselected package libxstream-java. Preparing to unpack .../327-libxstream-java_1.4.21-1_all.deb ... Unpacking libxstream-java (1.4.21-1) ... Selecting previously unselected package libjsap-java. Preparing to unpack .../328-libjsap-java_2.1-5_all.deb ... Unpacking libjsap-java (2.1-5) ... Selecting previously unselected package liblogback-java. Preparing to unpack .../329-liblogback-java_1%3a1.2.11-6_all.deb ... Unpacking liblogback-java (1:1.2.11-6) ... Selecting previously unselected package libdsiutils-java. Preparing to unpack .../330-libdsiutils-java_2.7.3+dfsg-1_all.deb ... Unpacking libdsiutils-java (2.7.3+dfsg-1) ... Selecting previously unselected package libobjenesis-java. Preparing to unpack .../331-libobjenesis-java_3.4-2_all.deb ... Unpacking libobjenesis-java (3.4-2) ... Selecting previously unselected package libeasymock-java. Preparing to unpack .../332-libeasymock-java_5.5.0-1_all.deb ... Unpacking libeasymock-java (5.5.0-1) ... Selecting previously unselected package libel-api-java. Preparing to unpack .../333-libel-api-java_3.0.0-3_all.deb ... Unpacking libel-api-java (3.0.0-3) ... Selecting previously unselected package libexec-maven-plugin-java. Preparing to unpack .../334-libexec-maven-plugin-java_3.1.0-2_all.deb ... Unpacking libexec-maven-plugin-java (3.1.0-2) ... Selecting previously unselected package libezmorph-java. Preparing to unpack .../335-libezmorph-java_1.0.6-4_all.deb ... Unpacking libezmorph-java (1.0.6-4) ... Selecting previously unselected package libgatk-native-bindings-java. Preparing to unpack .../336-libgatk-native-bindings-java_1.0.0+dfsg-2_all.deb ... Unpacking libgatk-native-bindings-java (1.0.0+dfsg-2) ... Selecting previously unselected package libgfortran5:amd64. Preparing to unpack .../337-libgfortran5_14.2.0-19_amd64.deb ... Unpacking libgfortran5:amd64 (14.2.0-19) ... Selecting previously unselected package libxml-commons-external-java. Preparing to unpack .../338-libxml-commons-external-java_1.4.01-6_all.deb ... Unpacking libxml-commons-external-java (1.4.01-6) ... Selecting previously unselected package libxml-commons-resolver1.1-java. Preparing to unpack .../339-libxml-commons-resolver1.1-java_1.2-11_all.deb ... Unpacking libxml-commons-resolver1.1-java (1.2-11) ... Selecting previously unselected package libxerces2-java. Preparing to unpack .../340-libxerces2-java_2.12.2-1_all.deb ... Unpacking libxerces2-java (2.12.2-1) ... Selecting previously unselected package libxom-java. Preparing to unpack .../341-libxom-java_1.3.9-1_all.deb ... Unpacking libxom-java (1.3.9-1) ... Selecting previously unselected package libjson-java. Preparing to unpack .../342-libjson-java_3.1.0+dfsg-2_all.deb ... Unpacking libjson-java (3.1.0+dfsg-2) ... Selecting previously unselected package libmbedcrypto16:amd64. Preparing to unpack .../343-libmbedcrypto16_3.6.4-2_amd64.deb ... Unpacking libmbedcrypto16:amd64 (3.6.4-2) ... Selecting previously unselected package libmbedx509-7:amd64. Preparing to unpack .../344-libmbedx509-7_3.6.4-2_amd64.deb ... Unpacking libmbedx509-7:amd64 (3.6.4-2) ... Selecting previously unselected package libmbedtls21:amd64. Preparing to unpack .../345-libmbedtls21_3.6.4-2_amd64.deb ... Unpacking libmbedtls21:amd64 (3.6.4-2) ... Selecting previously unselected package ncbi-vdb-data. Preparing to unpack .../346-ncbi-vdb-data_3.2.1+dfsg-2_all.deb ... Unpacking ncbi-vdb-data (3.2.1+dfsg-2) ... Selecting previously unselected package libncbi-vdb3:amd64. Preparing to unpack .../347-libncbi-vdb3_3.2.1+dfsg-2_amd64.deb ... Unpacking libncbi-vdb3:amd64 (3.2.1+dfsg-2) ... Selecting previously unselected package libncbi-ngs3:amd64. Preparing to unpack .../348-libncbi-ngs3_3.2.1+dfsg-4_amd64.deb ... Unpacking libncbi-ngs3:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package libngs-jni:amd64. Preparing to unpack .../349-libngs-jni_3.2.1+dfsg-4_amd64.deb ... Unpacking libngs-jni:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package libngs-java:amd64. Preparing to unpack .../350-libngs-java_3.2.1+dfsg-4_amd64.deb ... Unpacking libngs-java:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package librhino-java. Preparing to unpack .../351-librhino-java_1.7.15-1_all.deb ... Unpacking librhino-java (1.7.15-1) ... Selecting previously unselected package libhtsjdk-java. Preparing to unpack .../352-libhtsjdk-java_4.1.3+dfsg-2_all.deb ... Unpacking libhtsjdk-java (4.1.3+dfsg-2) ... Selecting previously unselected package libgkl-java. Preparing to unpack .../353-libgkl-java_0.8.11+dfsg-2_all.deb ... Unpacking libgkl-java (0.8.11+dfsg-2) ... Selecting previously unselected package libicu4j-java. Preparing to unpack .../354-libicu4j-java_73.2-1_all.deb ... Unpacking libicu4j-java (73.2-1) ... Selecting previously unselected package liblog4j1.2-java. Preparing to unpack .../355-liblog4j1.2-java_1.2.17-11_all.deb ... Unpacking liblog4j1.2-java (1.2.17-11) ... Selecting previously unselected package libicb-utils-java. Preparing to unpack .../356-libicb-utils-java_2.0.1+git20161002.afee1d9-5_all.deb ... Unpacking libicb-utils-java (2.0.1+git20161002.afee1d9-5) ... Selecting previously unselected package libice6:amd64. Preparing to unpack .../357-libice6_2%3a1.1.1-1_amd64.deb ... Unpacking libice6:amd64 (2:1.1.1-1) ... Selecting previously unselected package libicu76:amd64. Preparing to unpack .../358-libicu76_76.1-4_amd64.deb ... Unpacking libicu76:amd64 (76.1-4) ... Selecting previously unselected package libjansi-java. Preparing to unpack .../359-libjansi-java_2.4.1-2_all.deb ... Unpacking libjansi-java (2.4.1-2) ... Selecting previously unselected package libjavassist-java. Preparing to unpack .../360-libjavassist-java_1%3a3.27.0-1_all.deb ... Unpacking libjavassist-java (1:3.27.0-1) ... Selecting previously unselected package libjaxb-api-java. Preparing to unpack .../361-libjaxb-api-java_2.3.1-1_all.deb ... Unpacking libjaxb-api-java (2.3.1-1) ... Selecting previously unselected package libjboss-logging-java. Preparing to unpack .../362-libjboss-logging-java_3.5.3-1_all.deb ... Unpacking libjboss-logging-java (3.5.3-1) ... Selecting previously unselected package libjboss-vfs-java. Preparing to unpack .../363-libjboss-vfs-java_3.2.15.Final-3_all.deb ... Unpacking libjboss-vfs-java (3.2.15.Final-3) ... Selecting previously unselected package libjbzip2-java. Preparing to unpack .../364-libjbzip2-java_0.9.1-8_all.deb ... Unpacking libjbzip2-java (0.9.1-8) ... Selecting previously unselected package libjcommander-java. Preparing to unpack .../365-libjcommander-java_1.71-4_all.deb ... Unpacking libjcommander-java (1.71-4) ... Selecting previously unselected package libjsp-api-java. Preparing to unpack .../366-libjsp-api-java_2.3.4-3_all.deb ... Unpacking libjsp-api-java (2.3.4-3) ... Selecting previously unselected package libservlet-api-java. Preparing to unpack .../367-libservlet-api-java_4.0.1-2_all.deb ... Unpacking libservlet-api-java (4.0.1-2) ... Selecting previously unselected package libwebsocket-api-java. Preparing to unpack .../368-libwebsocket-api-java_1.1-2_all.deb ... Unpacking libwebsocket-api-java (1.1-2) ... Selecting previously unselected package libjetty9-java. Preparing to unpack .../369-libjetty9-java_9.4.57-1_all.deb ... Unpacking libjetty9-java (9.4.57-1) ... Selecting previously unselected package libjsoup-java. Preparing to unpack .../370-libjsoup-java_1.15.3-1_all.deb ... Unpacking libjsoup-java (1.15.3-1) ... Selecting previously unselected package libjtidy-java. Preparing to unpack .../371-libjtidy-java_7+svn20110807-6_all.deb ... Unpacking libjtidy-java (7+svn20110807-6) ... Selecting previously unselected package liblapack3:amd64. Preparing to unpack .../372-liblapack3_3.12.1-4_amd64.deb ... Unpacking liblapack3:amd64 (3.12.1-4) ... Selecting previously unselected package libmaven-antrun-plugin-java. Preparing to unpack .../373-libmaven-antrun-plugin-java_3.1.0-1_all.deb ... Unpacking libmaven-antrun-plugin-java (3.1.0-1) ... Selecting previously unselected package libmaven-common-artifact-filters-java. Preparing to unpack .../374-libmaven-common-artifact-filters-java_3.4.0-1_all.deb ... Unpacking libmaven-common-artifact-filters-java (3.4.0-1) ... Selecting previously unselected package libmaven-artifact-transfer-java. Preparing to unpack .../375-libmaven-artifact-transfer-java_0.13.1-3_all.deb ... Unpacking libmaven-artifact-transfer-java (0.13.1-3) ... Selecting previously unselected package libplexus-build-api-java. Preparing to unpack .../376-libplexus-build-api-java_0.0.7-4_all.deb ... Unpacking libplexus-build-api-java (0.0.7-4) ... Selecting previously unselected package libmaven-filtering-java. Preparing to unpack .../377-libmaven-filtering-java_3.4.0-1_all.deb ... Unpacking libmaven-filtering-java (3.4.0-1) ... Selecting previously unselected package libmaven-assembly-plugin-java. Preparing to unpack .../378-libmaven-assembly-plugin-java_3.4.2-2_all.deb ... Unpacking libmaven-assembly-plugin-java (3.4.2-2) ... Selecting previously unselected package libmaven-clean-plugin-java. Preparing to unpack .../379-libmaven-clean-plugin-java_3.2.0-2_all.deb ... Unpacking libmaven-clean-plugin-java (3.2.0-2) ... Selecting previously unselected package libmaven-shared-incremental-java. Preparing to unpack .../380-libmaven-shared-incremental-java_1.1-6_all.deb ... Unpacking libmaven-shared-incremental-java (1.1-6) ... Selecting previously unselected package libplexus-compiler-java. Preparing to unpack .../381-libplexus-compiler-java_2.13.0-1_all.deb ... Unpacking libplexus-compiler-java (2.13.0-1) ... Selecting previously unselected package libqdox2-java. Preparing to unpack .../382-libqdox2-java_2.0.3-1_all.deb ... Unpacking libqdox2-java (2.0.3-1) ... Selecting previously unselected package libplexus-languages-java. Preparing to unpack .../383-libplexus-languages-java_1.1.1-3_all.deb ... Unpacking libplexus-languages-java (1.1.1-3) ... Selecting previously unselected package libmaven-compiler-plugin-java. Preparing to unpack .../384-libmaven-compiler-plugin-java_3.13.0-1_all.deb ... Unpacking libmaven-compiler-plugin-java (3.13.0-1) ... Selecting previously unselected package libmaven-dependency-analyzer-java. Preparing to unpack .../385-libmaven-dependency-analyzer-java_1.15.1-1_all.deb ... Unpacking libmaven-dependency-analyzer-java (1.15.1-1) ... Selecting previously unselected package libmaven-dependency-tree-java. Preparing to unpack .../386-libmaven-dependency-tree-java_3.3.0-1_all.deb ... Unpacking libmaven-dependency-tree-java (3.3.0-1) ... Selecting previously unselected package libmaven-reporting-impl-java. Preparing to unpack .../387-libmaven-reporting-impl-java_4.0.0-1_all.deb ... Unpacking libmaven-reporting-impl-java (4.0.0-1) ... Selecting previously unselected package libmaven-dependency-plugin-java. Preparing to unpack .../388-libmaven-dependency-plugin-java_3.8.1-1_all.deb ... Unpacking libmaven-dependency-plugin-java (3.8.1-1) ... Selecting previously unselected package libmaven-invoker-java. Preparing to unpack .../389-libmaven-invoker-java_3.3.0-1_all.deb ... Unpacking libmaven-invoker-java (3.3.0-1) ... Selecting previously unselected package libplexus-interactivity-api-java. Preparing to unpack .../390-libplexus-interactivity-api-java_1.3-1_all.deb ... Unpacking libplexus-interactivity-api-java (1.3-1) ... Selecting previously unselected package libmaven-javadoc-plugin-java. Preparing to unpack .../391-libmaven-javadoc-plugin-java_3.10.1-2_all.deb ... Unpacking libmaven-javadoc-plugin-java (3.10.1-2) ... Selecting previously unselected package libplexus-ant-factory-java. Preparing to unpack .../392-libplexus-ant-factory-java_1.0~alpha2.1-5_all.deb ... Unpacking libplexus-ant-factory-java (1.0~alpha2.1-5) ... Selecting previously unselected package libplexus-container-default1.5-java. Preparing to unpack .../393-libplexus-container-default1.5-java_2.1.1-1_all.deb ... Unpacking libplexus-container-default1.5-java (2.1.1-1) ... Selecting previously unselected package libplexus-bsh-factory-java. Preparing to unpack .../394-libplexus-bsh-factory-java_1.0~alpha7-5_all.deb ... Unpacking libplexus-bsh-factory-java (1.0~alpha7-5) ... Selecting previously unselected package libmaven-plugin-tools-java. Preparing to unpack .../395-libmaven-plugin-tools-java_3.10.2-2_all.deb ... Unpacking libmaven-plugin-tools-java (3.10.2-2) ... Selecting previously unselected package libmaven-reporting-exec-java. Preparing to unpack .../396-libmaven-reporting-exec-java_2.0.0-1_all.deb ... Unpacking libmaven-reporting-exec-java (2.0.0-1) ... Selecting previously unselected package libmaven-resources-plugin-java. Preparing to unpack .../397-libmaven-resources-plugin-java_3.3.1-1_all.deb ... Unpacking libmaven-resources-plugin-java (3.3.1-1) ... Selecting previously unselected package libmaven-site-plugin-java. Preparing to unpack .../398-libmaven-site-plugin-java_3.21.0-1_all.deb ... Unpacking libmaven-site-plugin-java (3.21.0-1) ... Selecting previously unselected package libmaven-source-plugin-java. Preparing to unpack .../399-libmaven-source-plugin-java_3.3.1-1_all.deb ... Unpacking libmaven-source-plugin-java (3.3.1-1) ... Selecting previously unselected package libpaper2:amd64. Preparing to unpack .../400-libpaper2_2.2.5-0.3+b2_amd64.deb ... Unpacking libpaper2:amd64 (2.2.5-0.3+b2) ... Selecting previously unselected package libpaper-utils. Preparing to unpack .../401-libpaper-utils_2.2.5-0.3+b2_amd64.deb ... Unpacking libpaper-utils (2.2.5-0.3+b2) ... Selecting previously unselected package libpicard-java. Preparing to unpack .../402-libpicard-java_3.3.0+dfsg-2_all.deb ... Unpacking libpicard-java (3.3.0+dfsg-2) ... Selecting previously unselected package libpj-java. Preparing to unpack .../403-libpj-java_0.0~20150107+dfsg-5_all.deb ... Unpacking libpj-java (0.0~20150107+dfsg-5) ... Selecting previously unselected package libpkgconf3:amd64. Preparing to unpack .../404-libpkgconf3_1.8.1-4_amd64.deb ... Unpacking libpkgconf3:amd64 (1.8.1-4) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../405-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Selecting previously unselected package libprotobuf32t64:amd64. Preparing to unpack .../406-libprotobuf32t64_3.21.12-11_amd64.deb ... Unpacking libprotobuf32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-lite32t64:amd64. Preparing to unpack .../407-libprotobuf-lite32t64_3.21.12-11_amd64.deb ... Unpacking libprotobuf-lite32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-dev:amd64. Preparing to unpack .../408-libprotobuf-dev_3.21.12-11_amd64.deb ... Unpacking libprotobuf-dev:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-java. Preparing to unpack .../409-libprotobuf-java_3.21.12-11_all.deb ... Unpacking libprotobuf-java (3.21.12-11) ... Selecting previously unselected package libprotoc32t64:amd64. Preparing to unpack .../410-libprotoc32t64_3.21.12-11_amd64.deb ... Unpacking libprotoc32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libreflections-java. Preparing to unpack .../411-libreflections-java_0.10.2+dfsg-2_all.deb ... Unpacking libreflections-java (0.10.2+dfsg-2) ... Selecting previously unselected package libsm6:amd64. Preparing to unpack .../412-libsm6_2%3a1.2.6-1_amd64.deb ... Unpacking libsm6:amd64 (2:1.2.6-1) ... Selecting previously unselected package libsurefire-java. Preparing to unpack .../413-libsurefire-java_2.22.3-4_all.deb ... Unpacking libsurefire-java (2.22.3-4) ... Selecting previously unselected package libtcl8.6:amd64. Preparing to unpack .../414-libtcl8.6_8.6.16+dfsg-1_amd64.deb ... Unpacking libtcl8.6:amd64 (8.6.16+dfsg-1) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../415-libtirpc-common_1.3.6+ds-1_all.deb ... Unpacking libtirpc-common (1.3.6+ds-1) ... Selecting previously unselected package libtirpc3t64:amd64. Preparing to unpack .../416-libtirpc3t64_1.3.6+ds-1_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3 to /lib/x86_64-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3.0.0 to /lib/x86_64-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:amd64 (1.3.6+ds-1) ... Selecting previously unselected package libxft2:amd64. Preparing to unpack .../417-libxft2_2.3.6-1+b4_amd64.deb ... Unpacking libxft2:amd64 (2.3.6-1+b4) ... Selecting previously unselected package libxss1:amd64. Preparing to unpack .../418-libxss1_1%3a1.2.3-1+b3_amd64.deb ... Unpacking libxss1:amd64 (1:1.2.3-1+b3) ... Selecting previously unselected package libtk8.6:amd64. Preparing to unpack .../419-libtk8.6_8.6.16-1_amd64.deb ... Unpacking libtk8.6:amd64 (8.6.16-1) ... Selecting previously unselected package libwagon-file-java. Preparing to unpack .../420-libwagon-file-java_3.5.3-2_all.deb ... Unpacking libwagon-file-java (3.5.3-2) ... Selecting previously unselected package libwagon-http-java. Preparing to unpack .../421-libwagon-http-java_3.5.3-2_all.deb ... Unpacking libwagon-http-java (3.5.3-2) ... Selecting previously unselected package libxml2-utils. Preparing to unpack .../422-libxml2-utils_2.12.7+dfsg+really2.9.14-2.1_amd64.deb ... Unpacking libxml2-utils (2.12.7+dfsg+really2.9.14-2.1) ... Selecting previously unselected package libxt6t64:amd64. Preparing to unpack .../423-libxt6t64_1%3a1.2.1-1.2+b2_amd64.deb ... Unpacking libxt6t64:amd64 (1:1.2.1-1.2+b2) ... Selecting previously unselected package maven. Preparing to unpack .../424-maven_3.9.9-1_all.deb ... Unpacking maven (3.9.9-1) ... Selecting previously unselected package maven-repo-helper. Preparing to unpack .../425-maven-repo-helper_1.11_all.deb ... Unpacking maven-repo-helper (1.11) ... Selecting previously unselected package unzip. Preparing to unpack .../426-unzip_6.0-29_amd64.deb ... Unpacking unzip (6.0-29) ... Selecting previously unselected package maven-debian-helper. Preparing to unpack .../427-maven-debian-helper_2.6.7_all.deb ... Unpacking maven-debian-helper (2.6.7) ... Selecting previously unselected package pkgconf-bin. Preparing to unpack .../428-pkgconf-bin_1.8.1-4_amd64.deb ... Unpacking pkgconf-bin (1.8.1-4) ... Selecting previously unselected package pkgconf:amd64. Preparing to unpack .../429-pkgconf_1.8.1-4_amd64.deb ... Unpacking pkgconf:amd64 (1.8.1-4) ... Selecting previously unselected package protobuf-compiler. Preparing to unpack .../430-protobuf-compiler_3.21.12-11_amd64.deb ... Unpacking protobuf-compiler (3.21.12-11) ... Selecting previously unselected package zip. Preparing to unpack .../431-zip_3.0-15_amd64.deb ... Unpacking zip (3.0-15) ... Selecting previously unselected package xdg-utils. Preparing to unpack .../432-xdg-utils_1.2.1-2_all.deb ... Unpacking xdg-utils (1.2.1-2) ... Selecting previously unselected package r-base-core. Preparing to unpack .../433-r-base-core_4.5.0-3_amd64.deb ... Unpacking r-base-core (4.5.0-3) ... Selecting previously unselected package r-cran-rjava. Preparing to unpack .../434-r-cran-rjava_1.0-11-2_amd64.deb ... Unpacking r-cran-rjava (1.0-11-2) ... Selecting previously unselected package testng. Preparing to unpack .../435-testng_6.9.12-4_all.deb ... Unpacking testng (6.9.12-4) ... Setting up libprotobuf-lite32t64:amd64 (3.21.12-11) ... Setting up media-types (13.0.0) ... Setting up libpipeline1:amd64 (1.5.8-1) ... Setting up fastjar (2:0.98-7) ... Setting up libgraphite2-3:amd64 (1.3.14-2+b1) ... Setting up liblcms2-2:amd64 (2.16-2) ... Setting up libpixman-1-0:amd64 (0.44.0-3) ... Setting up libjcommander-java (1.71-4) ... Setting up libfastutil-java (8.5.15+dfsg-1) ... Setting up libtext-charwidth-perl:amd64 (0.04-11+b4) ... Setting up wdiff (1.2.2-9) ... Setting up libsharpyuv0:amd64 (1.5.0-0.1) ... Setting up libpciaccess0:amd64 (0.17-3+b3) ... Setting up libslf4j-java (1.7.32-2) ... Setting up libprotobuf32t64:amd64 (3.21.12-11) ... Setting up libfile-which-perl (1.27-2) ... Setting up systemd-sysv (257.7-1) ... Setting up libxau6:amd64 (1:1.0.11-1) ... Setting up libxdmcp6:amd64 (1:1.1.5-1) ... Setting up libplexus-utils2-java (3.4.2-1) ... Setting up libnpth0t64:amd64 (1.8-3) ... Setting up libkeyutils1:amd64 (1.6.3-6) ... Setting up libplexus-classworlds-java (2.7.0-1) ... Setting up libxcb1:amd64 (1.17.0-2+b1) ... Setting up libopentest4j-reporting-java (0.1.0-M1-2) ... Setting up libplexus-build-api-java (0.0.7-4) ... Setting up libxcb-xfixes0:amd64 (1.17.0-2+b1) ... Setting up liblerc4:amd64 (4.0.0+ds-5) ... Setting up libjsr305-java (0.1~+svn49-12) ... Setting up bsdextrautils (2.41-5) ... Setting up hicolor-icon-theme (0.18-2) ... Setting up libgatk-native-bindings-java (1.0.0+dfsg-2) ... Setting up libgpg-error0:amd64 (1.51-4) ... Setting up libicu4j-java (73.2-1) ... Setting up java-common (0.76) ... Setting up libdynaloader-functions-perl (0.004-2) ... Setting up libdatrie1:amd64 (0.2.13-3+b1) ... Setting up libobjenesis-java (3.4-2) ... Setting up libclass-method-modifiers-perl (2.15-1) ... Setting up libqdox2-java (2.0.3-1) ... Setting up libaopalliance-java (20070526-7) ... Setting up libcommons-cli-java (1.6.0-1) ... Setting up libmagic-mgc (1:5.46-5) ... Setting up libcommons-exec-java (1.3-3) ... Setting up libxcb-render0:amd64 (1.17.0-2+b1) ... Setting up liblogback-java (1:1.2.11-6) ... Setting up libclone-perl:amd64 (0.47-1+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libglvnd0:amd64 (1.7.0-1+b2) ... Setting up libgoogle-gson-java (2.10.1-1) ... Setting up libtirpc-common (1.3.6+ds-1) ... Setting up libhtml-tagset-perl (3.24-1) ... Setting up libxcb-glx0:amd64 (1.17.0-2+b1) ... Setting up unzip (6.0-29) ... Setting up libdebhelper-perl (13.24.2) ... Setting up libbrotli1:amd64 (1.1.0-2+b7) ... Setting up libedit2:amd64 (3.1-20250104-1) ... Setting up liblwp-mediatypes-perl (6.04-2) ... Setting up libgdk-pixbuf2.0-common (2.42.12+dfsg-4) ... Setting up libmagic1t64:amd64 (1:5.46-5) ... Setting up libpicocli-java (4.6.2-2) ... Setting up libasm-java (9.8-1) ... Setting up x11-common (1:7.7+24) ... Running in chroot, ignoring request. Setting up X socket directories... /tmp/.X11-unix /tmp/.ICE-unix. Setting up libtry-tiny-perl (0.32-1) ... Setting up libsensors-config (1:3.6.2-2) ... Setting up libnghttp2-14:amd64 (1.64.0-1.1) ... Setting up libdeflate0:amd64 (1.23-2) ... Setting up perl-openssl-defaults:amd64 (7+b2) ... Setting up liblog4j1.2-java (1.2.17-11) ... Setting up gettext-base (0.23.1-2) ... Setting up m4 (1.4.19-8) ... Setting up libel-api-java (3.0.0-3) ... Setting up libgcrypt20:amd64 (1.11.0-7) ... Setting up xkb-data (2.42-1) ... Setting up libencode-locale-perl (1.05-3) ... Setting up libplexus-component-annotations-java (2.1.1-1) ... Setting up libxcb-shm0:amd64 (1.17.0-2+b1) ... Setting up libcom-err2:amd64 (1.47.2-3+b3) ... Setting up file (1:5.46-5) ... Setting up libjboss-logging-java (3.5.3-1) ... Setting up libunivocity-parsers-java (2.9.1-1) ... Setting up libtext-wrapi18n-perl (0.06-10) ... Setting up libjbig0:amd64 (2.1-6.1+b2) ... Setting up libelf1t64:amd64 (0.192-4) ... Setting up liboro-java (2.0.8a-15) ... Setting up libsnappy1v5:amd64 (1.2.2-1) ... Setting up libkrb5support0:amd64 (1.21.3-5) ... Setting up libexec-maven-plugin-java (3.1.0-2) ... Setting up libsasl2-modules-db:amd64 (2.1.28+dfsg1-9) ... Setting up tzdata (2025b-4) ... Current default time zone: 'Etc/UTC' Local time is now: Tue Sep 8 23:32:20 UTC 2026. Universal Time is now: Tue Sep 8 23:32:20 UTC 2026. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libxcb-present0:amd64 (1.17.0-2+b1) ... Setting up libgeronimo-annotation-1.3-spec-java (1.3-1) ... Setting up libgeronimo-interceptor-3.0-spec-java (1.0.1-5) ... Setting up libcommons-collections3-java (3.2.2-3) ... Setting up libasound2-data (1.2.14-1) ... Setting up libjavassist-java (1:3.27.0-1) ... Setting up zip (3.0-15) ... Setting up librhino-java (1.7.15-1) ... Setting up autotools-dev (20240727.1) ... Setting up libz3-4:amd64 (4.13.3-1) ... Setting up libblas3:amd64 (3.12.1-4) ... update-alternatives: using /usr/lib/x86_64-linux-gnu/blas/libblas.so.3 to provide /usr/lib/x86_64-linux-gnu/libblas.so.3 (libblas.so.3-x86_64-linux-gnu) in auto mode Setting up libpkgconf3:amd64 (1.8.1-4) ... Setting up libasound2t64:amd64 (1.2.14-1) ... Setting up libjpeg62-turbo:amd64 (1:2.1.5-4) ... Setting up libjaxen-java (1.1.6-5) ... Setting up libapiguardian-java (1.1.2-1) ... Setting up libx11-data (2:1.8.12-1) ... Setting up libepoxy0:amd64 (1.5.10-2) ... Setting up libnspr4:amd64 (2:4.36-1) ... Setting up libxcb-sync1:amd64 (1.17.0-2+b1) ... Setting up libjtidy-java (7+svn20110807-6) ... Setting up libjansi-java (2.4.1-2) ... Setting up libapache-pom-java (33-2) ... Setting up libavahi-common-data:amd64 (0.8-16) ... Setting up libxpp3-java (1.1.4c-4) ... Setting up libatinject-jsr330-api-java (1.0+ds1-6) ... Setting up libdbus-1-3:amd64 (1.16.2-2) ... Setting up libwebsocket-api-java (1.1-2) ... Setting up libfribidi0:amd64 (1.0.16-1) ... Setting up libproc2-0:amd64 (2:4.0.4-9) ... Setting up libplexus-interpolation-java (1.27-1) ... Setting up libunistring5:amd64 (1.3-2) ... Setting up fonts-dejavu-mono (2.37-8) ... Setting up libpng16-16t64:amd64 (1.6.48-1) ... Setting up libxml-commons-resolver1.1-java (1.2-11) ... Setting up libxz-java (1.9-1) ... Setting up libio-html-perl (1.004-3) ... Setting up libtcl8.6:amd64 (8.6.16+dfsg-1) ... Setting up autopoint (0.23.1-2) ... Setting up binfmt-support (2.2.2-7) ... Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of start. Created symlink '/etc/systemd/system/multi-user.target.wants/binfmt-support.service' -> '/usr/lib/systemd/system/binfmt-support.service'. Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Setting up fonts-dejavu-core (2.37-8) ... Setting up libjbzip2-java (0.9.1-8) ... Setting up libpcsclite1:amd64 (2.3.3-1) ... Setting up pkgconf-bin (1.8.1-4) ... Setting up libsensors5:amd64 (1:3.6.2-2) ... Setting up libmongodb-java (3.6.3-2) ... Setting up libk5crypto3:amd64 (1.21.3-5) ... Setting up libactivation-java (1.2.0-2) ... Setting up libhamcrest-java (2.2-2) ... Setting up libbsh-java (2.0b4-20) ... Setting up libjsp-api-java (2.3.4-3) ... Setting up libsasl2-2:amd64 (2.1.28+dfsg1-9) ... Setting up libgfortran5:amd64 (14.2.0-19) ... Setting up libvulkan1:amd64 (1.4.309.0-1) ... Setting up autoconf (2.72-3.1) ... Setting up libnghttp3-9:amd64 (1.8.0-1) ... Setting up libwebp7:amd64 (1.5.0-0.1) ... Setting up libcolt-free-java (1.2.0+dfsg-8) ... Setting up libtimedate-perl (2.3300-2) ... Setting up libgif7:amd64 (5.2.2-1+b1) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up libffi8:amd64 (3.4.8-2) ... Setting up dwz (0.15-1+b1) ... Setting up libplexus-interactivity-api-java (1.3-1) ... Setting up libfreemarker-java (2.3.32-2.1) ... Setting up sensible-utils (0.0.25) ... Setting up libxshmfence1:amd64 (1.3.3-1) ... Setting up libjsoup-java (1.15.3-1) ... Setting up at-spi2-common (2.56.2-1) ... Setting up libcommons-math-java (2.2-9) ... Setting up gpgv (2.4.7-21+b3) ... Setting up libtiff6:amd64 (4.7.0-3) ... Setting up libxcb-randr0:amd64 (1.17.0-2+b1) ... Setting up dbus-session-bus-common (1.16.2-2) ... Setting up libuchardet0:amd64 (0.0.8-1+b2) ... Setting up libassuan9:amd64 (3.0.2-2) ... Setting up libxml-commons-external-java (1.4.01-6) ... Setting up procps (2:4.0.4-9) ... Setting up libxbean-reflect-java (4.5-9) ... Setting up libservlet-api-java (4.0.1-2) ... Setting up libplexus-xml-java (3.0.1-2) ... Setting up librole-tiny-perl (2.002004-1) ... Setting up libopentest4j-java (1.2.0-4) ... Setting up libtasn1-6:amd64 (4.20.0-2) ... Setting up libx11-6:amd64 (2:1.8.12-1) ... Setting up ncbi-vdb-data (3.2.1+dfsg-2) ... Setting up libthai-data (0.1.29-2) ... Setting up netbase (6.5) ... Setting up libcommons-math3-java (3.6.1-4) ... Setting up sgml-base (1.31+nmu1) ... Setting up libsub-quote-perl (2.006008-1) ... Setting up libclass-xsaccessor-perl (1.19-4+b5) ... Setting up libkrb5-3:amd64 (1.21.3-5) ... Setting up libwayland-egl1:amd64 (1.23.1-3) ... Setting up libicu76:amd64 (76.1-4) ... Setting up libmbedcrypto16:amd64 (3.6.4-2) ... Setting up libpaper2:amd64 (2.2.5-0.3+b2) ... Setting up libssh2-1t64:amd64 (1.11.1-1) ... Setting up libhttpcore-java (4.4.16-1) ... Setting up libjoptsimple-java (5.0.4-7) ... Setting up libprotoc32t64:amd64 (3.21.12-11) ... Setting up libxerces2-java (2.12.2-1) ... Setting up libfile-dirlist-perl (0.05-3) ... Setting up dbus-system-bus-common (1.16.2-2) ... Creating group 'messagebus' with GID 997. Creating user 'messagebus' (System Message Bus) with UID 997 and GID 997. Setting up libfile-homedir-perl (1.006-2) ... Setting up libpj-java (0.0~20150107+dfsg-5) ... Setting up openssl (3.5.1-1) ... Setting up libdrm-common (2.4.124-2) ... Setting up libcdi-api-java (1.2-4) ... Setting up libsnappy-jni (1.1.10.7-1) ... Setting up libezmorph-java (1.0.6-4) ... Setting up libxcomposite1:amd64 (1:0.4.6-1) ... Setting up readline-common (8.2-6) ... Setting up libxml2:amd64 (2.12.7+dfsg+really2.9.14-2.1) ... Setting up xdg-utils (1.2.1-2) ... update-alternatives: using /usr/bin/xdg-open to provide /usr/bin/open (open) in auto mode Setting up libldap2:amd64 (2.6.10+dfsg-1) ... Setting up liburi-perl (5.30-1) ... Setting up dbus-bin (1.16.2-2) ... Setting up libfile-touch-perl (0.12-2) ... Setting up dctrl-tools (2.24-3+b1) ... Setting up libxkbcommon0:amd64 (1.7.0-2) ... Setting up libwayland-client0:amd64 (1.23.1-3) ... Setting up libnet-ssleay-perl:amd64 (1.94-3) ... Setting up automake (1:1.17-4) ... update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode Setting up libksba8:amd64 (1.6.7-2+b1) ... Setting up pinentry-curses (1.3.1-2) ... Setting up libdom4j-java (2.1.4-1) ... Setting up libjaxb-api-java (2.3.1-1) ... Setting up libfile-stripnondeterminism-perl (1.14.1-2) ... Setting up libxcb-dri3-0:amd64 (1.17.0-2+b1) ... Setting up libwagon-provider-api-java (3.5.3-2) ... Setting up libllvm19:amd64 (1:19.1.7-3+b1) ... Setting up libwayland-server0:amd64 (1.23.1-3) ... Setting up libx11-xcb1:amd64 (2:1.8.12-1) ... Setting up libice6:amd64 (2:1.1.1-1) ... Setting up libhttp-date-perl (6.06-1) ... Setting up libxstream-java (1.4.21-1) ... Setting up liblapack3:amd64 (3.12.1-4) ... update-alternatives: using /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/x86_64-linux-gnu/liblapack.so.3 (liblapack.so.3-x86_64-linux-gnu) in auto mode Setting up gettext (0.23.1-2) ... Setting up libjetty9-java (9.4.57-1) ... Setting up libxdamage1:amd64 (1:1.1.6-1+b2) ... Setting up libfile-listing-perl (6.16-1) ... Setting up libplexus-languages-java (1.1.1-3) ... Setting up protobuf-compiler (3.21.12-11) ... Setting up libjboss-vfs-java (3.2.15.Final-3) ... Setting up libxrender1:amd64 (1:0.9.12-1) ... Setting up jarwrapper (0.80) ... Setting up libtool (2.5.4-4) ... Setting up fontconfig-config (2.15.0-2.3) ... Setting up libmaven-parent-java (43-2) ... Setting up libcommons-parent-java (56-1) ... Setting up libavahi-common3:amd64 (0.8-16) ... Setting up libcommons-logging-java (1.3.0-2) ... Setting up libxext6:amd64 (2:1.3.4-1+b3) ... Setting up libnet-http-perl (6.23-1) ... Setting up libsisu-inject-java (0.3.5-1) ... Setting up libidn2-0:amd64 (2.3.8-2) ... Setting up libnss3:amd64 (2:3.110-1) ... Setting up dbus-daemon (1.16.2-2) ... Setting up libpaper-utils (2.2.5-0.3+b2) ... Setting up libxom-java (1.3.9-1) ... Setting up libdevel-callchecker-perl:amd64 (0.009-2) ... Setting up libcommons-lang-java (2.6-10) ... Setting up libmaven-dependency-analyzer-java (1.15.1-1) ... Setting up libplexus-cipher-java (2.0-1) ... Setting up pkgconf:amd64 (1.8.1-4) ... Setting up libxxf86vm1:amd64 (1:1.1.4-1+b4) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up libprotobuf-dev:amd64 (3.21.12-11) ... Setting up dh-autoreconf (20) ... Setting up patchutils (0.4.2-1) ... Setting up libcommons-jexl2-java (2.1.1-6) ... Setting up libthai0:amd64 (0.1.29-2+b1) ... Setting up ca-certificates (20250419) ... Updating certificates in /etc/ssl/certs... 150 added, 0 removed; done. Setting up libsisu-plexus-java (0.3.5-1) ... Setting up libglib2.0-0t64:amd64 (2.84.3-1) ... Setting up libmbedx509-7:amd64 (3.6.4-2) ... Setting up libfreetype6:amd64 (2.13.3+dfsg-1) ... Setting up libxfixes3:amd64 (1:6.0.0-2+b4) ... Setting up testng (6.9.12-4) ... Setting up dbus (1.16.2-2) ... Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of start. Setting up shared-mime-info (2.4-5+b2) ... Setting up libp11-kit0:amd64 (0.25.5-3) ... Setting up libxinerama1:amd64 (2:1.1.4-3+b4) ... Setting up libgssapi-krb5-2:amd64 (1.21.3-5) ... Setting up libxrandr2:amd64 (2:1.5.4-1+b3) ... Setting up libcommons-collections4-java (4.4-2) ... Setting up ucf (3.0052) ... Setting up libcommons-lang3-java (3.17.0-1) ... Setting up libmbedtls21:amd64 (3.6.4-2) ... Setting up libreadline8t64:amd64 (8.2-6) ... Setting up dh-strip-nondeterminism (1.14.1-2) ... Setting up libwww-robotrules-perl (6.02-1) ... Setting up libdrm2:amd64 (2.4.124-2) ... Setting up groff-base (1.23.0-9) ... Setting up libwayland-cursor0:amd64 (1.23.1-3) ... Setting up libhtml-parser-perl:amd64 (3.83-1+b2) ... Setting up gpgconf (2.4.7-21+b3) ... Setting up libpam-systemd:amd64 (257.7-1) ... Setting up libcommons-beanutils-java (1.10.1-1.1) ... Setting up libplexus-sec-dispatcher-java (2.0-3) ... Setting up libharfbuzz0b:amd64 (10.2.0-1+b1) ... Setting up libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-4) ... Setting up libsnappy-java (1.1.10.7-1) ... Setting up libxss1:amd64 (1:1.2.3-1+b3) ... Setting up libfontconfig1:amd64 (2.15.0-2.3) ... Setting up ca-certificates-java (20240118) ... No JRE found. Skipping Java certificates setup. Setting up libcommons-configuration-java (1.10-7) ... Setting up libwagon-file-java (3.5.3-2) ... Setting up libxml2-utils (2.12.7+dfsg+really2.9.14-2.1) ... Setting up libcommons-codec-java (1.18.0-1) ... Setting up libsm6:amd64 (2:1.2.6-1) ... Setting up libreflections-java (0.10.2+dfsg-2) ... Setting up libpython3.13-stdlib:amd64 (3.13.5-2) ... Setting up libavahi-client3:amd64 (0.8-16) ... Setting up libio-socket-ssl-perl (2.089-1) ... Setting up gpg (2.4.7-21+b3) ... Created symlink '/etc/systemd/user/sockets.target.wants/keyboxd.socket' -> '/usr/lib/systemd/user/keyboxd.socket'. Setting up libpython3-stdlib:amd64 (3.13.5-1) ... Setting up libhttp-message-perl (7.00-2) ... Setting up libdrm-amdgpu1:amd64 (2.4.124-2) ... Setting up libgnutls30t64:amd64 (3.8.9-3) ... Setting up gtk-update-icon-cache (4.18.6+ds-2) ... Setting up libhttp-negotiate-perl (6.01-2) ... Setting up velocity (1.7-7) ... Setting up fontconfig (2.15.0-2.3) ... Regenerating fonts cache... done. Setting up libxft2:amd64 (2.3.6-1+b4) ... Setting up gpg-agent (2.4.7-21+b3) ... Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-browser.socket' -> '/usr/lib/systemd/user/gpg-agent-browser.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-extra.socket' -> '/usr/lib/systemd/user/gpg-agent-extra.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-ssh.socket' -> '/usr/lib/systemd/user/gpg-agent-ssh.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent.socket' -> '/usr/lib/systemd/user/gpg-agent.socket'. Setting up libatk1.0-0t64:amd64 (2.56.2-1) ... Setting up openjdk-21-jre-headless:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/java to provide /usr/bin/java (java) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jpackage to provide /usr/bin/jpackage (jpackage) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/keytool to provide /usr/bin/keytool (keytool) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/rmiregistry to provide /usr/bin/rmiregistry (rmiregistry) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/lib/jexec to provide /usr/bin/jexec (jexec) in auto mode Setting up libxi6:amd64 (2:1.8.2-1) ... Setting up libtirpc3t64:amd64 (1.3.6+ds-1) ... Setting up libhttp-cookies-perl (6.11-1) ... Setting up python3.13 (3.13.5-2) ... Setting up libcommons-io-java (2.19.0-1) ... Setting up libcommons-digester-java (1.8.1-7) ... Setting up libxtst6:amd64 (2:1.2.5-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libhtml-tree-perl (5.07-3) ... Setting up libtk8.6:amd64 (8.6.16-1) ... Setting up libdistlib-java (1.0-5) ... Setting up libxcursor1:amd64 (1:1.2.3-1) ... Setting up libparams-classify-perl:amd64 (0.015-2+b4) ... Setting up libpango-1.0-0:amd64 (1.56.3-1) ... Setting up libdrm-intel1:amd64 (2.4.124-2) ... Setting up libpsl5t64:amd64 (0.21.2-1.1+b1) ... Setting up libncbi-vdb3:amd64 (3.2.1+dfsg-2) ... Setting up libcloudproviders0:amd64 (0.3.6-2) ... Setting up python3 (3.13.5-1) ... Setting up sopv-gpgv (0.1.4-1) ... update-alternatives: using /usr/bin/sopv-gpgv to provide /usr/bin/sopv (sopv) in auto mode Setting up man-db (2.13.1-1) ... Not building database; man-db/auto-update is not 'true'. Created symlink '/etc/systemd/system/timers.target.wants/man-db.timer' -> '/usr/lib/systemd/system/man-db.timer'. Setting up libcairo2:amd64 (1.18.4-1+b1) ... Setting up libcolord2:amd64 (1.4.7-3) ... Setting up libdconf1:amd64 (0.40.0-5) ... Setting up libmaven-filtering-java (3.4.0-1) ... Setting up dbus-user-session (1.16.2-2) ... Setting up libmaven-resolver-java (1.9.22-1) ... Setting up adwaita-icon-theme (48.1-1) ... update-alternatives: using /usr/share/icons/Adwaita/cursor.theme to provide /usr/share/icons/default/index.theme (x-cursor-theme) in auto mode Setting up libmodule-runtime-perl (0.018-1) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b5) ... Setting up libatspi2.0-0t64:amd64 (2.56.2-1) ... Setting up libxt6t64:amd64 (1:1.2.1-1.2+b2) ... Setting up libhttpclient-java (4.5.14-1) ... Setting up libmaven-common-artifact-filters-java (3.4.0-1) ... Setting up libmaven-dependency-tree-java (3.3.0-1) ... Setting up liblightcouch-java (0.2.0-1) ... Setting up libwagon-http-java (3.5.3-2) ... Setting up libcairo-gobject2:amd64 (1.18.4-1+b1) ... Setting up libmaven-shared-utils-java (3.4.2-1) ... Setting up libpangoft2-1.0-0:amd64 (1.56.3-1) ... Setting up libmaven-resources-plugin-java (3.3.1-1) ... Setting up libcups2t64:amd64 (2.4.10-3) ... Setting up libpangocairo-1.0-0:amd64 (1.56.3-1) ... Setting up libncbi-ngs3:amd64 (3.2.1+dfsg-4) ... Setting up libatk-bridge2.0-0t64:amd64 (2.56.2-1) ... Setting up mesa-libgallium:amd64 (25.0.7-2) ... Setting up libngs-jni:amd64 (3.2.1+dfsg-4) ... Setting up libplexus-io-java (3.3.1-2) ... Setting up libcommons-compress-java (1.27.1-2) ... Setting up libcurl4t64:amd64 (8.14.1-2) ... Setting up libcommons-validator-java (1:1.9.0-1) ... Setting up libgbm1:amd64 (25.0.7-2) ... Setting up libimport-into-perl (1.002005-2) ... Setting up libmoo-perl (2.005005-1) ... Setting up liblog4j2-java (2.19.0-2) ... Setting up libgl1-mesa-dri:amd64 (25.0.7-2) ... Setting up libmaven-invoker-java (3.3.0-1) ... Setting up debhelper (13.24.2) ... Setting up dconf-service (0.40.0-5) ... Setting up r-base-core (4.5.0-3) ... Creating config file /etc/R/Renviron with new version Setting up libmaven-clean-plugin-java (3.2.0-2) ... Setting up libplexus-archiver-java (4.6.1-1) ... Setting up libngs-java:amd64 (3.2.1+dfsg-4) ... Setting up libbarclay-java (5.0.0+dfsg-1) ... Setting up libglx-mesa0:amd64 (25.0.7-2) ... Setting up libglx0:amd64 (1.7.0-1+b2) ... Setting up dconf-gsettings-backend:amd64 (0.40.0-5) ... Setting up libmaven-archiver-java (3.6.2-1) ... Setting up libgl1:amd64 (1.7.0-1+b2) ... Setting up libmaven-source-plugin-java (3.3.1-1) ... Setting up libgtk-3-common (3.24.49-3) ... Setting up libgtk-3-0t64:amd64 (3.24.49-3) ... Setting up liberror-prone-java (2.18.0-1) ... Setting up libwww-perl (6.78-1) ... Setting up devscripts (2.25.15) ... Setting up libguava-java (32.0.1-1) ... Setting up javahelper (0.80) ... Setting up libprotobuf-java (3.21.12-11) ... Setting up libplexus-container-default-java (2.1.1-1) ... Setting up liblwp-protocol-https-perl (6.14-1) ... Setting up libguice-java (5.1.0-1) ... Setting up libplexus-i18n-java (1.0-beta-10-6) ... Setting up libplexus-container-default1.5-java (2.1.1-1) ... Setting up libplexus-velocity-java (1.2-4) ... Setting up libmaven3-core-java (3.9.9-1) ... Setting up libmaven-shared-incremental-java (1.1-6) ... Setting up libmaven-shared-io-java (3.0.0-4) ... Setting up libplexus-bsh-factory-java (1.0~alpha7-5) ... Setting up libplexus-compiler-java (2.13.0-1) ... Setting up libmaven-compiler-plugin-java (3.13.0-1) ... Setting up libmaven-artifact-transfer-java (0.13.1-3) ... Setting up libmaven-file-management-java (3.0.0-2) ... Setting up libbyte-buddy-java (1.14.19-1) ... Setting up libbuild-helper-maven-plugin-java (3.3.0-1) ... Setting up libeasymock-java (5.5.0-1) ... Setting up libmaven-jar-plugin-java (3.3.0-2) ... Setting up libmaven-assembly-plugin-java (3.4.2-2) ... Setting up libcommons-text-java (1.13.1-1) ... Setting up libdoxia-core-java (2.0.0-1) ... Setting up libdoxia-java (2.0.0-1) ... Setting up libmaven-reporting-api-java (4.0.0-1) ... Setting up libmaven-reporting-exec-java (2.0.0-1) ... Processing triggers for libc-bin (2.41-11) ... Processing triggers for systemd (257.7-1) ... Processing triggers for ca-certificates-java (20240118) ... Adding debian:ACCVRAIZ1.pem Adding debian:AC_RAIZ_FNMT-RCM.pem Adding debian:AC_RAIZ_FNMT-RCM_SERVIDORES_SEGUROS.pem Adding debian:ANF_Secure_Server_Root_CA.pem Adding debian:Actalis_Authentication_Root_CA.pem Adding debian:AffirmTrust_Commercial.pem Adding debian:AffirmTrust_Networking.pem Adding debian:AffirmTrust_Premium.pem Adding debian:AffirmTrust_Premium_ECC.pem Adding debian:Amazon_Root_CA_1.pem Adding debian:Amazon_Root_CA_2.pem Adding debian:Amazon_Root_CA_3.pem Adding debian:Amazon_Root_CA_4.pem Adding debian:Atos_TrustedRoot_2011.pem Adding debian:Atos_TrustedRoot_Root_CA_ECC_TLS_2021.pem Adding debian:Atos_TrustedRoot_Root_CA_RSA_TLS_2021.pem Adding debian:Autoridad_de_Certificacion_Firmaprofesional_CIF_A62634068.pem Adding debian:BJCA_Global_Root_CA1.pem Adding debian:BJCA_Global_Root_CA2.pem Adding debian:Baltimore_CyberTrust_Root.pem Adding debian:Buypass_Class_2_Root_CA.pem Adding debian:Buypass_Class_3_Root_CA.pem Adding debian:CA_Disig_Root_R2.pem Adding debian:CFCA_EV_ROOT.pem Adding debian:COMODO_Certification_Authority.pem Adding debian:COMODO_ECC_Certification_Authority.pem Adding debian:COMODO_RSA_Certification_Authority.pem Adding debian:Certainly_Root_E1.pem Adding debian:Certainly_Root_R1.pem Adding debian:Certigna.pem Adding debian:Certigna_Root_CA.pem Adding debian:Certum_EC-384_CA.pem Adding debian:Certum_Trusted_Network_CA.pem Adding debian:Certum_Trusted_Network_CA_2.pem Adding debian:Certum_Trusted_Root_CA.pem Adding debian:CommScope_Public_Trust_ECC_Root-01.pem Adding debian:CommScope_Public_Trust_ECC_Root-02.pem Adding debian:CommScope_Public_Trust_RSA_Root-01.pem Adding debian:CommScope_Public_Trust_RSA_Root-02.pem Adding debian:Comodo_AAA_Services_root.pem Adding debian:D-TRUST_BR_Root_CA_1_2020.pem Adding debian:D-TRUST_BR_Root_CA_2_2023.pem Adding debian:D-TRUST_EV_Root_CA_1_2020.pem Adding debian:D-TRUST_EV_Root_CA_2_2023.pem Adding debian:D-TRUST_Root_Class_3_CA_2_2009.pem Adding debian:D-TRUST_Root_Class_3_CA_2_EV_2009.pem Adding debian:DigiCert_Assured_ID_Root_CA.pem Adding debian:DigiCert_Assured_ID_Root_G2.pem Adding debian:DigiCert_Assured_ID_Root_G3.pem Adding debian:DigiCert_Global_Root_CA.pem Adding debian:DigiCert_Global_Root_G2.pem Adding debian:DigiCert_Global_Root_G3.pem Adding debian:DigiCert_High_Assurance_EV_Root_CA.pem Adding debian:DigiCert_TLS_ECC_P384_Root_G5.pem Adding debian:DigiCert_TLS_RSA4096_Root_G5.pem Adding debian:DigiCert_Trusted_Root_G4.pem Adding debian:Entrust.net_Premium_2048_Secure_Server_CA.pem Adding debian:Entrust_Root_Certification_Authority.pem Adding debian:Entrust_Root_Certification_Authority_-_EC1.pem Adding debian:Entrust_Root_Certification_Authority_-_G2.pem Adding debian:FIRMAPROFESIONAL_CA_ROOT-A_WEB.pem Adding debian:GDCA_TrustAUTH_R5_ROOT.pem Adding debian:GLOBALTRUST_2020.pem Adding debian:GTS_Root_R1.pem Adding debian:GTS_Root_R2.pem Adding debian:GTS_Root_R3.pem Adding debian:GTS_Root_R4.pem Adding debian:GlobalSign_ECC_Root_CA_-_R4.pem Adding debian:GlobalSign_ECC_Root_CA_-_R5.pem Adding debian:GlobalSign_Root_CA.pem Adding debian:GlobalSign_Root_CA_-_R3.pem Adding debian:GlobalSign_Root_CA_-_R6.pem Adding debian:GlobalSign_Root_E46.pem Adding debian:GlobalSign_Root_R46.pem Adding debian:Go_Daddy_Class_2_CA.pem Adding debian:Go_Daddy_Root_Certificate_Authority_-_G2.pem Adding debian:HARICA_TLS_ECC_Root_CA_2021.pem Adding debian:HARICA_TLS_RSA_Root_CA_2021.pem Adding debian:Hellenic_Academic_and_Research_Institutions_ECC_RootCA_2015.pem Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2015.pem Adding debian:HiPKI_Root_CA_-_G1.pem Adding debian:Hongkong_Post_Root_CA_3.pem Adding debian:ISRG_Root_X1.pem Adding debian:ISRG_Root_X2.pem Adding debian:IdenTrust_Commercial_Root_CA_1.pem Adding debian:IdenTrust_Public_Sector_Root_CA_1.pem Adding debian:Izenpe.com.pem Adding debian:Microsec_e-Szigno_Root_CA_2009.pem Adding debian:Microsoft_ECC_Root_Certificate_Authority_2017.pem Adding debian:Microsoft_RSA_Root_Certificate_Authority_2017.pem Adding debian:NAVER_Global_Root_Certification_Authority.pem Adding debian:NetLock_Arany_=Class_Gold=_Főtanúsítvány.pem Adding debian:OISTE_WISeKey_Global_Root_GB_CA.pem Adding debian:OISTE_WISeKey_Global_Root_GC_CA.pem Adding debian:QuoVadis_Root_CA_1_G3.pem Adding debian:QuoVadis_Root_CA_2.pem Adding debian:QuoVadis_Root_CA_2_G3.pem Adding debian:QuoVadis_Root_CA_3.pem Adding debian:QuoVadis_Root_CA_3_G3.pem Adding debian:SSL.com_EV_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_EV_Root_Certification_Authority_RSA_R2.pem Adding debian:SSL.com_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_Root_Certification_Authority_RSA.pem Adding debian:SSL.com_TLS_ECC_Root_CA_2022.pem Adding debian:SSL.com_TLS_RSA_Root_CA_2022.pem Adding debian:SZAFIR_ROOT_CA2.pem Adding debian:Sectigo_Public_Server_Authentication_Root_E46.pem Adding debian:Sectigo_Public_Server_Authentication_Root_R46.pem Adding debian:SecureSign_Root_CA12.pem Adding debian:SecureSign_Root_CA14.pem Adding debian:SecureSign_Root_CA15.pem Adding debian:SecureTrust_CA.pem Adding debian:Secure_Global_CA.pem Adding debian:Security_Communication_ECC_RootCA1.pem Adding debian:Security_Communication_RootCA2.pem Adding debian:Starfield_Class_2_CA.pem Adding debian:Starfield_Root_Certificate_Authority_-_G2.pem Adding debian:Starfield_Services_Root_Certificate_Authority_-_G2.pem Adding debian:SwissSign_Gold_CA_-_G2.pem Adding debian:T-TeleSec_GlobalRoot_Class_2.pem Adding debian:T-TeleSec_GlobalRoot_Class_3.pem Adding debian:TUBITAK_Kamu_SM_SSL_Kok_Sertifikasi_-_Surum_1.pem Adding debian:TWCA_CYBER_Root_CA.pem Adding debian:TWCA_Global_Root_CA.pem Adding debian:TWCA_Root_Certification_Authority.pem Adding debian:Telekom_Security_TLS_ECC_Root_2020.pem Adding debian:Telekom_Security_TLS_RSA_Root_2023.pem Adding debian:TeliaSonera_Root_CA_v1.pem Adding debian:Telia_Root_CA_v2.pem Adding debian:TrustAsia_Global_Root_CA_G3.pem Adding debian:TrustAsia_Global_Root_CA_G4.pem Adding debian:Trustwave_Global_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P256_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P384_Certification_Authority.pem Adding debian:TunTrust_Root_CA.pem Adding debian:UCA_Extended_Validation_Root.pem Adding debian:UCA_Global_G2_Root.pem Adding debian:USERTrust_ECC_Certification_Authority.pem Adding debian:USERTrust_RSA_Certification_Authority.pem Adding debian:XRamp_Global_CA_Root.pem Adding debian:certSIGN_ROOT_CA.pem Adding debian:certSIGN_Root_CA_G2.pem Adding debian:e-Szigno_Root_CA_2017.pem Adding debian:ePKI_Root_Certification_Authority.pem Adding debian:emSign_ECC_Root_CA_-_C3.pem Adding debian:emSign_ECC_Root_CA_-_G3.pem Adding debian:emSign_Root_CA_-_C1.pem Adding debian:emSign_Root_CA_-_G1.pem Adding debian:vTrus_ECC_Root_CA.pem Adding debian:vTrus_Root_CA.pem done. Setting up maven (3.9.9-1) ... update-alternatives: using /usr/share/maven/bin/mvn to provide /usr/bin/mvn (mvn) in auto mode Setting up openjdk-21-jre:amd64 (21.0.8+9-1) ... Setting up ant (1.10.15-1) ... Setting up junit4 (4.13.2-5) ... Setting up openjdk-21-jdk-headless:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jar to provide /usr/bin/jar (jar) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jarsigner to provide /usr/bin/jarsigner (jarsigner) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javac to provide /usr/bin/javac (javac) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javadoc to provide /usr/bin/javadoc (javadoc) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javap to provide /usr/bin/javap (javap) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jcmd to provide /usr/bin/jcmd (jcmd) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdb to provide /usr/bin/jdb (jdb) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdeprscan to provide /usr/bin/jdeprscan (jdeprscan) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdeps to provide /usr/bin/jdeps (jdeps) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jfr to provide /usr/bin/jfr (jfr) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jimage to provide /usr/bin/jimage (jimage) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jinfo to provide /usr/bin/jinfo (jinfo) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jlink to provide /usr/bin/jlink (jlink) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jmap to provide /usr/bin/jmap (jmap) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jmod to provide /usr/bin/jmod (jmod) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jps to provide /usr/bin/jps (jps) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jrunscript to provide /usr/bin/jrunscript (jrunscript) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jshell to provide /usr/bin/jshell (jshell) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstack to provide /usr/bin/jstack (jstack) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstat to provide /usr/bin/jstat (jstat) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstatd to provide /usr/bin/jstatd (jstatd) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jwebserver to provide /usr/bin/jwebserver (jwebserver) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/serialver to provide /usr/bin/serialver (serialver) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jhsdb to provide /usr/bin/jhsdb (jhsdb) in auto mode Setting up default-jre-headless (2:1.21-76) ... Setting up ant-contrib (1.0~b3+svn177-12) ... Setting up maven-repo-helper (1.11) ... Setting up default-jre (2:1.21-76) ... Setting up libmaven-antrun-plugin-java (3.1.0-1) ... Setting up libplexus-ant-factory-java (1.0~alpha2.1-5) ... Setting up openjdk-21-jdk:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jconsole to provide /usr/bin/jconsole (jconsole) in auto mode Setting up default-jdk-headless (2:1.21-76) ... Setting up libjsap-java (2.1-5) ... Setting up r-cran-rjava (1.0-11-2) ... Setting up libdsiutils-java (2.7.3+dfsg-1) ... Setting up junit5 (5.10.3-1) ... Setting up libjson-java (3.1.0+dfsg-2) ... Setting up libhtsjdk-java (4.1.3+dfsg-2) ... Setting up libmaven-plugin-tools-java (3.10.2-2) ... Setting up libgkl-java (0.8.11+dfsg-2) ... Setting up default-jdk (2:1.21-76) ... Setting up libpicard-java (3.3.0+dfsg-2) ... Setting up libicb-utils-java (2.0.1+git20161002.afee1d9-5) ... Processing triggers for sgml-base (1.31+nmu1) ... Setting up libvelocity-tools-java (2.0-9) ... Setting up libdoxia-sitetools-java (2.0.0-1) ... Setting up libmaven-site-plugin-java (3.21.0-1) ... Setting up libmaven-javadoc-plugin-java (3.10.1-2) ... Setting up libmaven-reporting-impl-java (4.0.0-1) ... Setting up libsurefire-java (2.22.3-4) ... Setting up libmaven-dependency-plugin-java (3.8.1-1) ... Setting up maven-debian-helper (2.6.7) ... Processing triggers for ca-certificates (20250419) ... Updating certificates in /etc/ssl/certs... 0 added, 0 removed; done. Running hooks in /etc/ca-certificates/update.d... done. Processing triggers for ca-certificates-java (20240118) ... done. Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/reproducible-path/libgoby-java-3.3.1+dfsg2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../libgoby-java_3.3.1+dfsg2-11_source.changes dpkg-buildpackage: info: source package libgoby-java dpkg-buildpackage: info: source version 3.3.1+dfsg2-11 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Pierre Gruet dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean --with javahelper dh_auto_clean bash -c "for dir in \$(find . -name target -type d); do if [ -f \$(echo \$dir | sed -e s/target\$/pom.xml/) ]; then rm -Rf \$dir; fi done" mh_unpatchpoms -plibgoby-io-java jh_clean Duplicate specification "unlink|u" for option "u" debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' dh_clean rm -rf goby-distribution/test-data goby-distribution/test-results rm -rf test-results/ make[1]: Leaving directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' debian/rules binary dh binary --with javahelper dh_update_autotools_config dh_autoreconf dh_auto_configure mh_patchpoms -plibgoby-io-java --debian-build --keep-pom-version --maven-repo=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo jh_linkjars dh_auto_build /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode package -DskipTests -Dnotimestamp=true -Dlocale=en_US OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] The artifact org.apache.maven.plugins:maven-surefire-plugin:jar:2.17 has been relocated to org.apache.maven.plugins:maven-surefire-plugin:jar:2.22.3 [WARNING] The artifact org.apache.maven.plugins:maven-jar-plugin:jar:3.1.2 has been relocated to org.apache.maven.plugins:maven-jar-plugin:jar:3.3.0 [WARNING] Parameter 'additionalparam' is unknown for plugin 'maven-javadoc-plugin:3.10.1:jar (attach-javadocs)' [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] [mkdir] Created dir: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-io --- [INFO] Copying 2 resources from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-io --- [INFO] Recompiling the module because of changed source code. [INFO] Compiling 260 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- antrun:3.1.0:run (default) @ goby-io --- [WARNING] Parameter 'tasks' is deprecated: Use target instead. For version 3.0.0, this parameter is only defined to break the build if you use it! [WARNING] Parameter tasks is deprecated, use target instead [INFO] Executing tasks [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2 [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/classes [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-io --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-io --- [INFO] No sources to compile [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-io --- [INFO] Tests are skipped. [INFO] [INFO] --- jar:3.3.0:jar (default-jar) @ goby-io --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1.jar [INFO] [INFO] >>> source:3.3.1:jar (attach-sources) > generate-sources @ goby-io >>> [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] <<< source:3.3.1:jar (attach-sources) < generate-sources @ goby-io <<< [INFO] [INFO] [INFO] --- source:3.3.1:jar (attach-sources) @ goby-io --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1-sources.jar [INFO] [INFO] --- javadoc:3.10.1:jar (attach-javadocs) @ goby-io --- [INFO] Adding the --ignore-source-errors option [INFO] No previous run data found, generating javadoc. [WARNING] Javadoc Warnings [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:26: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:68: error: cannot find symbol [WARNING] Rengine rEngine; [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class FisherExactRCalculator [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactTestCalculator.java:21: error: package DistLib does not exist [WARNING] import DistLib.hypergeometric; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/EstimatedDistribution.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AnnotationAveragingWriter.java:39: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:32: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:43: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:44: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:45: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Unmarshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:76: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class StatsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:34: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:35: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:36: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Marshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlRootElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:31: error: cannot find symbol [WARNING] @XmlRootElement [WARNING] ^ [WARNING] symbol: class XmlRootElement [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:696: error: cannot find symbol [WARNING] private void writeXml(PrintWriter output, String[] samples, MethylStats[] methylStats) throws JAXBException { [WARNING] ^ [WARNING] symbol: class JAXBException [WARNING] location: class MethylStatsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/SimulateBisulfiteReads.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:30: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.CommandLine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:31: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.DefaultExecutor; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:32: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.PumpStreamHandler; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/TestRConnectionMode.java:25: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/PercentMismatchesQualityFilter.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:39: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:40: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelRegion; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:41: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:53: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:54: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:55: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Marshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:106: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:325: error: cannot find symbol [WARNING] protected synchronized ParallelTeam getParallelTeam() { [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:23: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlElementWrapper; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:24: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlRootElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:32: error: cannot find symbol [WARNING] @XmlRootElement(name = "info-output") [WARNING] ^ [WARNING] symbol: class XmlRootElement [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:441: error: cannot find symbol [WARNING] private void writeInfoOutput() throws JAXBException, IOException { [WARNING] ^ [WARNING] symbol: class JAXBException [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessorType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: class XmlAccessorType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessorType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: class XmlAccessorType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:283: error: cannot find symbol [WARNING] class BasenameParallelRegion extends ParallelRegion { [WARNING] ^ [WARNING] symbol: class ParallelRegion [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/FastaToCompactMode.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.PJProperties; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/BetweenGroupSequenceVariationOutputFormat.java:40: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/CompareGroupsVCFOutputFormat.java:42: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/MethylationRateVCFOutputFormat.java:45: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/FoldChangeForExonPairs.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/PlantIndels.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:24: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelRegion; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:31: error: cannot find symbol [WARNING] class BasenameParallelRegion extends ParallelRegion { [WARNING] ^ [WARNING] symbol: class ParallelRegion [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:21: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:33: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class DoInParallel [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:47: error: cannot find symbol [WARNING] protected synchronized ParallelTeam getParallelTeam() { [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class DoInParallel [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/FisherExactTestAdaptor.java:23: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/methylation/MethylSimilarityScan.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:23: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RMainLoopCallbacks; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:24: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:29: error: cannot find symbol [WARNING] class RLoggerMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ [WARNING] symbol: class RMainLoopCallbacks [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:42: error: cannot find symbol [WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:57: error: cannot find symbol [WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:77: error: cannot find symbol [WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:88: error: cannot find symbol [WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:99: error: cannot find symbol [WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:108: error: cannot find symbol [WARNING] public void rFlushConsole(final Rengine rengine) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:118: error: cannot find symbol [WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:127: error: cannot find symbol [WARNING] public void rLoadHistory(final Rengine re, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:24: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:56: error: cannot find symbol [WARNING] private Rengine rengine; [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class GobyRengine [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:127: error: cannot find symbol [WARNING] public Rengine getRengine() { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class GobyRengine [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:27: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.REXP; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:28: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RVector; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:29: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:208: error: cannot find symbol [WARNING] private static Result evaluateFisherExpression(final Rengine rengine, [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class FisherExact [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:21: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RMainLoopCallbacks; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:22: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:27: error: cannot find symbol [WARNING] class RConsoleMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ [WARNING] symbol: class RMainLoopCallbacks [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:35: error: cannot find symbol [WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:50: error: cannot find symbol [WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:70: error: cannot find symbol [WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:81: error: cannot find symbol [WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:92: error: cannot find symbol [WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:101: error: cannot find symbol [WARNING] public void rFlushConsole(final Rengine rengine) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:111: error: cannot find symbol [WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:120: error: cannot find symbol [WARNING] public void rLoadHistory(final Rengine re, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: variable XmlAccessType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:35: error: cannot find symbol [WARNING] @XmlElement(name = "al") [WARNING] ^ [WARNING] symbol: class XmlElement [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:36: error: cannot find symbol [WARNING] @XmlElementWrapper(name = "annotation-lengths") [WARNING] ^ [WARNING] symbol: class XmlElementWrapper [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: variable XmlAccessType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:39: error: cannot find symbol [WARNING] @XmlElement(name = "tc") [WARNING] ^ [WARNING] symbol: class XmlElement [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:40: error: cannot find symbol [WARNING] @XmlElementWrapper(name = "total-counts") [WARNING] ^ [WARNING] symbol: class XmlElementWrapper [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/dsv/CommonIndelArtifactFilter.java:17: warning: invalid input: '<' [WARNING] * larger than expected (P<0.05, with Poisson cumulative distribution) from prior observations (most of them are assumed to be errors). [WARNING] ^ [WARNING] 100 warnings [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1-javadoc.jar [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] Parameter 'additionalparam' is unknown for plugin 'maven-javadoc-plugin:3.10.1:jar (attach-javadocs)' [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-distribution --- [INFO] Copying 3 resources from src/main/resources to target/classes [INFO] Copying 72 resources from src/main/java to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 525 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-distribution --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 120 source files with javac [debug target 1.8] to target/test-classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-distribution --- [INFO] Tests are skipped. [INFO] [INFO] --- jar:3.3.0:jar (default-jar) @ goby-distribution --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1.jar [INFO] [INFO] >>> source:3.3.1:jar (attach-sources) > generate-sources @ goby-distribution >>> [INFO] [INFO] <<< source:3.3.1:jar (attach-sources) < generate-sources @ goby-distribution <<< [INFO] [INFO] [INFO] --- source:3.3.1:jar (attach-sources) @ goby-distribution --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1-sources.jar [INFO] [INFO] --- javadoc:3.10.1:jar (attach-javadocs) @ goby-distribution --- [INFO] Adding the --ignore-source-errors option [INFO] No previous run data found, generating javadoc. [WARNING] Javadoc Warnings [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/dsv/CommonIndelArtifactFilter.java:17: warning: invalid input: '<' [WARNING] * larger than expected (P<0.05, with Poisson cumulative distribution) from prior observations (most of them are assumed to be errors). [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticCoder.java:56: warning: reference not found: it.unimi.dsi.mg4j.io.ArithmeticDecoder [WARNING] * @see it.unimi.dsi.mg4j.io.ArithmeticDecoder (MG4J). [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoder.java:33: warning: reference not found: it.unimi.dsi.mg4j.io.ArithmeticDecoder [WARNING] * @see it.unimi.dsi.mg4j.io.ArithmeticDecoder (MG4J) [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:60: warning: @return tag cannot be used in method with void return type. [WARNING] void flush(InputBitStream ibs) throws IOException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:72: warning: reference not found: org.campagnelab.goby.aligners.LastagAligner [WARNING] * @see org.campagnelab.goby.aligners.LastagAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:79: warning: reference not found: org.campagnelab.goby.aligners.LastAligner [WARNING] * @see org.campagnelab.goby.aligners.LastAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:87: warning: reference not found: org.campagnelab.goby.aligners.BWAAligner [WARNING] * @see org.campagnelab.goby.aligners.BWAAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:95: warning: reference not found: org.campagnelab.goby.aligners.GSnapAligner [WARNING] * @see org.campagnelab.goby.aligners.GSnapAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:131: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * @return the next {@link edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/MoveToFrontCoder.java:42: warning: invalid input: '<' [WARNING] * @param symbol Symbol to encode with move to front (precondition: 0<= symbol ?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/QualityEncoding.java:41: warning: invalid input: '<' [WARNING] * !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparison.java:233: warning: @return tag cannot be used in method with void return type. [WARNING] public void setCountComparisonFailures(final boolean countComparisonFailures) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparison.java:275: warning: @return tag cannot be used in method with void return type. [WARNING] public void setAllowSourceNs(boolean allowSourceNs) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparisonInterface.java:130: warning: @return tag cannot be used in method with void return type. [WARNING] public void setAllowSourceNs(boolean allowSourceNs); [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SAMComparisonMode.java:214: warning: @return tag cannot be used in method with void return type. [WARNING] public void setCheckMate(final boolean checkMate) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SamExtractReadsMode.java:44: warning: invalid input: '<' [WARNING] * WARNING: If the file contains pairs, the source SAM/BAM file >>MUST<< be sorted by read name. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SamExtractReadsMode.java:44: warning: invalid input: '<' [WARNING] * WARNING: If the file contains pairs, the source SAM/BAM file >>MUST<< be sorted by read name. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SampleQualityScoresMode.java:176: warning: invalid input: '<' [WARNING] * Set to <= 0 to process the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '&' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '&' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '<' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SortMode.java:142: warning: invalid input: '<' [WARNING] * Set to < 0 for auto-detect number of cores. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/vcf/VCFParser.java:179: warning: invalid input: '<' [WARNING] * Set to <= 0 to scan the entire file. This must be set before calling readHeader() for the value to be used. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] 91 warnings [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1-javadoc.jar [INFO] [INFO] --- assembly:3.4.2:single (make-assembly) @ goby-distribution --- [WARNING] Parameter 'finalName' is read-only, must not be used in configuration [INFO] Reading assembly descriptor: assembly/assembly.xml [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-bin.jar [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.062 s] [INFO] Goby I/O ........................................... SUCCESS [ 25.186 s] [INFO] Goby Full Distribution ............................. SUCCESS [ 36.572 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 01:01 min [INFO] Finished at: 2026-09-08T11:36:40-12:00 [INFO] ------------------------------------------------------------------------ debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' # Create a symlink to the directory with test data for tests run from the # goby-distribution directory. ln -s ../test-data goby-distribution/test-data # The test-results directory should exist because test classes will write inside. if [ ! -e test-results ]; then mkdir test-results/; fi # Putting the JRI location in the path, as indicated in GobyRengine.java. # Also indicating R_HOME, as found in http://rforge.net/JRI/. export LD_LIBRARY_PATH="$LD_LIBRARY_PATH:/usr/lib/R/site-library/rJava/jri" && \ export R_HOME="/usr/lib/R" && \ dh_auto_test --no-parallel /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode test OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] The artifact org.apache.maven.plugins:maven-surefire-plugin:jar:2.17 has been relocated to org.apache.maven.plugins:maven-surefire-plugin:jar:2.22.3 [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-io --- [INFO] Copying 2 resources from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-io --- [INFO] Recompiling the module because of changed source code. [INFO] Compiling 260 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- antrun:3.1.0:run (default) @ goby-io --- [WARNING] Parameter 'tasks' is deprecated: Use target instead. For version 3.0.0, this parameter is only defined to break the build if you use it! [WARNING] Parameter tasks is deprecated, use target instead [INFO] Executing tasks [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2 [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/classes [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-io --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-io --- [INFO] No sources to compile [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-io --- [INFO] No tests to run. [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-distribution --- [INFO] Copying 3 resources from src/main/resources to target/classes [INFO] Copying 72 resources from src/main/java to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 525 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-distribution --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 120 source files with javac [debug target 1.8] to target/test-classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-distribution --- [INFO] [INFO] ------------------------------------------------------- [INFO] T E S T S [INFO] ------------------------------------------------------- [INFO] Running TestSuite 11:36:59.262 INFO TestPostBarcodeMatcher - Num matches = 200, Num Ambiguous = 0, Num no matches = 0 11:36:59.267 INFO TestPostBarcodeMatcher - Time to parse 8 million reads 0 seconds SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/share/java/slf4j-simple.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven-repo/ch/qos/logback/logback-classic/debian/logback-classic-debian.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/share/java/logback-classic.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. SLF4J: Actual binding is of type [org.slf4j.impl.SimpleLoggerFactory] Creating base test directory: test-results/stats [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. 11:36:59.447 INFO RLoggerMainLoopCallback - 11:36:59.448 INFO RLoggerMainLoopCallback - R version 4.5.0 (2025-04-11) -- "How About a Twenty-Six" Copyright (C) 2025 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu 11:36:59.448 INFO RLoggerMainLoopCallback - R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. 11:36:59.448 INFO RLoggerMainLoopCallback - R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. 11:36:59.448 INFO RLoggerMainLoopCallback - Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. ##fileformat=VCFv4.1 ##Goby=UNKNOWN ##FieldGroupAssociations=CHROM=genomic-coordinate,CHROM=cross-sample-field,POS=genomic-coordinate,POS=cross-sample-field,ID=external-identifiers,ID=cross-sample-field,REF=cross-sample-field,ALT=cross-sample-field,QUAL=cross-sample-field,FILTER=cross-sample-field,INFO=cross-sample-field,INFO/p-value1=cross-sample-field,INFO/p-value1=p-value,INFO/p-value2=cross-sample-field,INFO/p-value2=p-value,INFO/#Cm_Group[Group_1]=cross-sample-field,INFO/#Cm_Group[Group_1]=#Cm,FORMAT/Zygosity=zygozity,FORMAT/Zygosity=sample-data,FORMAT/Another=another,FORMAT/Another=sample-data, ##INFO= ##INFO= ##INFO= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SampleA SampleB 11:36:59.723 INFO BullardUpperQuartileNormalization - normalization denominator 55731.7 for sample B-7 11:36:59.723 INFO BullardUpperQuartileNormalization - normalization denominator 55210.1 for sample B-3 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 114146 for sample A-3 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 110048 for sample A-12 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 55508.1 for sample B-15 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 56178.7 for sample B-14 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 57370.8 for sample B-11 11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 110495 for sample A-17 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 57892.4 for sample B-2 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 57668.9 for sample B-10 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 110793 for sample A-16 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 56402.2 for sample B-8 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 54316.0 for sample B-4 11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 113773 for sample A-2 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 108781 for sample A-0 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 55359.1 for sample B-6 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 111687 for sample A-9 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 109899 for sample A-8 11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 114071 for sample A-5 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 110569 for sample A-4 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 113177 for sample A-6 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 113102 for sample A-7 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 56923.8 for sample B-5 11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 114071 for sample A-10 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 109303 for sample A-14 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 55061.1 for sample B-9 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 112059 for sample A-1 11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 56029.7 for sample B-0 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 56700.3 for sample B-12 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 57147.3 for sample B-13 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 113401 for sample A-19 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 110718 for sample A-18 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 112208 for sample A-15 11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 56029.7 for sample B-1 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 112953 for sample A-13 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 112581 for sample A-11 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 57668.9 for sample B-16 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 56774.8 for sample B-17 11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 55880.7 for sample B-19 11:36:59.731 INFO BullardUpperQuartileNormalization - normalization denominator 57519.8 for sample B-18 11:36:59.802 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value 11:36:59.846 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. 11:36:59.846 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value 11:36:59.859 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. 11:36:59.859 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value 11:36:59.996 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. 11:37:00.046 INFO FDRAdjustment - ... statistic t-test-P-value-Bonferroni-adjusted was found, FDR adjustment executed. 11:37:00.047 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value 11:37:00.174 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. 11:37:00.192 INFO FDRAdjustment - ... statistic another-p-value-Bonferroni-adjusted was found, FDR adjustment executed. list3:element-id p-value p-value-BH-FDR-q-value [ 0 [2.354054E-7, 1.177027E-5] ] [ 1 [2.10159E-5, 4.294736666666667E-4] ] [ 2 [2.576842E-5, 4.294736666666667E-4] ] [ 3 [9.814783E-5, 9.471342857142858E-4] ] [ 4 [1.05261E-4, 9.471342857142858E-4] ] [ 5 [1.241481E-4, 9.471342857142858E-4] ] [ 6 [1.325988E-4, 9.471342857142858E-4] ] [ 7 [1.568503E-4, 9.803143750000002E-4] ] [ 8 [2.254557E-4, 0.0012525316666666666] ] [ 9 [3.79538E-4, 0.00189769] ] [ 10 [6.114943E-4, 0.0027795195454545455] ] [ 11 [0.001613954, 0.006724808333333334] ] [ 12 [0.00330243, 0.012636935714285714] ] [ 13 [0.003538342, 0.012636935714285714] ] [ 14 [0.005236997, 0.017456656666666667] ] [ 15 [0.006831909, 0.020762429411764708] ] [ 16 [0.007059226, 0.020762429411764708] ] [ 17 [0.008805129, 0.024458691666666667] ] [ 18 [0.00940104, 0.02473957894736842] ] [ 19 [0.01129798, 0.028244949999999998] ] [ 20 [0.02115017, 0.050357547619047614] ] [ 21 [0.04922736, 0.11188036363636364] ] [ 22 [0.06053298, 0.1304633125] ] [ 23 [0.06262239, 0.1304633125] ] [ 24 [0.07395153, 0.14790306] ] [ 25 [0.08281103, 0.15925198076923075] ] [ 26 [0.08633331, 0.1598765] ] [ 27 [0.1190654, 0.21261678571428572] ] [ 28 [0.1890796, 0.32599931034482754] ] [ 29 [0.2058494, 0.3430823333333333] ] [ 30 [0.2209214, 0.3563248387096774] ] [ 31 [0.2856, 0.44625000000000004] ] [ 32 [0.3048895, 0.4619537878787878] ] [ 33 [0.4660682, 0.6835770833333333] ] [ 34 [0.4830809, 0.6835770833333333] ] [ 35 [0.4921755, 0.6835770833333333] ] [ 36 [0.5319453, 0.718845] ] [ 37 [0.575155, 0.7414352564102564] ] [ 38 [0.5783195, 0.7414352564102564] ] [ 39 [0.6185894, 0.7626062790697675] ] [ 40 [0.636362, 0.7626062790697675] ] [ 41 [0.6448587, 0.7626062790697675] ] [ 42 [0.6558414, 0.7626062790697675] ] [ 43 [0.6885884, 0.7824868181818182] ] [ 44 [0.7189864, 0.7988737777777778] ] [ 45 [0.8179539, 0.8802645744680851] ] [ 46 [0.8274487, 0.8802645744680851] ] [ 47 [0.89713, 0.9304775510204082] ] [ 48 [0.911868, 0.9304775510204082] ] [ 49 [0.943789, 0.943789] ] element-id average RPKM group A(AC) average RPKM group B(AC) average log2_RPKM group A(AC) average log2_RPKM group B(AC) average count group A average count group B [ id-1 [1.0027385888732063, 0.49859021162242134, 0.003945548431445906, -1.0040735349267995, 0.0, 0.0] ] truncated fdr=3.53108e-05 original=3.53108e-05 truncated fdr=0.00128842 original=0.00128842 truncated fdr=0.00128842 original=0.00128842 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00294094 original=0.00294094 truncated fdr=0.00375760 original=0.00375760 truncated fdr=0.00569307 original=0.00569307 truncated fdr=0.00833856 original=0.00833856 truncated fdr=0.0201744 original=0.0201744 truncated fdr=0.0379108 original=0.0379108 truncated fdr=0.0379108 original=0.0379108 truncated fdr=0.0523700 original=0.0523700 truncated fdr=0.0622873 original=0.0622873 truncated fdr=0.0622873 original=0.0622873 truncated fdr=0.0733761 original=0.0733761 truncated fdr=0.0742187 original=0.0742187 truncated fdr=0.0847349 original=0.0847349 truncated fdr=0.151073 original=0.151073 truncated fdr=0.335641 original=0.335641 truncated fdr=0.391390 original=0.391390 truncated fdr=0.391390 original=0.391390 truncated fdr=0.443709 original=0.443709 truncated fdr=0.477756 original=0.477756 truncated fdr=0.479630 original=0.479630 truncated fdr=0.637850 original=0.637850 truncated fdr=0.977998 original=0.977998 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. Creating base test directory: test-results/stats-writer allele: A ref: [CC] alt: [T]11:37:12.719 WARN MessageChunksWriter - Using chunk-size=10000 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) 11:37:13.176 WARN GobyVersion - Version number UNKNOWN not recognized. Assuming this version is the most recent. [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.258 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.261 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.263 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.265 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.267 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.269 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.271 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.273 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.275 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.277 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.463 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.465 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.467 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.468 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.470 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.472 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.473 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.475 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.477 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.478 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.554 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.555 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.556 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.558 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.560 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.561 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.563 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.564 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.565 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.567 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.637 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.638 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.639 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.641 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.642 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.644 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.645 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.647 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.648 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.649 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.747 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.748 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.750 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.751 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.752 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.753 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.755 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.757 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.758 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.760 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.827 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.828 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.829 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.830 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.831 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.832 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.833 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.834 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.835 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.836 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.897 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.899 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.900 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.901 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.903 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.904 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.905 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.907 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.908 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.910 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:13.966 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:13.967 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:13.968 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:13.969 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:13.970 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:13.971 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:13.973 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:13.974 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:13.976 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:13.977 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.037 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.038 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.039 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.040 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.041 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.042 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.043 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.044 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.045 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.046 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.101 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.102 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.103 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.104 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.105 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.106 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.107 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.108 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.109 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.110 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.167 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.168 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.169 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.170 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.171 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.172 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.173 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.174 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.174 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.175 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Methylation format ignores thresholdDistinctReadIndices. Additionally, the minimum coverage needed for a site to be reported can be changed with --minimum-variation-support. Filtering reads that have these criteria: [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest_mci [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 11:37:14.236 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 11:37:14.237 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 11:37:14.238 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 11:37:14.239 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 11:37:14.240 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 11:37:14.241 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 11:37:14.242 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 11:37:14.243 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 11:37:14.244 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 11:37:14.245 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + /T q=40 s=0 info: - /T q=40 s=0 info: + /C q=10 s=0 info: + /C q=20 s=0 info: + /C q=30 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=10 s=0 info: + /C q=20 s=0 info: + /N q=30 s=0 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + /T q=40 s=1 info: + /T q=10 s=1 info: + /T q=20 s=1 info: + /T q=30 s=1 info: + /N q=40 s=1 info: + /N q=40 s=1 list: pos=-1 #bases: 33 #indels: 0 filtered: {+ ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + /C q=10 s=0, + /C q=20 s=0, + /C q=30 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=10 s=0, + /C q=20 s=0, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + /T q=40 s=1, + /T q=10 s=1, + /T q=20 s=1, + /T q=30 s=1, + /N q=40 s=1, + /N q=40 s=1} Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 1/1 ..T Loading test-data/fdr-mode/file1.vcf Loading test-data/fdr-mode/file2.vcf Loading test-data/fdr-mode/file3.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file1.vcf Combining test-data/fdr-mode/file2.vcf Combining test-data/fdr-mode/file3.vcf Loading test-data/fdr-mode/file-B-1.vcf Loading test-data/fdr-mode/file-B-2.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file-B-1.vcf Combining test-data/fdr-mode/file-B-2.vcf Loading test-data/fdr-mode/file-B-1.vcf Loading test-data/fdr-mode/file-B-2.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file-B-1.vcf Combining test-data/fdr-mode/file-B-2.vcf Loading test-data/fdr-mode/file1.vcf Loading test-data/fdr-mode/file2.vcf Loading test-data/fdr-mode/file3.vcf Combining test-data/fdr-mode/file1.vcf Combining test-data/fdr-mode/file2.vcf Combining test-data/fdr-mode/file3.vcf Scanning target file.. Target file had 1 entries. Wrote 1 target ids to alignment header. Setting quality threshold to 0.05 Total logical entries written: 2 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 0 Number of queries: 3 Number of targets: 3 Removed by quality filter: 0 Not best score: 1 Number of alignments written: 2 query_index: 0 target_index: 0 position: 14977972 score: 780.0 matching_reverse_strand: false multiplicity: 1 number_of_mismatches: 1 number_of_indels: 0 query_length: 142 query_aligned_length: 134 target_aligned_length: 134 sequence_variations { to: "T" from: "A" position: 6 to_quality: "/" read_index: 14 } fragment_index: 0 query_index_occurrences: 2 ambiguity: 1 Processing test-data/sample-qual-scores/30reads.fa Processed 0 read entries. Min quality score: 2147483647 Max quality score: -2147483648 Avg quality score: 0 Probable quality encoding scheme: fasta Processing test-data/sample-qual-scores/30reads.fq Processed 30 read entries. Min quality score: 69 Max quality score: 98 Avg quality score: 94 Probable quality encoding scheme: Illumina/Solexa TTC[27]->CGT[27] / qual=1:2:3 A[15]->G[20] / qual=20 A[15]->G[20] / qual=20 Setting quality threshold to 0.02 11:37:15.397 WARN MessageChunksWriter - Using chunk-size=1 11:37:15.402 WARN MessageChunksWriter - Using chunk-size=1 11:37:15.408 WARN MessageChunksWriter - Using chunk-size=1 11:37:15.414 WARN MessageChunksWriter - Using chunk-size=1 [main] WARN org.campagnelab.goby.alignments.BufferedSortingAlignmentWriter - Local sorting strategy failed to restore sort order. The destination has been marked as unsorted. You must sort the output manually to improve compression. 11:37:15.435 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.439 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 Scanned 5 entries 11:37:15.445 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.447 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 Scanned 2 entries 11:37:15.453 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.456 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.462 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.464 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.469 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.472 WARN MessageChunksWriter - Using chunk-size=1000 0 2 11:37:15.480 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.483 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-101 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-101 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-102 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-102 11:37:15.493 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.497 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.506 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.511 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.522 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.540 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 Scanned 5 entries 11:37:15.582 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.654 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.655 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.881 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:15.912 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.913 WARN MessageChunksWriter - Using chunk-size=1000 11:37:15.922 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 3ms; used/avail/free/total/max mem: 240.28M/20.85G/548.25M/788.53M/21.09G 11:37:15.969 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.016 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.021 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 290.59M/20.80G/497.94M/788.53M/21.09G 11:37:16.071 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.093 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.139 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.167 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.169 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.196 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.221 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.223 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item]; used/avail/free/total/max mem: 381.39M/20.71G/407.14M/788.53M/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.325 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.355 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.357 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.381 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.406 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.407 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.409 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. 11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 440.74M/20.65G/347.79M/788.53M/21.09G 11:37:16.418 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. notBestScoreCount=16.6667 % geneAmbiguityCount=33.3333 % found entry: query_index: 0 target_index: 1 position: 2 score: 31.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 0 target_index: 2 position: 3 score: 31.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 4 position: 6 score: 30.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.424 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.450 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.451 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.480 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.508 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.509 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.512 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.513 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 467.37M/20.62G/321.16M/788.53M/21.09G 11:37:16.518 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.520 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.525 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.558 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.559 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.594 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.629 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.630 WARN MessageChunksWriter - Using chunk-size=1000 Finding max number of reads... Found input file with 2 target(s) 11:37:16.633 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. Found input file with 2 target(s) 11:37:16.634 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. ... max number of reads was 10 First pass: determine which reads should be kept in the merged alignment. Scanning align-105 Scanning align-106 Found 40 logical alignment entries. Prepare merged too many hits information. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 492.80M/20.60G/295.73M/788.53M/21.09G Second pass: writing the merged alignment. 11:37:16.642 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.644 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. Wrote 20 skipped: 20 50.000000% too many hits 0.000000% notBestScore: 50.000000% Total logical entries written: 20 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 9 Number of queries: 10 Number of targets: 4 Percent aligned: 100.0 11:37:16.648 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.691 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.692 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.716 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.740 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.742 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.744 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 518.57M/20.57G/269.95M/788.53M/21.09G 11:37:16.749 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1 position: 11 score: 40.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1 position: 12 score: 41.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1 position: 13 score: 42.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1 position: 14 score: 43.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1 position: 15 score: 44.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1 position: 16 score: 45.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1 position: 17 score: 46.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1 position: 18 score: 47.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1 position: 19 score: 48.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1 position: 20 score: 49.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:16.753 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.838 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.843 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.878 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:16.922 WARN MessageChunksWriter - Using chunk-size=1000 11:37:16.935 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 5ms [2 items, 500.00 items/s, 2.00 ms/item]; used/avail/free/total/max mem: 575.80M/20.51G/212.73M/788.53M/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:17.044 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.071 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.072 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.098 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 11:37:17.123 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.135 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.138 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.141 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.167 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 217.33M/20.87G/571.20M/788.53M/21.09G 11:37:17.171 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 11:37:17.186 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 0 target_index: 3999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 3999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 11:37:17.219 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.222 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.225 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.228 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.231 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.233 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.236 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 Processing queryIndex=8 with description '8 perfect start of ref' Processing queryIndex=9 with description '9 perfect start of ref reverse strand' Processing queryIndex=18 with description '18 mismatch at end x1, starting at -1' Processing queryIndex=19 with description '19 mismatch at end x2, starting at -1' Processing queryIndex=20 with description '20 mismatch at end x5, starting at -1' Processing queryIndex=21 with description '21 mismatch at end x1, starting at -2' Processing queryIndex=22 with description '22 mismatch at end x2, starting at -2' Processing queryIndex=23 with description '23 mismatch at end x5, starting at -2' Processing queryIndex=12 with description '12 mismatch at beginning x1, starting at 1, with mutation at 20' Processing queryIndex=13 with description '13 mismatch at beginning x2, starting at 1, with mutation at 20' Processing queryIndex=15 with description '15 mismatch at beginning x1, starting at 2' Processing queryIndex=16 with description '16 mismatch at beginning x2, starting at 2' Processing queryIndex=14 with description '14 mismatch at beginning x5, starting at 1 (pos 4 actually does match), with mutation at 20' Processing queryIndex=17 with description '17 mismatch at beginning x5, starting at 2 (pos 4 actually does match)' Processing queryIndex=0 with description '0 perfect match' Processing queryIndex=1 with description '1 perfect match on reverse strand' Processing queryIndex=2 with description '2 mutation' Processing queryIndex=3 with description '3 mutation on reverse strand' Processing queryIndex=4 with description '4 insertion' Processing queryIndex=6 with description '6 deletion' Processing queryIndex=7 with description '7 deletion on reverse strand' Processing queryIndex=27 with description '27 padding left & right, deletion then mutation' Processing queryIndex=24 with description '24 padding left & right, mutation, deletion' Processing queryIndex=5 with description '5 insertion on reverse strand' Processing queryIndex=10 with description '10 perfect end of ref' Processing queryIndex=11 with description '11 perfect end of ref reverse strand' query_index: 0 target_index: 0 position: 0 query_position: 0 matching_reverse_strand: false query_length: 75 query_aligned_length: 75 target_aligned_length: 75 mapping_quality: 255 pair_flags: 0 fragment_index: 0 ambiguity: 1 query_index: 1 target_index: 0 position: 1 query_position: 0 matching_reverse_strand: false query_length: 75 query_aligned_length: 75 target_aligned_length: 75 mapping_quality: 255 pair_flags: 0 fragment_index: 0 ambiguity: 1 entry:query_index: 0 target_index: 0 position: 5 score: 5.0 matching_reverse_strand: false query_length: 20 query_aligned_length: 20 target_aligned_length: 20 sequence_variations { to: "CTAG" from: "----" position: 10 read_index: 10 } entry:query_index: 1 target_index: 0 position: 5 matching_reverse_strand: false query_length: 20 query_aligned_length: 20 target_aligned_length: 20 sequence_variations { to: "CTAG" from: "----" position: 10 to_quality: "((((" read_index: 10 } entry: query_index: 0 target_index: 0 position: 0 matching_reverse_strand: false query_length: 10 query_aligned_length: 10 sequence_variations { to: "AAA" from: "---" position: 3 read_index: 3 } processing entry on target 0 at position 0 processing entry on target 0 at position 5 processing entry on target 1 at position 0 processing entry on target 1 at position 5 processing entry on target 4 at position 0 processing entry on target 4 at position 5 entry:query_index: 0 target_index: 0 position: 10 matching_reverse_strand: false query_length: 50 query_aligned_length: 50 sequence_variations { to: "AAA" from: "---" position: 20 read_index: 20 } entry:query_index: 1 target_index: 0 position: 1 matching_reverse_strand: false query_length: 50 query_aligned_length: 50 sequence_variations { to: "T" from: "A" position: 20 read_index: 20 } 11:37:17.396 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.400 WARN MessageChunksWriter - Using chunk-size=1000 Total logical entries written: 20000 Total bytes written: 77210 Average bytes/logical entry: 3.8605 Min query index: 0 Max query index: 1999 Number of queries: 2000 Number of targets: 10 11:37:17.493 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.495 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.506 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.509 WARN MessageChunksWriter - Using chunk-size=1000 0 23 11:37:17.525 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.527 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.529 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.537 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.538 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.539 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.547 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.549 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.550 WARN MessageChunksWriter - Using chunk-size=1000 entry.position(): 1 entry.position(): 2 entry.position(): 3 entry.position(): 5 entry.position(): 6 entry.position(): 7 entry.position(): 8 entry.position(): 9 entry.position(): 10 entry.position(): 10 entry.position(): 12 entry.position(): 99 11:37:17.557 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.558 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.559 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.566 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.567 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.569 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.571 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-1.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-1 11:37:17.572 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-2.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-2 11:37:17.573 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-3.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-3 11:37:17.577 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.578 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.579 WARN MessageChunksWriter - Using chunk-size=1000 11:37:17.695 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 0 Total bytes written: 31 Average bytes/logical entry: Infinity Min query index: 2147483647 Max query index: -2147483648 Number of queries: 2 Number of targets: 0 97 11:37:17.703 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.709 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.712 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 11:37:17.715 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 read =CTCCAGAACTGTAAGATAATAAGTTGGTGTTGTTTT expected =TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT recons. ref=TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT read =TTTCCCACATTTCCCATCACCACTACTACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =TTTCCCAAATTTCACATCACTACTACACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =TAAAACCTAAAAAAAAAAAAAAACCCC expected =TAAAA--TAAAAAAAAAAAAAAACCCC recons. ref=TAAAA--TAAAAAAAAAAAAAAACCCC read =TTTTGATGAAGTCTCTGTGTCCTGGGGCATCAATGATGGTCACA expected =TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA recons. ref=TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA read =TTTCCCAAATTTCACATCACTACACTACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTATCTTTTT expected =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT recons. ref=CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT Total logical entries written: 1 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 45 field CHROM value: 0 field POS value: 145497099 field ID value: . field REF value: A field ALT value: G field QUAL value: 17.1 field FILTER value: . field INFO[DP] value: 2 field INFO[DP4] value: 0,0,2,0 field INFO[MQ] value: 25 field INFO[FQ] value: -30.8 field INFO[AF1] value: 0.9999 field INFO[CI95] value: 0.5,1 field INFO[PV4] value: field INFO[INDEL] value: INDEL field INFO[PC2] value: 3,3 field INFO[PCHI2] value: 0.752 field INFO[QCHI2] value: 1 field INFO[RP] value: field FORMAT[GT] value: field FORMAT[GQ] value: field FORMAT[GL] value: field FORMAT[DP] value: field FORMAT[SP] value: field FORMAT[PL] value: field results/IPBKRNW/IPBKRNW-replicate.bam[GT] value: 1/1 field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] value: 42 field results/IPBKRNW/IPBKRNW-replicate.bam[GL] value: field results/IPBKRNW/IPBKRNW-replicate.bam[DP] value: field results/IPBKRNW/IPBKRNW-replicate.bam[SP] value: field results/IPBKRNW/IPBKRNW-replicate.bam[PL] value: 25,3,0 field results/IPBKRNW/IPBKRNW-sorted.bam[GT] value: 1/1 field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] value: 42 field results/IPBKRNW/IPBKRNW-sorted.bam[GL] value: field results/IPBKRNW/IPBKRNW-sorted.bam[DP] value: field results/IPBKRNW/IPBKRNW-sorted.bam[SP] value: field results/IPBKRNW/IPBKRNW-sorted.bam[PL] value: 25,3,0 field CHROM gfi:0 value: 0 field POS gfi:1 value: 145497099 field ID gfi:2 value: . field REF gfi:3 value: A field ALT gfi:4 value: G field QUAL gfi:5 value: 17.1 field FILTER gfi:6 value: . field FORMAT[GT] gfi:7 value: field FORMAT[GQ] gfi:8 value: field FORMAT[GL] gfi:9 value: field FORMAT[DP] gfi:10 value: field FORMAT[SP] gfi:11 value: field FORMAT[PL] gfi:12 value: field results/IPBKRNW/IPBKRNW-replicate.bam[GT] gfi:13 value: 1/1 field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] gfi:14 value: 11 field results/IPBKRNW/IPBKRNW-replicate.bam[GL] gfi:15 value: field results/IPBKRNW/IPBKRNW-replicate.bam[DP] gfi:16 value: field results/IPBKRNW/IPBKRNW-replicate.bam[SP] gfi:17 value: field results/IPBKRNW/IPBKRNW-replicate.bam[PL] gfi:18 value: 015,4,0 field results/IPBKRNW/IPBKRNW-sorted.bam[GT] gfi:19 value: 1/1 field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] gfi:20 value: 42 field results/IPBKRNW/IPBKRNW-sorted.bam[GL] gfi:21 value: field results/IPBKRNW/IPBKRNW-sorted.bam[DP] gfi:22 value: field results/IPBKRNW/IPBKRNW-sorted.bam[SP] gfi:23 value: field results/IPBKRNW/IPBKRNW-sorted.bam[PL] gfi:24 value: 25,3,0 [ {N:15} {///////////00//0010} {N:15} {00101111001101100101111101111111/0/} |Encoded in 80 bits [ {N:15} {11111111111001100101100011111001011110011011001011111011111111} {0} {1} {1} {1} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->29 {N:15} {00101111001101100101111101111111101110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->74decoding: 0 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 1 decoding: 2 decoding: 3 decoding: 4 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 1 [ {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {0} {1} {0} {0} {1} {1} {1} {0} {0} {0} {1} {0} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {1} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {0} {1} |Encoded in 72 bits [ {00110011001100100011001001110001010010001101010110100101101001} {0} {0}decoding: 0 {1} {0}decoding: 4 {0} {0}decoding: 4 {0} {0}decoding: 4 {0}decoding: 4 {0}decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 decoding: 4 {0} {0} {0} {0} {0}decoding: 1 {0} {0} {0} {0}decoding: 2 {0} {0} {0} {0} {0}decoding: 3 decoding: 4 {0} {0} {0} {0}decoding: 3 {0} {0} {0}decoding: 1 {0} {0} {0} {0}decoding: 2 {0} {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0} {0} {0}decoding: 3 {0} {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0}decoding: 1 [ {N:2} {0010} {N:5} {011111} {N:5} {/0/00///01} {N:3} {//0/0/} {N:15} {///////////00//0010} |Encoded in 80 bits [ {N:2} {00101111010111111111011010011101111011110101110001111111111111} {1} {1} {1} {0} {0} {1} {1} | ->10 {N:5} {01111111110110100111011110111101011100011111111111111110011001} {0} {1} {1} {0} {0} {0} {0} {0} {0} | ->22 {N:5} {10100111011110111101011100011111111111111110011001011000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->38 {N:3} {11010111000111111111111111100110010110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->50 {N:15} {11111111111001100101100000000000000000000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->79decoding: 0 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 1 decoding: 2 decoding: 3 decoding: 4 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 1 Total logical entries written: 4 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 1 Max query index: 1 Number of queries: 1 Number of targets: 2 Total logical entries written: 4 Total bytes written: 62 Average bytes/logical entry: 15.5 Min query index: 1 Max query index: 1 Number of queries: 1 Number of targets: 2 Annotations loaded Annotations loaded Annotations loaded Annotations loaded Annotations loaded count perbase{0=>0, 13=>0, 11=>2, 3=>2, 5=>3} count keys [0, 3, 5, 11, 13] -1 0.0 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 overlapping count 3, 4 0.0 overlapping count 15, 17 0.0 overlapping count 9, 18 2.0 overlapping count 3, 8 2.0 overlapping count 11, 12 0.0 overlapping count 9, 10 1.0 overlapping count 8, 9 0.0 overlapping count 8, 8 0.0 overlapping count 5, 6 0.0 overlapping count 3, 3 0.0 overlapping count 3, 12 5.0 overlapping count -1, 2 0.0 overlapping count 0, 45 6.0 overlapping count 13, 15 0.0 -1 0.0 0 0.0 1 0.0 2 0.0 3 2.0 4 2.0 5 3.0 6 3.0 7 3.0 8 3.0 9 3.0 10 3.0 11 2.0 12 2.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 overlapping count 3, 4 2.0 overlapping count 2, 3 2.0 overlapping count 3, 8 4.0 overlapping count 11, 12 2.0 overlapping count 9, 10 3.0 overlapping count 8, 9 4.0 overlapping count 8, 8 3.0 overlapping count 5, 6 3.0 overlapping count 3, 3 2.0 overlapping count 3, 12 5.0 overlapping count -1, 2 0.0 overlapping count 0, 45 6.0 overlapping count 13, 15 1.0 [main] WARN org.campagnelab.goby.algorithmic.algorithm.EquivalentIndelRegionCalculator - Cannot determine sequence at position 600000000 of reference-index 2 appending (count=0,length=1) appending (count=4,length=3) appending (count=1,length=3) appending (count=0,length=2) appending (count=3,length=1) appending (count=1,length=1) appending (count=0,length=1) appending (count=4,length=3) appending (count=0,length=5) appending (count=3,length=1) appending (count=0,length=2) appending (count=2,length=1) appending (count=0,length=2) appending (count=3,length=1) appending (count=2,length=1) appending (count=0,length=1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=6 count=1 (0,1) loading transition for reader[0] position=1 length=3 count=3 (0,1)(1,4) loading transition for reader[0] position=4 length=2 count=0 (0,1)(1,4)(4,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 (0,0) loading transition for reader[0] position=1 length=1 count=1 (0,0)(1,1) loading transition for reader[0] position=2 length=4 count=0 (0,0)(1,1)(2,0) loading transition for reader[1] position=4 length=10 count=1 (0,0)(1,1)(2,0)(4,1) loading transition for reader[0] position=6 length=2 count=1 (0,0)(1,1)(2,0)(4,1)(6,2) loading transition for reader[0] position=8 length=1 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1) loading transition for reader[0] position=9 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) loading transition for reader[0] position=10 length=2 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) loading transition for reader[0] position=12 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) loading transition for reader[0] position=13 length=3 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) loading transition for reader[0] position=16 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 loading transition for reader[0] position=1 length=1 count=1 loading transition for reader[0] position=2 length=4 count=0 loading transition for reader[1] position=4 length=10 count=1 loading transition for reader[0] position=6 length=2 count=1 loading transition for reader[0] position=8 length=1 count=0 loading transition for reader[0] position=9 length=1 count=1 loading transition for reader[0] position=10 length=2 count=0 loading transition for reader[0] position=12 length=1 count=1 loading transition for reader[0] position=13 length=3 count=0 loading transition for reader[0] position=16 length=1 count=1 loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=6 count=1 (0,1) loading transition for reader[0] position=1 length=3 count=3 (0,1)(1,4) loading transition for reader[0] position=4 length=2 count=0 (0,1)(1,4)(4,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 (0,0) loading transition for reader[0] position=1 length=1 count=1 (0,0)(1,1) loading transition for reader[0] position=2 length=4 count=0 (0,0)(1,1)(2,0) loading transition for reader[1] position=4 length=10 count=1 (0,0)(1,1)(2,0)(4,1) loading transition for reader[0] position=6 length=2 count=1 (0,0)(1,1)(2,0)(4,1)(6,2) loading transition for reader[0] position=8 length=1 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1) loading transition for reader[0] position=9 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) loading transition for reader[0] position=10 length=2 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) loading transition for reader[0] position=12 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) loading transition for reader[0] position=13 length=3 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) loading transition for reader[0] position=16 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 loading transition for reader[0] position=1 length=1 count=1 loading transition for reader[0] position=2 length=4 count=0 loading transition for reader[1] position=4 length=10 count=1 loading transition for reader[0] position=6 length=2 count=1 loading transition for reader[0] position=8 length=1 count=0 loading transition for reader[0] position=9 length=1 count=1 loading transition for reader[0] position=10 length=2 count=0 loading transition for reader[0] position=12 length=1 count=1 loading transition for reader[0] position=13 length=3 count=0 loading transition for reader[0] position=16 length=1 count=1 loading transition for reader[0] position=0 length=1 count=0 (0,0) loading transition for reader[0] position=1 length=3 count=1 (0,0)(1,1) Appending count: 39901 length: 10 Appending count: 17289 length: 6 Appending count: 37817 length: 1 Appending count: 33709 length: 6 Appending count: 44089 length: 2 Appending count: 28866 length: 3 Appending count: 31179 length: 1 Appending count: 5042 length: 9 Appending count: 38546 length: 7 Appending count: 40217 length: 4 Appending count: 27078 length: 6 Appending count: 26550 length: 1 Appending count: 36152 length: 1 Appending count: 17051 length: 7 Appending count: 34867 length: 10 Appending count: 47667 length: 10 Appending count: 43469 length: 9 Appending count: 5683 length: 3 Appending count: 41404 length: 4 Appending count: 14249 length: 9 Appending count: 32710 length: 8 Appending count: 2641 length: 6 Appending count: 1505 length: 1 Appending count: 343 length: 8 Appending count: 40906 length: 6 Appending count: 42278 length: 6 Appending count: 30993 length: 2 Appending count: 31983 length: 6 Appending count: 17856 length: 6 Appending count: 40661 length: 3 position= 0 count= 39901 position= 1 count= 39901 position= 2 count= 39901 position= 3 count= 39901 position= 4 count= 39901 position= 5 count= 39901 position= 6 count= 39901 position= 7 count= 39901 position= 8 count= 39901 position= 9 count= 39901 position= 10 count= 17289 position= 11 count= 17289 position= 12 count= 17289 position= 13 count= 17289 position= 14 count= 17289 position= 15 count= 17289 position= 16 count= 37817 position= 17 count= 33709 position= 18 count= 33709 position= 19 count= 33709 position= 20 count= 33709 position= 21 count= 33709 position= 22 count= 33709 position= 23 count= 44089 position= 24 count= 44089 position= 25 count= 28866 position= 26 count= 28866 position= 27 count= 28866 position= 28 count= 31179 position= 29 count= 5042 position= 30 count= 5042 position= 31 count= 5042 position= 32 count= 5042 position= 33 count= 5042 position= 34 count= 5042 position= 35 count= 5042 position= 36 count= 5042 position= 37 count= 5042 position= 38 count= 38546 position= 39 count= 38546 position= 40 count= 38546 position= 41 count= 38546 position= 42 count= 38546 position= 43 count= 38546 position= 44 count= 38546 position= 45 count= 40217 position= 46 count= 40217 position= 47 count= 40217 position= 48 count= 40217 position= 49 count= 27078 position= 50 count= 27078 position= 51 count= 27078 position= 52 count= 27078 position= 53 count= 27078 position= 54 count= 27078 position= 55 count= 26550 position= 56 count= 36152 position= 57 count= 17051 position= 58 count= 17051 position= 59 count= 17051 position= 60 count= 17051 position= 61 count= 17051 position= 62 count= 17051 position= 63 count= 17051 position= 64 count= 34867 position= 65 count= 34867 position= 66 count= 34867 position= 67 count= 34867 position= 68 count= 34867 position= 69 count= 34867 position= 70 count= 34867 position= 71 count= 34867 position= 72 count= 34867 position= 73 count= 34867 position= 74 count= 47667 position= 75 count= 47667 position= 76 count= 47667 position= 77 count= 47667 position= 78 count= 47667 position= 79 count= 47667 position= 80 count= 47667 position= 81 count= 47667 position= 82 count= 47667 position= 83 count= 47667 position= 84 count= 43469 position= 85 count= 43469 position= 86 count= 43469 position= 87 count= 43469 position= 88 count= 43469 position= 89 count= 43469 position= 90 count= 43469 position= 91 count= 43469 position= 92 count= 43469 position= 93 count= 5683 position= 94 count= 5683 position= 95 count= 5683 position= 96 count= 41404 position= 97 count= 41404 position= 98 count= 41404 position= 99 count= 41404 position= 100 count= 14249 position= 101 count= 14249 position= 102 count= 14249 position= 103 count= 14249 position= 104 count= 14249 position= 105 count= 14249 position= 106 count= 14249 position= 107 count= 14249 position= 108 count= 14249 position= 109 count= 32710 position= 110 count= 32710 position= 111 count= 32710 position= 112 count= 32710 position= 113 count= 32710 position= 114 count= 32710 position= 115 count= 32710 position= 116 count= 32710 position= 117 count= 2641 position= 118 count= 2641 position= 119 count= 2641 position= 120 count= 2641 position= 121 count= 2641 position= 122 count= 2641 position= 123 count= 1505 position= 124 count= 343 position= 125 count= 343 position= 126 count= 343 position= 127 count= 343 position= 128 count= 343 position= 129 count= 343 position= 130 count= 343 position= 131 count= 343 position= 132 count= 40906 position= 133 count= 40906 position= 134 count= 40906 position= 135 count= 40906 position= 136 count= 40906 position= 137 count= 40906 position= 138 count= 42278 position= 139 count= 42278 position= 140 count= 42278 position= 141 count= 42278 position= 142 count= 42278 position= 143 count= 42278 position= 144 count= 30993 position= 145 count= 30993 position= 146 count= 31983 position= 147 count= 31983 position= 148 count= 31983 position= 149 count= 31983 position= 150 count= 31983 position= 151 count= 31983 position= 152 count= 17856 position= 153 count= 17856 position= 154 count= 17856 position= 155 count= 17856 position= 156 count= 17856 position= 157 count= 17856 position= 158 count= 40661 position= 159 count= 40661 position= 160 count= 40661 appending (count=10,length=4) appending (count=1,length=0) appending (count=2,length=8) Hello appending (count=10,length=4) 11:38:08.185 WARN WiggleWindow - Not writing 101 7 11:38:08.186 WARN WiggleWindow - Not writing 111 7 11:38:08.186 WARN WiggleWindow - Not writing 131 8 11:38:08.186 WARN WiggleWindow - Not writing 141 8 11:38:08.186 WARN WiggleWindow - Not writing 151 8 peak : start :5 count :13 length :100010 peak : start :100020 count :10 length :1 original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGTGT original G----GTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: G original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT mapped: GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT original G--GTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGT qPhred=1 qPhred=2 qPhred=3 qPhred=4 qPhred=5 qPhred=6 qPhred=7 qPhred=8 qPhred=9 qPhred=10 qPhred=11 qPhred=12 qPhred=13 qPhred=14 qPhred=15 qPhred=16 qPhred=17 qPhred=18 qPhred=19 qPhred=20 qPhred=21 qPhred=22 qPhred=23 qPhred=24 qPhred=25 qPhred=26 qPhred=27 qPhred=28 qPhred=29 qPhred=30 qPhred=31 qPhred=32 qPhred=33 qPhred=34 qPhred=35 qPhred=36 qPhred=37 qPhred=38 qPhred=39 qPhred=40 qPhred=41 qPhred=42 qPhred=43 qPhred=44 qPhred=45 qPhred=46 qPhred=47 qPhred=48 qPhred=49 qPhred=50 qPhred=51 qPhred=52 qPhred=53 qPhred=54 qPhred=55 qPhred=56 qPhred=57 qPhred=58 qPhred=59 qPhred=60 qPhred=61 0 AAC 3 ACC 6 ATC 9 AGC 12 AAC 15 ACC 18 ATC 21 AGC 24 AAC 27 ACC 30 ATC 33 AGC 36 AAC 39 ACC 42 ATC 45 AGC 48 AAC 51 ACC 54 ATC 57 AGC 60 AAC 63 ACC 66 ATC 69 AGC 72 AAC 75 ACC 78 ATC 81 AGC11:38:16.444 WARN MessageChunksWriter - Using chunk-size=9 11:38:16.448 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 660 Average bytes/logical entry: 16.923077 Number of bits/base 3.6590436 11:38:16.450 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 685 Average bytes/logical entry: 17.564102 Number of bits/base 3.797644 11:38:16.453 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 660 Average bytes/logical entry: 16.923077 Number of bits/base 3.6590436 >1 NNTGAATGAGACCTA [WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46, Time elapsed: 79.464 s - in TestSuite [INFO] [INFO] Results: [INFO] [WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46 [INFO] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.064 s] [INFO] Goby I/O ........................................... SUCCESS [398 d 06:23 h] [INFO] Goby Full Distribution ............................. SUCCESS [01:57 min] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 02:06 min [INFO] Finished at: 2026-09-08T11:38:48-12:00 [INFO] ------------------------------------------------------------------------ make[1]: Leaving directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Ddebian.package=libgoby-io-java -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo -Dinstall.to.usj=true org.debian.maven:debian-maven-plugin:2.6:install OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-framework --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/pom.xml.save with options: [INFO] --keep-pom-version --package=libgoby-io-java --has-package-version [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-io --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/pom.xml.save with options: [INFO] --keep-pom-version --package=libgoby-io-java [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] Install jar for goby-io into /usr/share/java [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-distribution --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/pom.xml.save with options: [INFO] --keep-pom-version --package=goby-java [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] Install jar for goby-distribution into /usr/share/java [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.866 s] [INFO] Goby I/O ........................................... SUCCESS [ 0.134 s] [INFO] Goby Full Distribution ............................. SUCCESS [ 0.149 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 1.596 s [INFO] Finished at: 2026-09-08T11:38:53-12:00 [INFO] ------------------------------------------------------------------------ mh_resolve_dependencies --non-interactive --offline --build -plibgoby-io-java --base-directory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 --non-explore Analysing pom.xml... Analysing goby-distribution/pom.xml... Checking the parent dependency in the sub project goby-distribution/pom.xml Analysing goby-io/pom.xml... Checking the parent dependency in the sub project goby-io/pom.xml > dpkg --search /usr/share/maven-repo/org/rosuda/REngine/REngine/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/rosuda/REngine/REngine Sep 08, 2026 11:39:05 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/pom.xml: Dependency not found org.rosuda.REngine:REngine:jar:debian > dpkg --search /usr/share/maven-repo/org/itadaki/bzip2/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/itadaki/bzip2 Sep 08, 2026 11:39:10 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/pom.xml: Dependency not found org.itadaki:bzip2:jar:debian ERROR: goby-distribution/pom.xml: dependency is not packaged in the Maven repository for Debian: org.rosuda.REngine:REngine:debian goby-io/pom.xml: dependency is not packaged in the Maven repository for Debian: org.itadaki:bzip2:debian -------- Some problems were found in this project, exiting... mh_unpatchpoms -plibgoby-io-java dh_install jh_installjavadoc dh_installdocs dh_installchangelogs dh_installman dh_lintian dh_perl dh_link jh_installlibs jh_classpath jh_manifest jh_exec jh_depends dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_installdeb dh_gencontrol dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${maven:Depends} used, but is not defined dpkg-gencontrol: warning: Recommends field of package goby-java: substitution variable ${maven:OptionalDepends} used, but is not defined dpkg-gencontrol: warning: package goby-java: substitution variable ${java:Depends} unused, but is defined dpkg-gencontrol: warning: Depends field of package libgoby-io-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${java:Depends} unused, but is defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${maven:CompileDepends} unused, but is defined dh_md5sums dh_builddeb dpkg-deb: building package 'libgoby-io-java' in '../libgoby-io-java_3.3.1+dfsg2-11_all.deb'. dpkg-deb: building package 'goby-java' in '../goby-java_3.3.1+dfsg2-11_all.deb'. dpkg-genbuildinfo --build=binary -O../libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo dpkg-genchanges --build=binary -O../libgoby-java_3.3.1+dfsg2-11_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/148101 and its subdirectories I: Current time: Tue Sep 8 11:39:41 -12 2026 I: pbuilder-time-stamp: 1788910781 Wed Aug 6 17:16:43 UTC 2025 I: 1st build successful. Starting 2nd build on remote node ionos11-amd64.debian.net. Wed Aug 6 17:16:43 UTC 2025 I: Preparing to do remote build '2' on ionos11-amd64.debian.net. Wed Aug 6 17:16:43 UTC 2025 - checking /var/lib/jenkins/offline_nodes if ionos11-amd64.debian.net is marked as down. Wed Aug 6 17:16:43 UTC 2025 - checking via ssh if ionos11-amd64.debian.net is up. removed '/tmp/read-only-fs-test-1R385O' ==================================================================================== Wed Aug 6 17:16:44 UTC 2025 - running /srv/jenkins/bin/reproducible_build.sh (for job /srv/jenkins/bin/reproducible_build.sh) on ionos11-amd64, called using "2 libgoby-java trixie /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC 3.3.1+dfsg2-11" as arguments. Wed Aug 6 17:16:44 UTC 2025 - actually running "reproducible_build.sh" (md5sum 44ec6a3142940d5e9a7ab76543d96029) as "/tmp/jenkins-script-TCFZLsBx" $ git clone https://salsa.debian.org/qa/jenkins.debian.net.git ; more CONTRIBUTING Wed Aug 6 17:16:44 UTC 2025 I: Downloading source for trixie/libgoby-java=3.3.1+dfsg2-11 Reading package lists... NOTICE: 'libgoby-java' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/libgoby-java.git Please use: git clone https://salsa.debian.org/med-team/libgoby-java.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 41.6 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (dsc) [3008 B] Get:2 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (tar) [41.6 MB] Get:3 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (diff) [29.4 kB] Fetched 41.6 MB in 1s (76.7 MB/s) Download complete and in download only mode Reading package lists... NOTICE: 'libgoby-java' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/libgoby-java.git Please use: git clone https://salsa.debian.org/med-team/libgoby-java.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 41.6 MB of source archives. Get:1 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (dsc) [3008 B] Get:2 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (tar) [41.6 MB] Get:3 http://deb.debian.org/debian trixie/main libgoby-java 3.3.1+dfsg2-11 (diff) [29.4 kB] Fetched 41.6 MB in 1s (76.7 MB/s) Download complete and in download only mode ============================================================================= Re-Building libgoby-java in trixie on amd64 on ionos11-amd64 now. Date: Wed Aug 6 17:16:45 UTC 2025 Date UTC: Wed Aug 6 17:16:45 UTC 2025 ============================================================================= ++ mktemp -t pbuilderrc_XXXX --tmpdir=/srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC + local TMPCFG=/srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/pbuilderrc_if16 + case ${ARCH} in + case $ARCH in + locale=et_EE + language=et + case "${SUITE}" in + reproducible_buildflags=+all + extra_deb_build_options= + case "${SRCPACKAGE}" in + cat + echo BUILDDIR=/build/reproducible-path + '[' libgoby-java = debian-installer -o libgoby-java = debian-installer-netboot-images ']' + pbuilder_options=() + local pbuilder_options + DEBBUILDOPTS=-b + BINARYTARGET= + '[' libgoby-java = u-boot ']' + case "${SRCPACKAGE}" in + PBUILDERTIMEOUT=24 + local PRESULT=0 + sudo timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/pbuilderrc_if16 --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b2 --logfile b2/build.log libgoby-java_3.3.1+dfsg2-11.dsc W: /root/.pbuilderrc does not exist I: Logging to b2/build.log I: pbuilder: network access will be disabled during build I: Current time: Thu Aug 7 07:16:45 +14 2025 I: pbuilder-time-stamp: 1754500605 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [libgoby-java_3.3.1+dfsg2-11.dsc] I: copying [./libgoby-java_3.3.1+dfsg2.orig.tar.xz] I: copying [./libgoby-java_3.3.1+dfsg2-11.debian.tar.xz] I: Extracting source dpkg-source: warning: cannot verify inline signature for ./libgoby-java_3.3.1+dfsg2-11.dsc: no acceptable signature found dpkg-source: info: extracting libgoby-java in libgoby-java-3.3.1+dfsg2 dpkg-source: info: unpacking libgoby-java_3.3.1+dfsg2.orig.tar.xz dpkg-source: info: unpacking libgoby-java_3.3.1+dfsg2-11.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying protoc.patch dpkg-source: info: applying adding_dependencies.patch dpkg-source: info: applying using_jbzip2.patch dpkg-source: info: applying adapting_to_old_fastutil.patch dpkg-source: info: applying using_GeneratedMessageV3.patch dpkg-source: info: applying using_commons-cli.patch dpkg-source: info: applying using_correct_SamReader_api.patch dpkg-source: info: applying inclusions_in_SplitTranscriptsMode.patch dpkg-source: info: applying catch_IOException_LineIterator.patch dpkg-source: info: applying computing_fisher_pvalue_hypergeom.patch dpkg-source: info: applying exclude_not_runnable_tests.patch dpkg-source: info: applying goby_script.patch dpkg-source: info: applying path_of_goby_jar_for_Debian.patch dpkg-source: info: applying jaxb_dependency.patch dpkg-source: info: applying using_pcre2.patch dpkg-source: info: applying omit_test_failing_randomly.patch dpkg-source: info: applying adding_opens_arg_for_tests.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D01_modify_environment starting debug: Running on ionos11-amd64. I: Changing host+domainname to test build reproducibility I: Adding a custom variable just for the fun of it... I: Changing /bin/sh to bash '/bin/sh' -> '/bin/bash' lrwxrwxrwx 1 root root 9 Aug 6 17:17 /bin/sh -> /bin/bash I: Setting pbuilder2's login shell to /bin/bash I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D01_modify_environment finished I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D02_print_environment starting I: set BASH=/bin/sh BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath BASH_ALIASES=() BASH_ARGC=() BASH_ARGV=() BASH_CMDS=() BASH_LINENO=([0]="12" [1]="0") BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu") BASH_VERSION='5.2.37(1)-release' BUILDDIR=/build/reproducible-path BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' BUILDUSERNAME=pbuilder2 BUILD_ARCH=amd64 DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=40 ' DIRSTACK=() DISTRIBUTION=trixie EUID=0 FUNCNAME=([0]="Echo" [1]="main") GROUPS=() HOME=/root HOSTNAME=i-capture-the-hostname HOSTTYPE=x86_64 HOST_ARCH=amd64 IFS=' ' INVOCATION_ID=7baf82eafc8c4f0690099c3e8ee829f5 LANG=C LANGUAGE=et_EE:et LC_ALL=C MACHTYPE=x86_64-pc-linux-gnu MAIL=/var/mail/root OPTERR=1 OPTIND=1 OSTYPE=linux-gnu PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path PBCURRENTCOMMANDLINEOPERATION=build PBUILDER_OPERATION=build PBUILDER_PKGDATADIR=/usr/share/pbuilder PBUILDER_PKGLIBDIR=/usr/lib/pbuilder PBUILDER_SYSCONFDIR=/etc PIPESTATUS=([0]="0") POSIXLY_CORRECT=y PPID=902668 PS4='+ ' PWD=/ SHELL=/bin/bash SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix SHLVL=3 SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/pbuilderrc_if16 --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b2 --logfile b2/build.log libgoby-java_3.3.1+dfsg2-11.dsc' SUDO_GID=111 SUDO_UID=106 SUDO_USER=jenkins TERM=unknown TZ=/usr/share/zoneinfo/Etc/GMT-14 UID=0 USER=root _='I: set' http_proxy=http://46.16.76.132:3128 I: uname -a Linux i-capture-the-hostname 6.1.0-37-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.140-1 (2025-05-22) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 May 12 19:25 /bin -> usr/bin I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), maven-debian-helper, javahelper, default-jdk, ant, ant-contrib, libjbzip2-java, libcommons-collections3-java, libcommons-configuration-java, libcommons-exec-java, libcommons-io-java, libcommons-lang-java, libcommons-logging-java, libcommons-math-java, libcommons-cli-java, libdistlib-java, liblog4j1.2-java, libexec-maven-plugin-java, libjaxb-api-java, libmaven-assembly-plugin-java, libmaven-antrun-plugin-java, libbuild-helper-maven-plugin-java, libmaven-dependency-plugin-java, libmaven-source-plugin-java, libmaven-javadoc-plugin-java, libprotobuf-java, libhtsjdk-java, libfastutil-java, protobuf-compiler, libjsap-java, libdsiutils-java, libicb-utils-java, libreflections-java, libpj-java, libprotobuf-dev, pkgconf, r-cran-rjava, libeasymock-java, junit4, testng, libpicard-java dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19851 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on maven-debian-helper; however: Package maven-debian-helper is not installed. pbuilder-satisfydepends-dummy depends on javahelper; however: Package javahelper is not installed. pbuilder-satisfydepends-dummy depends on default-jdk; however: Package default-jdk is not installed. pbuilder-satisfydepends-dummy depends on ant; however: Package ant is not installed. pbuilder-satisfydepends-dummy depends on ant-contrib; however: Package ant-contrib is not installed. pbuilder-satisfydepends-dummy depends on libjbzip2-java; however: Package libjbzip2-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-collections3-java; however: Package libcommons-collections3-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-configuration-java; however: Package libcommons-configuration-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-exec-java; however: Package libcommons-exec-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-io-java; however: Package libcommons-io-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-lang-java; however: Package libcommons-lang-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-logging-java; however: Package libcommons-logging-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-math-java; however: Package libcommons-math-java is not installed. pbuilder-satisfydepends-dummy depends on libcommons-cli-java; however: Package libcommons-cli-java is not installed. pbuilder-satisfydepends-dummy depends on libdistlib-java; however: Package libdistlib-java is not installed. pbuilder-satisfydepends-dummy depends on liblog4j1.2-java; however: Package liblog4j1.2-java is not installed. pbuilder-satisfydepends-dummy depends on libexec-maven-plugin-java; however: Package libexec-maven-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libjaxb-api-java; however: Package libjaxb-api-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-assembly-plugin-java; however: Package libmaven-assembly-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-antrun-plugin-java; however: Package libmaven-antrun-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libbuild-helper-maven-plugin-java; however: Package libbuild-helper-maven-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-dependency-plugin-java; however: Package libmaven-dependency-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-source-plugin-java; however: Package libmaven-source-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libmaven-javadoc-plugin-java; however: Package libmaven-javadoc-plugin-java is not installed. pbuilder-satisfydepends-dummy depends on libprotobuf-java; however: Package libprotobuf-java is not installed. pbuilder-satisfydepends-dummy depends on libhtsjdk-java; however: Package libhtsjdk-java is not installed. pbuilder-satisfydepends-dummy depends on libfastutil-java; however: Package libfastutil-java is not installed. pbuilder-satisfydepends-dummy depends on protobuf-compiler; however: Package protobuf-compiler is not installed. pbuilder-satisfydepends-dummy depends on libjsap-java; however: Package libjsap-java is not installed. pbuilder-satisfydepends-dummy depends on libdsiutils-java; however: Package libdsiutils-java is not installed. pbuilder-satisfydepends-dummy depends on libicb-utils-java; however: Package libicb-utils-java is not installed. pbuilder-satisfydepends-dummy depends on libreflections-java; however: Package libreflections-java is not installed. pbuilder-satisfydepends-dummy depends on libpj-java; however: Package libpj-java is not installed. pbuilder-satisfydepends-dummy depends on libprotobuf-dev; however: Package libprotobuf-dev is not installed. pbuilder-satisfydepends-dummy depends on pkgconf; however: Package pkgconf is not installed. pbuilder-satisfydepends-dummy depends on r-cran-rjava; however: Package r-cran-rjava is not installed. pbuilder-satisfydepends-dummy depends on libeasymock-java; however: Package libeasymock-java is not installed. pbuilder-satisfydepends-dummy depends on junit4; however: Package junit4 is not installed. pbuilder-satisfydepends-dummy depends on testng; however: Package testng is not installed. pbuilder-satisfydepends-dummy depends on libpicard-java; however: Package libpicard-java is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: adwaita-icon-theme{a} ant{a} ant-contrib{a} at-spi2-common{a} autoconf{a} automake{a} autopoint{a} autotools-dev{a} binfmt-support{a} bsdextrautils{a} ca-certificates{a} ca-certificates-java{a} dbus{a} dbus-bin{a} dbus-daemon{a} dbus-session-bus-common{a} dbus-system-bus-common{a} dbus-user-session{a} dconf-gsettings-backend{a} dconf-service{a} dctrl-tools{a} debhelper{a} default-jdk{a} default-jdk-headless{a} default-jre{a} default-jre-headless{a} devscripts{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} fastjar{a} file{a} fontconfig{a} fontconfig-config{a} fonts-dejavu-core{a} fonts-dejavu-mono{a} gettext{a} gettext-base{a} gpg{a} gpg-agent{a} gpgconf{a} gpgv{a} groff-base{a} gtk-update-icon-cache{a} hicolor-icon-theme{a} intltool-debian{a} jarwrapper{a} java-common{a} javahelper{a} junit4{a} junit5{a} libactivation-java{a} libaopalliance-java{a} libapache-pom-java{a} libapiguardian-java{a} libapparmor1{a} libarchive-zip-perl{a} libasm-java{a} libasound2-data{a} libasound2t64{a} libassuan9{a} libatinject-jsr330-api-java{a} libatk-bridge2.0-0t64{a} libatk1.0-0t64{a} libatspi2.0-0t64{a} libavahi-client3{a} libavahi-common-data{a} libavahi-common3{a} libb-hooks-op-check-perl{a} libbarclay-java{a} libblas3{a} libbrotli1{a} libbsh-java{a} libbuild-helper-maven-plugin-java{a} libbyte-buddy-java{a} libcairo-gobject2{a} libcairo2{a} libcdi-api-java{a} libclass-method-modifiers-perl{a} libclass-xsaccessor-perl{a} libclone-perl{a} libcloudproviders0{a} libcolord2{a} libcolt-free-java{a} libcom-err2{a} libcommons-beanutils-java{a} libcommons-cli-java{a} libcommons-codec-java{a} libcommons-collections3-java{a} libcommons-collections4-java{a} libcommons-compress-java{a} libcommons-configuration-java{a} libcommons-digester-java{a} libcommons-exec-java{a} libcommons-io-java{a} libcommons-jexl2-java{a} libcommons-lang-java{a} libcommons-lang3-java{a} libcommons-logging-java{a} libcommons-math-java{a} libcommons-math3-java{a} libcommons-parent-java{a} libcommons-text-java{a} libcommons-validator-java{a} libcups2t64{a} libcurl4t64{a} libdatrie1{a} libdbus-1-3{a} libdconf1{a} libdebhelper-perl{a} libdeflate0{a} libdevel-callchecker-perl{a} libdistlib-java{a} libdom4j-java{a} libdoxia-core-java{a} libdoxia-java{a} libdoxia-sitetools-java{a} libdrm-amdgpu1{a} libdrm-common{a} libdrm-intel1{a} libdrm2{a} libdsiutils-java{a} libdynaloader-functions-perl{a} libeasymock-java{a} libedit2{a} libel-api-java{a} libelf1t64{a} libencode-locale-perl{a} libepoxy0{a} liberror-prone-java{a} libexec-maven-plugin-java{a} libexpat1{a} libezmorph-java{a} libfastutil-java{a} libffi8{a} libfile-dirlist-perl{a} libfile-homedir-perl{a} libfile-listing-perl{a} libfile-stripnondeterminism-perl{a} libfile-touch-perl{a} libfile-which-perl{a} libfontconfig1{a} libfreemarker-java{a} libfreetype6{a} libfribidi0{a} libgatk-native-bindings-java{a} libgbm1{a} libgcrypt20{a} libgdk-pixbuf-2.0-0{a} libgdk-pixbuf2.0-common{a} libgeronimo-annotation-1.3-spec-java{a} libgeronimo-interceptor-3.0-spec-java{a} libgfortran5{a} libgif7{a} libgkl-java{a} libgl1{a} libgl1-mesa-dri{a} libglib2.0-0t64{a} libglvnd0{a} libglx-mesa0{a} libglx0{a} libgnutls30t64{a} libgoogle-gson-java{a} libgpg-error0{a} libgraphite2-3{a} libgssapi-krb5-2{a} libgtk-3-0t64{a} libgtk-3-common{a} libguava-java{a} libguice-java{a} libhamcrest-java{a} libharfbuzz0b{a} libhtml-parser-perl{a} libhtml-tagset-perl{a} libhtml-tree-perl{a} libhtsjdk-java{a} libhttp-cookies-perl{a} libhttp-date-perl{a} libhttp-message-perl{a} libhttp-negotiate-perl{a} libhttpclient-java{a} libhttpcore-java{a} libicb-utils-java{a} libice6{a} libicu4j-java{a} libicu76{a} libidn2-0{a} libimport-into-perl{a} libio-html-perl{a} libio-socket-ssl-perl{a} libjansi-java{a} libjavassist-java{a} libjaxb-api-java{a} libjaxen-java{a} libjbig0{a} libjboss-logging-java{a} libjboss-vfs-java{a} libjbzip2-java{a} libjcommander-java{a} libjetty9-java{a} libjoptsimple-java{a} libjpeg62-turbo{a} libjsap-java{a} libjson-java{a} libjsoup-java{a} libjsp-api-java{a} libjsr305-java{a} libjtidy-java{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libksba8{a} liblapack3{a} liblcms2-2{a} libldap2{a} liblerc4{a} liblightcouch-java{a} libllvm19{a} liblog4j1.2-java{a} liblog4j2-java{a} liblogback-java{a} liblwp-mediatypes-perl{a} liblwp-protocol-https-perl{a} libmagic-mgc{a} libmagic1t64{a} libmaven-antrun-plugin-java{a} libmaven-archiver-java{a} libmaven-artifact-transfer-java{a} libmaven-assembly-plugin-java{a} libmaven-clean-plugin-java{a} libmaven-common-artifact-filters-java{a} libmaven-compiler-plugin-java{a} libmaven-dependency-analyzer-java{a} libmaven-dependency-plugin-java{a} libmaven-dependency-tree-java{a} libmaven-file-management-java{a} libmaven-filtering-java{a} libmaven-invoker-java{a} libmaven-jar-plugin-java{a} libmaven-javadoc-plugin-java{a} libmaven-parent-java{a} libmaven-plugin-tools-java{a} libmaven-reporting-api-java{a} libmaven-reporting-exec-java{a} libmaven-reporting-impl-java{a} libmaven-resolver-java{a} libmaven-resources-plugin-java{a} libmaven-shared-incremental-java{a} libmaven-shared-io-java{a} libmaven-shared-utils-java{a} libmaven-site-plugin-java{a} libmaven-source-plugin-java{a} libmaven3-core-java{a} libmbedcrypto16{a} libmbedtls21{a} libmbedx509-7{a} libmodule-runtime-perl{a} libmongodb-java{a} libmoo-perl{a} libncbi-ngs3{a} libncbi-vdb3{a} libnet-http-perl{a} libnet-ssleay-perl{a} libnghttp2-14{a} libnghttp3-9{a} libngs-java{a} libngs-jni{a} libnpth0t64{a} libnspr4{a} libnss3{a} libobjenesis-java{a} libopentest4j-java{a} libopentest4j-reporting-java{a} liboro-java{a} libp11-kit0{a} libpam-systemd{a} libpango-1.0-0{a} libpangocairo-1.0-0{a} libpangoft2-1.0-0{a} libpaper-utils{a} libpaper2{a} libparams-classify-perl{a} libpciaccess0{a} libpcsclite1{a} libpicard-java{a} libpicocli-java{a} libpipeline1{a} libpixman-1-0{a} libpj-java{a} libpkgconf3{a} libplexus-ant-factory-java{a} libplexus-archiver-java{a} libplexus-bsh-factory-java{a} libplexus-build-api-java{a} libplexus-cipher-java{a} libplexus-classworlds-java{a} libplexus-compiler-java{a} libplexus-component-annotations-java{a} libplexus-container-default-java{a} libplexus-container-default1.5-java{a} libplexus-i18n-java{a} libplexus-interactivity-api-java{a} libplexus-interpolation-java{a} libplexus-io-java{a} libplexus-languages-java{a} libplexus-sec-dispatcher-java{a} libplexus-utils2-java{a} libplexus-velocity-java{a} libplexus-xml-java{a} libpng16-16t64{a} libproc2-0{a} libprotobuf-dev{a} libprotobuf-java{a} libprotobuf-lite32t64{a} libprotobuf32t64{a} libprotoc32t64{a} libpsl5t64{a} libpython3-stdlib{a} libpython3.13-minimal{a} libpython3.13-stdlib{a} libqdox2-java{a} libreadline8t64{a} libreflections-java{a} librhino-java{a} librole-tiny-perl{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libsensors-config{a} libsensors5{a} libservlet-api-java{a} libsharpyuv0{a} libsisu-inject-java{a} libsisu-plexus-java{a} libslf4j-java{a} libsm6{a} libsnappy-java{a} libsnappy-jni{a} libsnappy1v5{a} libssh2-1t64{a} libsub-quote-perl{a} libsurefire-java{a} libsystemd-shared{a} libtasn1-6{a} libtcl8.6{a} libtext-charwidth-perl{a} libtext-wrapi18n-perl{a} libthai-data{a} libthai0{a} libtiff6{a} libtimedate-perl{a} libtirpc-common{a} libtirpc3t64{a} libtk8.6{a} libtool{a} libtry-tiny-perl{a} libuchardet0{a} libunistring5{a} libunivocity-parsers-java{a} liburi-perl{a} libvelocity-tools-java{a} libvulkan1{a} libwagon-file-java{a} libwagon-http-java{a} libwagon-provider-api-java{a} libwayland-client0{a} libwayland-cursor0{a} libwayland-egl1{a} libwayland-server0{a} libwebp7{a} libwebsocket-api-java{a} libwww-perl{a} libwww-robotrules-perl{a} libx11-6{a} libx11-data{a} libx11-xcb1{a} libxau6{a} libxbean-reflect-java{a} libxcb-dri3-0{a} libxcb-glx0{a} libxcb-present0{a} libxcb-randr0{a} libxcb-render0{a} libxcb-shm0{a} libxcb-sync1{a} libxcb-xfixes0{a} libxcb1{a} libxcomposite1{a} libxcursor1{a} libxdamage1{a} libxdmcp6{a} libxerces2-java{a} libxext6{a} libxfixes3{a} libxft2{a} libxi6{a} libxinerama1{a} libxkbcommon0{a} libxml-commons-external-java{a} libxml-commons-resolver1.1-java{a} libxml2{a} libxml2-utils{a} libxom-java{a} libxpp3-java{a} libxrandr2{a} libxrender1{a} libxshmfence1{a} libxss1{a} libxstream-java{a} libxt6t64{a} libxtst6{a} libxxf86vm1{a} libxz-java{a} libz3-4{a} m4{a} man-db{a} maven{a} maven-debian-helper{a} maven-repo-helper{a} media-types{a} mesa-libgallium{a} ncbi-vdb-data{a} netbase{a} openjdk-21-jdk{a} openjdk-21-jdk-headless{a} openjdk-21-jre{a} openjdk-21-jre-headless{a} openssl{a} patchutils{a} perl-openssl-defaults{a} pinentry-curses{a} pkgconf{a} pkgconf-bin{a} po-debconf{a} procps{a} protobuf-compiler{a} python3{a} python3-minimal{a} python3.13{a} python3.13-minimal{a} r-base-core{a} r-cran-rjava{a} readline-common{a} sensible-utils{a} sgml-base{a} shared-mime-info{a} sopv-gpgv{a} systemd{a} systemd-sysv{a} testng{a} tzdata{a} ucf{a} unzip{a} velocity{a} wdiff{a} x11-common{a} xdg-utils{a} xkb-data{a} zip{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: alsa-topology-conf alsa-ucm-conf ant-optional at-spi2-core chrony curl debian-keyring debian-tag2upload-keyring dput dput-ng dupload equivs fonts-dejavu-extra gnupg krb5-locales libarchive-cpio-perl libatk-wrapper-java-jni libdata-dump-perl libdistro-info-perl libfile-mimeinfo-perl libgdk-pixbuf2.0-bin libgit-wrapper-perl libgitlab-api-v4-perl libgkl-jni libglib2.0-data libgpg-error-l10n libgtk-3-bin libhtml-form-perl libhtml-format-perl libhttp-daemon-perl libio-compress-brotli-perl libjline3-java libjson-perl libkmod2 libldap-common liblist-compare-perl libltdl-dev libmail-sendmail-perl libmailtools-perl libnamespace-clean-perl libnet-dbus-perl libnss-systemd librsvg2-common libsasl2-modules libsoap-lite-perl libstring-shellquote-perl libx11-protocol-perl libxstring-perl libxt-dev libyaml-snake-java licensecheck lintian linux-sysctl-defaults lynx lzip mesa-vulkan-drivers ntpsec openntpd pristine-tar psmisc publicsuffix python3-apt python3-argcomplete python3-debian python3-magic python3-requests python3-unidiff python3-xdg r-base-dev r-doc-html r-recommended sopv-doc strace systemd-cryptsetup systemd-timesyncd wget x11-utils x11-xserver-utils xdg-user-dirs 0 packages upgraded, 461 newly installed, 0 to remove and 0 not upgraded. Need to get 386 MB of archives. After unpacking 1012 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main amd64 libsystemd-shared amd64 257.7-1 [2151 kB] Get: 2 http://deb.debian.org/debian trixie/main amd64 libapparmor1 amd64 4.1.0-1 [43.7 kB] Get: 3 http://deb.debian.org/debian trixie/main amd64 systemd amd64 257.7-1 [3099 kB] Get: 4 http://deb.debian.org/debian trixie/main amd64 systemd-sysv amd64 257.7-1 [64.2 kB] Get: 5 http://deb.debian.org/debian trixie/main amd64 libdbus-1-3 amd64 1.16.2-2 [178 kB] Get: 6 http://deb.debian.org/debian trixie/main amd64 dbus-bin amd64 1.16.2-2 [80.0 kB] Get: 7 http://deb.debian.org/debian trixie/main amd64 dbus-session-bus-common all 1.16.2-2 [52.3 kB] Get: 8 http://deb.debian.org/debian trixie/main amd64 libexpat1 amd64 2.7.1-2 [108 kB] Get: 9 http://deb.debian.org/debian trixie/main amd64 dbus-daemon amd64 1.16.2-2 [159 kB] Get: 10 http://deb.debian.org/debian trixie/main amd64 dbus-system-bus-common all 1.16.2-2 [53.5 kB] Get: 11 http://deb.debian.org/debian trixie/main amd64 dbus amd64 1.16.2-2 [71.6 kB] Get: 12 http://deb.debian.org/debian trixie/main amd64 libpipeline1 amd64 1.5.8-1 [42.0 kB] Get: 13 http://deb.debian.org/debian trixie/main amd64 binfmt-support amd64 2.2.2-7 [64.3 kB] Get: 14 http://deb.debian.org/debian trixie/main amd64 libpython3.13-minimal amd64 3.13.5-2 [862 kB] Get: 15 http://deb.debian.org/debian trixie/main amd64 python3.13-minimal amd64 3.13.5-2 [2224 kB] Get: 16 http://deb.debian.org/debian trixie/main amd64 python3-minimal amd64 3.13.5-1 [27.2 kB] Get: 17 http://deb.debian.org/debian trixie/main amd64 media-types all 13.0.0 [29.3 kB] Get: 18 http://deb.debian.org/debian trixie/main amd64 netbase all 6.5 [12.4 kB] Get: 19 http://deb.debian.org/debian trixie/main amd64 tzdata all 2025b-4 [260 kB] Get: 20 http://deb.debian.org/debian trixie/main amd64 libffi8 amd64 3.4.8-2 [24.1 kB] Get: 21 http://deb.debian.org/debian trixie/main amd64 readline-common all 8.2-6 [69.4 kB] Get: 22 http://deb.debian.org/debian trixie/main amd64 libreadline8t64 amd64 8.2-6 [169 kB] Get: 23 http://deb.debian.org/debian trixie/main amd64 libpython3.13-stdlib amd64 3.13.5-2 [1956 kB] Get: 24 http://deb.debian.org/debian trixie/main amd64 python3.13 amd64 3.13.5-2 [757 kB] Get: 25 http://deb.debian.org/debian trixie/main amd64 libpython3-stdlib amd64 3.13.5-1 [10.2 kB] Get: 26 http://deb.debian.org/debian trixie/main amd64 python3 amd64 3.13.5-1 [28.2 kB] Get: 27 http://deb.debian.org/debian trixie/main amd64 libproc2-0 amd64 2:4.0.4-9 [65.6 kB] Get: 28 http://deb.debian.org/debian trixie/main amd64 procps amd64 2:4.0.4-9 [882 kB] Get: 29 http://deb.debian.org/debian trixie/main amd64 sensible-utils all 0.0.25 [25.0 kB] Get: 30 http://deb.debian.org/debian trixie/main amd64 openssl amd64 3.5.1-1 [1494 kB] Get: 31 http://deb.debian.org/debian trixie/main amd64 ca-certificates all 20250419 [162 kB] Get: 32 http://deb.debian.org/debian trixie/main amd64 libmagic-mgc amd64 1:5.46-5 [338 kB] Get: 33 http://deb.debian.org/debian trixie/main amd64 libmagic1t64 amd64 1:5.46-5 [109 kB] Get: 34 http://deb.debian.org/debian trixie/main amd64 file amd64 1:5.46-5 [43.6 kB] Get: 35 http://deb.debian.org/debian trixie/main amd64 gettext-base amd64 0.23.1-2 [243 kB] Get: 36 http://deb.debian.org/debian trixie/main amd64 libuchardet0 amd64 0.0.8-1+b2 [68.9 kB] Get: 37 http://deb.debian.org/debian trixie/main amd64 groff-base amd64 1.23.0-9 [1187 kB] Get: 38 http://deb.debian.org/debian trixie/main amd64 libpam-systemd amd64 257.7-1 [297 kB] Get: 39 http://deb.debian.org/debian trixie/main amd64 bsdextrautils amd64 2.41-5 [94.6 kB] Get: 40 http://deb.debian.org/debian trixie/main amd64 man-db amd64 2.13.1-1 [1469 kB] Get: 41 http://deb.debian.org/debian trixie/main amd64 libtext-charwidth-perl amd64 0.04-11+b4 [9476 B] Get: 42 http://deb.debian.org/debian trixie/main amd64 libtext-wrapi18n-perl all 0.06-10 [8808 B] Get: 43 http://deb.debian.org/debian trixie/main amd64 ucf all 3.0052 [43.3 kB] Get: 44 http://deb.debian.org/debian trixie/main amd64 libgdk-pixbuf2.0-common all 2.42.12+dfsg-4 [311 kB] Get: 45 http://deb.debian.org/debian trixie/main amd64 libglib2.0-0t64 amd64 2.84.3-1 [1515 kB] Get: 46 http://deb.debian.org/debian trixie/main amd64 libxml2 amd64 2.12.7+dfsg+really2.9.14-2.1 [698 kB] Get: 47 http://deb.debian.org/debian trixie/main amd64 shared-mime-info amd64 2.4-5+b2 [760 kB] Get: 48 http://deb.debian.org/debian trixie/main amd64 libjpeg62-turbo amd64 1:2.1.5-4 [168 kB] Get: 49 http://deb.debian.org/debian trixie/main amd64 libpng16-16t64 amd64 1.6.48-1 [282 kB] Get: 50 http://deb.debian.org/debian trixie/main amd64 libdeflate0 amd64 1.23-2 [47.3 kB] Get: 51 http://deb.debian.org/debian trixie/main amd64 libjbig0 amd64 2.1-6.1+b2 [32.1 kB] Get: 52 http://deb.debian.org/debian trixie/main amd64 liblerc4 amd64 4.0.0+ds-5 [183 kB] Get: 53 http://deb.debian.org/debian trixie/main amd64 libsharpyuv0 amd64 1.5.0-0.1 [116 kB] Get: 54 http://deb.debian.org/debian trixie/main amd64 libwebp7 amd64 1.5.0-0.1 [318 kB] Get: 55 http://deb.debian.org/debian trixie/main amd64 libtiff6 amd64 4.7.0-3 [346 kB] Get: 56 http://deb.debian.org/debian trixie/main amd64 libgdk-pixbuf-2.0-0 amd64 2.42.12+dfsg-4 [141 kB] Get: 57 http://deb.debian.org/debian trixie/main amd64 gtk-update-icon-cache amd64 4.18.6+ds-2 [52.7 kB] Get: 58 http://deb.debian.org/debian trixie/main amd64 hicolor-icon-theme all 0.18-2 [11.8 kB] Get: 59 http://deb.debian.org/debian trixie/main amd64 adwaita-icon-theme all 48.1-1 [504 kB] Get: 60 http://deb.debian.org/debian trixie/main amd64 ca-certificates-java all 20240118 [11.6 kB] Get: 61 http://deb.debian.org/debian trixie/main amd64 java-common all 0.76 [6776 B] Get: 62 http://deb.debian.org/debian trixie/main amd64 liblcms2-2 amd64 2.16-2 [160 kB] Get: 63 http://deb.debian.org/debian trixie/main amd64 libnspr4 amd64 2:4.36-1 [110 kB] Get: 64 http://deb.debian.org/debian trixie/main amd64 libnss3 amd64 2:3.110-1 [1393 kB] Get: 65 http://deb.debian.org/debian trixie/main amd64 libpcsclite1 amd64 2.3.3-1 [55.2 kB] Get: 66 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jre-headless amd64 21.0.8+9-1 [41.8 MB] Get: 67 http://deb.debian.org/debian trixie/main amd64 default-jre-headless amd64 2:1.21-76 [3192 B] Get: 68 http://deb.debian.org/debian trixie/main amd64 ant all 1.10.15-1 [2163 kB] Get: 69 http://deb.debian.org/debian trixie/main amd64 ant-contrib all 1.0~b3+svn177-12 [262 kB] Get: 70 http://deb.debian.org/debian trixie/main amd64 at-spi2-common all 2.56.2-1 [171 kB] Get: 71 http://deb.debian.org/debian trixie/main amd64 m4 amd64 1.4.19-8 [294 kB] Get: 72 http://deb.debian.org/debian trixie/main amd64 autoconf all 2.72-3.1 [494 kB] Get: 73 http://deb.debian.org/debian trixie/main amd64 autotools-dev all 20240727.1 [60.2 kB] Get: 74 http://deb.debian.org/debian trixie/main amd64 automake all 1:1.17-4 [862 kB] Get: 75 http://deb.debian.org/debian trixie/main amd64 autopoint all 0.23.1-2 [770 kB] Get: 76 http://deb.debian.org/debian trixie/main amd64 dbus-user-session amd64 1.16.2-2 [52.1 kB] Get: 77 http://deb.debian.org/debian trixie/main amd64 libdconf1 amd64 0.40.0-5 [41.8 kB] Get: 78 http://deb.debian.org/debian trixie/main amd64 dconf-service amd64 0.40.0-5 [32.4 kB] Get: 79 http://deb.debian.org/debian trixie/main amd64 dconf-gsettings-backend amd64 0.40.0-5 [28.6 kB] Get: 80 http://deb.debian.org/debian trixie/main amd64 dctrl-tools amd64 2.24-3+b1 [104 kB] Get: 81 http://deb.debian.org/debian trixie/main amd64 libdebhelper-perl all 13.24.2 [90.9 kB] Get: 82 http://deb.debian.org/debian trixie/main amd64 libtool all 2.5.4-4 [539 kB] Get: 83 http://deb.debian.org/debian trixie/main amd64 dh-autoreconf all 20 [17.1 kB] Get: 84 http://deb.debian.org/debian trixie/main amd64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 85 http://deb.debian.org/debian trixie/main amd64 libfile-stripnondeterminism-perl all 1.14.1-2 [19.7 kB] Get: 86 http://deb.debian.org/debian trixie/main amd64 dh-strip-nondeterminism all 1.14.1-2 [8620 B] Get: 87 http://deb.debian.org/debian trixie/main amd64 libelf1t64 amd64 0.192-4 [189 kB] Get: 88 http://deb.debian.org/debian trixie/main amd64 dwz amd64 0.15-1+b1 [110 kB] Get: 89 http://deb.debian.org/debian trixie/main amd64 libunistring5 amd64 1.3-2 [477 kB] Get: 90 http://deb.debian.org/debian trixie/main amd64 gettext amd64 0.23.1-2 [1680 kB] Get: 91 http://deb.debian.org/debian trixie/main amd64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 92 http://deb.debian.org/debian trixie/main amd64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 93 http://deb.debian.org/debian trixie/main amd64 debhelper all 13.24.2 [919 kB] Get: 94 http://deb.debian.org/debian trixie/main amd64 libatk1.0-0t64 amd64 2.56.2-1 [51.9 kB] Get: 95 http://deb.debian.org/debian trixie/main amd64 libxau6 amd64 1:1.0.11-1 [20.4 kB] Get: 96 http://deb.debian.org/debian trixie/main amd64 libxdmcp6 amd64 1:1.1.5-1 [27.8 kB] Get: 97 http://deb.debian.org/debian trixie/main amd64 libxcb1 amd64 1.17.0-2+b1 [144 kB] Get: 98 http://deb.debian.org/debian trixie/main amd64 libx11-data all 2:1.8.12-1 [343 kB] Get: 99 http://deb.debian.org/debian trixie/main amd64 libx11-6 amd64 2:1.8.12-1 [815 kB] Get: 100 http://deb.debian.org/debian trixie/main amd64 libxext6 amd64 2:1.3.4-1+b3 [50.4 kB] Get: 101 http://deb.debian.org/debian trixie/main amd64 libxi6 amd64 2:1.8.2-1 [78.9 kB] Get: 102 http://deb.debian.org/debian trixie/main amd64 libatspi2.0-0t64 amd64 2.56.2-1 [80.7 kB] Get: 103 http://deb.debian.org/debian trixie/main amd64 libatk-bridge2.0-0t64 amd64 2.56.2-1 [68.5 kB] Get: 104 http://deb.debian.org/debian trixie/main amd64 libbrotli1 amd64 1.1.0-2+b7 [307 kB] Get: 105 http://deb.debian.org/debian trixie/main amd64 libfreetype6 amd64 2.13.3+dfsg-1 [452 kB] Get: 106 http://deb.debian.org/debian trixie/main amd64 fonts-dejavu-mono all 2.37-8 [489 kB] Get: 107 http://deb.debian.org/debian trixie/main amd64 fonts-dejavu-core all 2.37-8 [840 kB] Get: 108 http://deb.debian.org/debian trixie/main amd64 fontconfig-config amd64 2.15.0-2.3 [318 kB] Get: 109 http://deb.debian.org/debian trixie/main amd64 libfontconfig1 amd64 2.15.0-2.3 [392 kB] Get: 110 http://deb.debian.org/debian trixie/main amd64 libpixman-1-0 amd64 0.44.0-3 [248 kB] Get: 111 http://deb.debian.org/debian trixie/main amd64 libxcb-render0 amd64 1.17.0-2+b1 [115 kB] Get: 112 http://deb.debian.org/debian trixie/main amd64 libxcb-shm0 amd64 1.17.0-2+b1 [105 kB] Get: 113 http://deb.debian.org/debian trixie/main amd64 libxrender1 amd64 1:0.9.12-1 [27.9 kB] Get: 114 http://deb.debian.org/debian trixie/main amd64 libcairo2 amd64 1.18.4-1+b1 [538 kB] Get: 115 http://deb.debian.org/debian trixie/main amd64 libcairo-gobject2 amd64 1.18.4-1+b1 [130 kB] Get: 116 http://deb.debian.org/debian trixie/main amd64 libcloudproviders0 amd64 0.3.6-2 [29.2 kB] Get: 117 http://deb.debian.org/debian trixie/main amd64 libcolord2 amd64 1.4.7-3 [139 kB] Get: 118 http://deb.debian.org/debian trixie/main amd64 libavahi-common-data amd64 0.8-16 [112 kB] Get: 119 http://deb.debian.org/debian trixie/main amd64 libavahi-common3 amd64 0.8-16 [44.2 kB] Get: 120 http://deb.debian.org/debian trixie/main amd64 libavahi-client3 amd64 0.8-16 [48.4 kB] Get: 121 http://deb.debian.org/debian trixie/main amd64 libidn2-0 amd64 2.3.8-2 [109 kB] Get: 122 http://deb.debian.org/debian trixie/main amd64 libp11-kit0 amd64 0.25.5-3 [425 kB] Get: 123 http://deb.debian.org/debian trixie/main amd64 libtasn1-6 amd64 4.20.0-2 [49.9 kB] Get: 124 http://deb.debian.org/debian trixie/main amd64 libgnutls30t64 amd64 3.8.9-3 [1465 kB] Get: 125 http://deb.debian.org/debian trixie/main amd64 libkrb5support0 amd64 1.21.3-5 [33.0 kB] Get: 126 http://deb.debian.org/debian trixie/main amd64 libcom-err2 amd64 1.47.2-3+b3 [25.0 kB] Get: 127 http://deb.debian.org/debian trixie/main amd64 libk5crypto3 amd64 1.21.3-5 [81.5 kB] Get: 128 http://deb.debian.org/debian trixie/main amd64 libkeyutils1 amd64 1.6.3-6 [9456 B] Get: 129 http://deb.debian.org/debian trixie/main amd64 libkrb5-3 amd64 1.21.3-5 [326 kB] Get: 130 http://deb.debian.org/debian trixie/main amd64 libgssapi-krb5-2 amd64 1.21.3-5 [138 kB] Get: 131 http://deb.debian.org/debian trixie/main amd64 libcups2t64 amd64 2.4.10-3 [251 kB] Get: 132 http://deb.debian.org/debian trixie/main amd64 libepoxy0 amd64 1.5.10-2 [193 kB] Get: 133 http://deb.debian.org/debian trixie/main amd64 libfribidi0 amd64 1.0.16-1 [26.5 kB] Get: 134 http://deb.debian.org/debian trixie/main amd64 libgraphite2-3 amd64 1.3.14-2+b1 [75.4 kB] Get: 135 http://deb.debian.org/debian trixie/main amd64 libharfbuzz0b amd64 10.2.0-1+b1 [479 kB] Get: 136 http://deb.debian.org/debian trixie/main amd64 fontconfig amd64 2.15.0-2.3 [463 kB] Get: 137 http://deb.debian.org/debian trixie/main amd64 libthai-data all 0.1.29-2 [168 kB] Get: 138 http://deb.debian.org/debian trixie/main amd64 libdatrie1 amd64 0.2.13-3+b1 [38.1 kB] Get: 139 http://deb.debian.org/debian trixie/main amd64 libthai0 amd64 0.1.29-2+b1 [49.4 kB] Get: 140 http://deb.debian.org/debian trixie/main amd64 libpango-1.0-0 amd64 1.56.3-1 [226 kB] Get: 141 http://deb.debian.org/debian trixie/main amd64 libpangoft2-1.0-0 amd64 1.56.3-1 [55.6 kB] Get: 142 http://deb.debian.org/debian trixie/main amd64 libpangocairo-1.0-0 amd64 1.56.3-1 [35.7 kB] Get: 143 http://deb.debian.org/debian trixie/main amd64 libwayland-client0 amd64 1.23.1-3 [26.8 kB] Get: 144 http://deb.debian.org/debian trixie/main amd64 libwayland-cursor0 amd64 1.23.1-3 [11.9 kB] Get: 145 http://deb.debian.org/debian trixie/main amd64 libwayland-egl1 amd64 1.23.1-3 [5860 B] Get: 146 http://deb.debian.org/debian trixie/main amd64 libxcomposite1 amd64 1:0.4.6-1 [16.3 kB] Get: 147 http://deb.debian.org/debian trixie/main amd64 libxfixes3 amd64 1:6.0.0-2+b4 [20.2 kB] Get: 148 http://deb.debian.org/debian trixie/main amd64 libxcursor1 amd64 1:1.2.3-1 [39.7 kB] Get: 149 http://deb.debian.org/debian trixie/main amd64 libxdamage1 amd64 1:1.1.6-1+b2 [15.5 kB] Get: 150 http://deb.debian.org/debian trixie/main amd64 libxinerama1 amd64 2:1.1.4-3+b4 [16.0 kB] Get: 151 http://deb.debian.org/debian trixie/main amd64 xkb-data all 2.42-1 [790 kB] Get: 152 http://deb.debian.org/debian trixie/main amd64 libxkbcommon0 amd64 1.7.0-2 [113 kB] Get: 153 http://deb.debian.org/debian trixie/main amd64 libxrandr2 amd64 2:1.5.4-1+b3 [36.3 kB] Get: 154 http://deb.debian.org/debian trixie/main amd64 libgtk-3-common all 3.24.49-3 [4908 kB] Get: 155 http://deb.debian.org/debian trixie/main amd64 libgtk-3-0t64 amd64 3.24.49-3 [2769 kB] Get: 156 http://deb.debian.org/debian trixie/main amd64 libglvnd0 amd64 1.7.0-1+b2 [52.0 kB] Get: 157 http://deb.debian.org/debian trixie/main amd64 libdrm-common all 2.4.124-2 [8288 B] Get: 158 http://deb.debian.org/debian trixie/main amd64 libdrm2 amd64 2.4.124-2 [39.0 kB] Get: 159 http://deb.debian.org/debian trixie/main amd64 libx11-xcb1 amd64 2:1.8.12-1 [247 kB] Get: 160 http://deb.debian.org/debian trixie/main amd64 libxcb-dri3-0 amd64 1.17.0-2+b1 [107 kB] Get: 161 http://deb.debian.org/debian trixie/main amd64 libxcb-glx0 amd64 1.17.0-2+b1 [122 kB] Get: 162 http://deb.debian.org/debian trixie/main amd64 libxcb-present0 amd64 1.17.0-2+b1 [106 kB] Get: 163 http://deb.debian.org/debian trixie/main amd64 libxcb-xfixes0 amd64 1.17.0-2+b1 [109 kB] Get: 164 http://deb.debian.org/debian trixie/main amd64 libxxf86vm1 amd64 1:1.1.4-1+b4 [19.3 kB] Get: 165 http://deb.debian.org/debian trixie/main amd64 libdrm-amdgpu1 amd64 2.4.124-2 [22.6 kB] Get: 166 http://deb.debian.org/debian trixie/main amd64 libpciaccess0 amd64 0.17-3+b3 [51.9 kB] Get: 167 http://deb.debian.org/debian trixie/main amd64 libdrm-intel1 amd64 2.4.124-2 [64.1 kB] Get: 168 http://deb.debian.org/debian trixie/main amd64 libedit2 amd64 3.1-20250104-1 [93.8 kB] Get: 169 http://deb.debian.org/debian trixie/main amd64 libz3-4 amd64 4.13.3-1 [8560 kB] Get: 170 http://deb.debian.org/debian trixie/main amd64 libllvm19 amd64 1:19.1.7-3+b1 [26.0 MB] Get: 171 http://deb.debian.org/debian trixie/main amd64 libsensors-config all 1:3.6.2-2 [16.2 kB] Get: 172 http://deb.debian.org/debian trixie/main amd64 libsensors5 amd64 1:3.6.2-2 [37.5 kB] Get: 173 http://deb.debian.org/debian trixie/main amd64 libxcb-randr0 amd64 1.17.0-2+b1 [117 kB] Get: 174 http://deb.debian.org/debian trixie/main amd64 libxcb-sync1 amd64 1.17.0-2+b1 [109 kB] Get: 175 http://deb.debian.org/debian trixie/main amd64 libxshmfence1 amd64 1.3.3-1 [10.9 kB] Get: 176 http://deb.debian.org/debian trixie/main amd64 mesa-libgallium amd64 25.0.7-2 [9629 kB] Get: 177 http://deb.debian.org/debian trixie/main amd64 libwayland-server0 amd64 1.23.1-3 [34.4 kB] Get: 178 http://deb.debian.org/debian trixie/main amd64 libgbm1 amd64 25.0.7-2 [44.4 kB] Get: 179 http://deb.debian.org/debian trixie/main amd64 libvulkan1 amd64 1.4.309.0-1 [130 kB] Get: 180 http://deb.debian.org/debian trixie/main amd64 libgl1-mesa-dri amd64 25.0.7-2 [46.1 kB] Get: 181 http://deb.debian.org/debian trixie/main amd64 libglx-mesa0 amd64 25.0.7-2 [143 kB] Get: 182 http://deb.debian.org/debian trixie/main amd64 libglx0 amd64 1.7.0-1+b2 [34.9 kB] Get: 183 http://deb.debian.org/debian trixie/main amd64 libgl1 amd64 1.7.0-1+b2 [89.5 kB] Get: 184 http://deb.debian.org/debian trixie/main amd64 libasound2-data all 1.2.14-1 [21.1 kB] Get: 185 http://deb.debian.org/debian trixie/main amd64 libasound2t64 amd64 1.2.14-1 [381 kB] Get: 186 http://deb.debian.org/debian trixie/main amd64 libgif7 amd64 5.2.2-1+b1 [44.2 kB] Get: 187 http://deb.debian.org/debian trixie/main amd64 x11-common all 1:7.7+24 [217 kB] Get: 188 http://deb.debian.org/debian trixie/main amd64 libxtst6 amd64 2:1.2.5-1 [25.8 kB] Get: 189 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jre amd64 21.0.8+9-1 [205 kB] Get: 190 http://deb.debian.org/debian trixie/main amd64 default-jre amd64 2:1.21-76 [1068 B] Get: 191 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jdk-headless amd64 21.0.8+9-1 [82.9 MB] Get: 192 http://deb.debian.org/debian trixie/main amd64 default-jdk-headless amd64 2:1.21-76 [1124 B] Get: 193 http://deb.debian.org/debian trixie/main amd64 openjdk-21-jdk amd64 21.0.8+9-1 [3624 kB] Get: 194 http://deb.debian.org/debian trixie/main amd64 default-jdk amd64 2:1.21-76 [1076 B] Get: 195 http://deb.debian.org/debian trixie/main amd64 libgpg-error0 amd64 1.51-4 [82.1 kB] Get: 196 http://deb.debian.org/debian trixie/main amd64 libassuan9 amd64 3.0.2-2 [61.5 kB] Get: 197 http://deb.debian.org/debian trixie/main amd64 libgcrypt20 amd64 1.11.0-7 [843 kB] Get: 198 http://deb.debian.org/debian trixie/main amd64 gpgconf amd64 2.4.7-21+b3 [129 kB] Get: 199 http://deb.debian.org/debian trixie/main amd64 libksba8 amd64 1.6.7-2+b1 [136 kB] Get: 200 http://deb.debian.org/debian trixie/main amd64 libnpth0t64 amd64 1.8-3 [23.2 kB] Get: 201 http://deb.debian.org/debian trixie/main amd64 gpg amd64 2.4.7-21+b3 [634 kB] Get: 202 http://deb.debian.org/debian trixie/main amd64 pinentry-curses amd64 1.3.1-2 [86.4 kB] Get: 203 http://deb.debian.org/debian trixie/main amd64 gpg-agent amd64 2.4.7-21+b3 [271 kB] Get: 204 http://deb.debian.org/debian trixie/main amd64 libfile-dirlist-perl all 0.05-3 [7600 B] Get: 205 http://deb.debian.org/debian trixie/main amd64 libfile-which-perl all 1.27-2 [15.1 kB] Get: 206 http://deb.debian.org/debian trixie/main amd64 libfile-homedir-perl all 1.006-2 [42.4 kB] Get: 207 http://deb.debian.org/debian trixie/main amd64 libfile-touch-perl all 0.12-2 [8816 B] Get: 208 http://deb.debian.org/debian trixie/main amd64 libclass-method-modifiers-perl all 2.15-1 [18.0 kB] Get: 209 http://deb.debian.org/debian trixie/main amd64 libclass-xsaccessor-perl amd64 1.19-4+b5 [36.1 kB] Get: 210 http://deb.debian.org/debian trixie/main amd64 libb-hooks-op-check-perl amd64 0.22-3+b2 [10.6 kB] Get: 211 http://deb.debian.org/debian trixie/main amd64 libdynaloader-functions-perl all 0.004-2 [12.2 kB] Get: 212 http://deb.debian.org/debian trixie/main amd64 libdevel-callchecker-perl amd64 0.009-2 [15.6 kB] Get: 213 http://deb.debian.org/debian trixie/main amd64 libparams-classify-perl amd64 0.015-2+b4 [22.5 kB] Get: 214 http://deb.debian.org/debian trixie/main amd64 libmodule-runtime-perl all 0.018-1 [17.8 kB] Get: 215 http://deb.debian.org/debian trixie/main amd64 libimport-into-perl all 1.002005-2 [11.3 kB] Get: 216 http://deb.debian.org/debian trixie/main amd64 librole-tiny-perl all 2.002004-1 [21.4 kB] Get: 217 http://deb.debian.org/debian trixie/main amd64 libsub-quote-perl all 2.006008-1 [21.8 kB] Get: 218 http://deb.debian.org/debian trixie/main amd64 libmoo-perl all 2.005005-1 [58.0 kB] Get: 219 http://deb.debian.org/debian trixie/main amd64 libencode-locale-perl all 1.05-3 [12.9 kB] Get: 220 http://deb.debian.org/debian trixie/main amd64 libtimedate-perl all 2.3300-2 [39.3 kB] Get: 221 http://deb.debian.org/debian trixie/main amd64 libhttp-date-perl all 6.06-1 [10.7 kB] Get: 222 http://deb.debian.org/debian trixie/main amd64 libfile-listing-perl all 6.16-1 [12.4 kB] Get: 223 http://deb.debian.org/debian trixie/main amd64 libhtml-tagset-perl all 3.24-1 [14.7 kB] Get: 224 http://deb.debian.org/debian trixie/main amd64 liburi-perl all 5.30-1 [105 kB] Get: 225 http://deb.debian.org/debian trixie/main amd64 libhtml-parser-perl amd64 3.83-1+b2 [99.7 kB] Get: 226 http://deb.debian.org/debian trixie/main amd64 libhtml-tree-perl all 5.07-3 [211 kB] Get: 227 http://deb.debian.org/debian trixie/main amd64 libclone-perl amd64 0.47-1+b1 [13.9 kB] Get: 228 http://deb.debian.org/debian trixie/main amd64 libio-html-perl all 1.004-3 [16.2 kB] Get: 229 http://deb.debian.org/debian trixie/main amd64 liblwp-mediatypes-perl all 6.04-2 [20.2 kB] Get: 230 http://deb.debian.org/debian trixie/main amd64 libhttp-message-perl all 7.00-2 [79.8 kB] Get: 231 http://deb.debian.org/debian trixie/main amd64 libhttp-cookies-perl all 6.11-1 [19.1 kB] Get: 232 http://deb.debian.org/debian trixie/main amd64 libhttp-negotiate-perl all 6.01-2 [13.1 kB] Get: 233 http://deb.debian.org/debian trixie/main amd64 perl-openssl-defaults amd64 7+b2 [6724 B] Get: 234 http://deb.debian.org/debian trixie/main amd64 libnet-ssleay-perl amd64 1.94-3 [339 kB] Get: 235 http://deb.debian.org/debian trixie/main amd64 libio-socket-ssl-perl all 2.089-1 [223 kB] Get: 236 http://deb.debian.org/debian trixie/main amd64 libnet-http-perl all 6.23-1 [23.9 kB] Get: 237 http://deb.debian.org/debian trixie/main amd64 liblwp-protocol-https-perl all 6.14-1 [10.8 kB] Get: 238 http://deb.debian.org/debian trixie/main amd64 libtry-tiny-perl all 0.32-1 [22.9 kB] Get: 239 http://deb.debian.org/debian trixie/main amd64 libwww-robotrules-perl all 6.02-1 [12.9 kB] Get: 240 http://deb.debian.org/debian trixie/main amd64 libwww-perl all 6.78-1 [183 kB] Get: 241 http://deb.debian.org/debian trixie/main amd64 patchutils amd64 0.4.2-1 [77.5 kB] Get: 242 http://deb.debian.org/debian trixie/main amd64 gpgv amd64 2.4.7-21+b3 [241 kB] Get: 243 http://deb.debian.org/debian trixie/main amd64 sopv-gpgv all 0.1.4-1 [11.3 kB] Get: 244 http://deb.debian.org/debian trixie/main amd64 wdiff amd64 1.2.2-9 [122 kB] Get: 245 http://deb.debian.org/debian trixie/main amd64 devscripts all 2.25.15 [1067 kB] Get: 246 http://deb.debian.org/debian trixie/main amd64 fastjar amd64 2:0.98-7 [80.1 kB] Get: 247 http://deb.debian.org/debian trixie/main amd64 jarwrapper all 0.80 [9692 B] Get: 248 http://deb.debian.org/debian trixie/main amd64 javahelper all 0.80 [80.4 kB] Get: 249 http://deb.debian.org/debian trixie/main amd64 libhamcrest-java all 2.2-2 [121 kB] Get: 250 http://deb.debian.org/debian trixie/main amd64 junit4 all 4.13.2-5 [350 kB] Get: 251 http://deb.debian.org/debian trixie/main amd64 libapiguardian-java all 1.1.2-1 [4656 B] Get: 252 http://deb.debian.org/debian trixie/main amd64 libopentest4j-java all 1.2.0-4 [9516 B] Get: 253 http://deb.debian.org/debian trixie/main amd64 libopentest4j-reporting-java all 0.1.0-M1-2 [49.0 kB] Get: 254 http://deb.debian.org/debian trixie/main amd64 libpicocli-java all 4.6.2-2 [390 kB] Get: 255 http://deb.debian.org/debian trixie/main amd64 libunivocity-parsers-java all 2.9.1-1 [397 kB] Get: 256 http://deb.debian.org/debian trixie/main amd64 junit5 all 5.10.3-1 [2459 kB] Get: 257 http://deb.debian.org/debian trixie/main amd64 libactivation-java all 1.2.0-2 [84.7 kB] Get: 258 http://deb.debian.org/debian trixie/main amd64 libaopalliance-java all 20070526-7 [8572 B] Get: 259 http://deb.debian.org/debian trixie/main amd64 libapache-pom-java all 33-2 [5852 B] Get: 260 http://deb.debian.org/debian trixie/main amd64 libasm-java all 9.8-1 [392 kB] Get: 261 http://deb.debian.org/debian trixie/main amd64 libatinject-jsr330-api-java all 1.0+ds1-6 [5112 B] Get: 262 http://deb.debian.org/debian trixie/main amd64 libcommons-parent-java all 56-1 [10.8 kB] Get: 263 http://deb.debian.org/debian trixie/main amd64 libcommons-lang3-java all 3.17.0-1 [641 kB] Get: 264 http://deb.debian.org/debian trixie/main amd64 libfreemarker-java all 2.3.32-2.1 [1525 kB] Get: 265 http://deb.debian.org/debian trixie/main amd64 libgoogle-gson-java all 2.10.1-1 [262 kB] Get: 266 http://deb.debian.org/debian trixie/main amd64 libjoptsimple-java all 5.0.4-7 [73.7 kB] Get: 267 http://deb.debian.org/debian trixie/main amd64 libcommons-codec-java all 1.18.0-1 [304 kB] Get: 268 http://deb.debian.org/debian trixie/main amd64 libcommons-logging-java all 1.3.0-2 [68.6 kB] Get: 269 http://deb.debian.org/debian trixie/main amd64 libhttpcore-java all 4.4.16-1 [636 kB] Get: 270 http://deb.debian.org/debian trixie/main amd64 libhttpclient-java all 4.5.14-1 [1247 kB] Get: 271 http://deb.debian.org/debian trixie/main amd64 liblightcouch-java all 0.2.0-1 [75.0 kB] Get: 272 http://deb.debian.org/debian trixie/main amd64 libmongodb-java all 3.6.3-2 [1901 kB] Get: 273 http://deb.debian.org/debian trixie/main amd64 libslf4j-java all 1.7.32-2 [142 kB] Get: 274 http://deb.debian.org/debian trixie/main amd64 liblog4j2-java all 2.19.0-2 [2310 kB] Get: 275 http://deb.debian.org/debian trixie/main amd64 libbarclay-java all 5.0.0+dfsg-1 [108 kB] Get: 276 http://deb.debian.org/debian trixie/main amd64 libblas3 amd64 3.12.1-4 [160 kB] Get: 277 http://deb.debian.org/debian trixie/main amd64 libbsh-java all 2.0b4-20 [291 kB] Get: 278 http://deb.debian.org/debian trixie/main amd64 libcommons-io-java all 2.19.0-1 [524 kB] Get: 279 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-utils-java all 3.4.2-1 [137 kB] Get: 280 http://deb.debian.org/debian trixie/main amd64 libcommons-cli-java all 1.6.0-1 [60.4 kB] Get: 281 http://deb.debian.org/debian trixie/main amd64 libgeronimo-annotation-1.3-spec-java all 1.3-1 [11.1 kB] Get: 282 http://deb.debian.org/debian trixie/main amd64 liberror-prone-java all 2.18.0-1 [22.5 kB] Get: 283 http://deb.debian.org/debian trixie/main amd64 libjsr305-java all 0.1~+svn49-12 [26.6 kB] Get: 284 http://deb.debian.org/debian trixie/main amd64 libguava-java all 32.0.1-1 [2708 kB] Get: 285 http://deb.debian.org/debian trixie/main amd64 libguice-java all 5.1.0-1 [932 kB] Get: 286 http://deb.debian.org/debian trixie/main amd64 libmaven-parent-java all 43-2 [6252 B] Get: 287 http://deb.debian.org/debian trixie/main amd64 libplexus-utils2-java all 3.4.2-1 [258 kB] Get: 288 http://deb.debian.org/debian trixie/main amd64 libwagon-provider-api-java all 3.5.3-2 [48.3 kB] Get: 289 http://deb.debian.org/debian trixie/main amd64 libmaven-resolver-java all 1.9.22-1 [729 kB] Get: 290 http://deb.debian.org/debian trixie/main amd64 libplexus-cipher-java all 2.0-1 [14.9 kB] Get: 291 http://deb.debian.org/debian trixie/main amd64 libplexus-classworlds-java all 2.7.0-1 [50.6 kB] Get: 292 http://deb.debian.org/debian trixie/main amd64 libplexus-component-annotations-java all 2.1.1-1 [7660 B] Get: 293 http://deb.debian.org/debian trixie/main amd64 libplexus-interpolation-java all 1.27-1 [76.8 kB] Get: 294 http://deb.debian.org/debian trixie/main amd64 libplexus-sec-dispatcher-java all 2.0-3 [28.3 kB] Get: 295 http://deb.debian.org/debian trixie/main amd64 libgeronimo-interceptor-3.0-spec-java all 1.0.1-5 [8444 B] Get: 296 http://deb.debian.org/debian trixie/main amd64 libcdi-api-java all 1.2-4 [55.3 kB] Get: 297 http://deb.debian.org/debian trixie/main amd64 libsisu-inject-java all 0.3.5-1 [352 kB] Get: 298 http://deb.debian.org/debian trixie/main amd64 libsisu-plexus-java all 0.3.5-1 [183 kB] Get: 299 http://deb.debian.org/debian trixie/main amd64 libmaven3-core-java all 3.9.9-1 [1661 kB] Get: 300 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-io-java all 3.0.0-4 [33.2 kB] Get: 301 http://deb.debian.org/debian trixie/main amd64 libmaven-file-management-java all 3.0.0-2 [35.1 kB] Get: 302 http://deb.debian.org/debian trixie/main amd64 libbuild-helper-maven-plugin-java all 3.3.0-1 [59.5 kB] Get: 303 http://deb.debian.org/debian trixie/main amd64 libbyte-buddy-java all 1.14.19-1 [4756 kB] Get: 304 http://deb.debian.org/debian trixie/main amd64 libcolt-free-java all 1.2.0+dfsg-8 [440 kB] Get: 305 http://deb.debian.org/debian trixie/main amd64 libcommons-collections3-java all 3.2.2-3 [530 kB] Get: 306 http://deb.debian.org/debian trixie/main amd64 libcommons-beanutils-java all 1.10.1-1.1 [231 kB] Get: 307 http://deb.debian.org/debian trixie/main amd64 libcommons-collections4-java all 4.4-2 [682 kB] Get: 308 http://deb.debian.org/debian trixie/main amd64 libcommons-compress-java all 1.27.1-2 [641 kB] Get: 309 http://deb.debian.org/debian trixie/main amd64 libcommons-lang-java all 2.6-10 [273 kB] Get: 310 http://deb.debian.org/debian trixie/main amd64 libcommons-configuration-java all 1.10-7 [348 kB] Get: 311 http://deb.debian.org/debian trixie/main amd64 libcommons-digester-java all 1.8.1-7 [138 kB] Get: 312 http://deb.debian.org/debian trixie/main amd64 libcommons-exec-java all 1.3-3 [48.4 kB] Get: 313 http://deb.debian.org/debian trixie/main amd64 libcommons-jexl2-java all 2.1.1-6 [256 kB] Get: 314 http://deb.debian.org/debian trixie/main amd64 libcommons-math-java all 2.2-9 [933 kB] Get: 315 http://deb.debian.org/debian trixie/main amd64 libcommons-math3-java all 3.6.1-4 [2040 kB] Get: 316 http://deb.debian.org/debian trixie/main amd64 libplexus-io-java all 3.3.1-2 [65.3 kB] Get: 317 http://deb.debian.org/debian trixie/main amd64 libsnappy1v5 amd64 1.2.2-1 [29.3 kB] Get: 318 http://deb.debian.org/debian trixie/main amd64 libsnappy-jni amd64 1.1.10.7-1 [6492 B] Get: 319 http://deb.debian.org/debian trixie/main amd64 libsnappy-java all 1.1.10.7-1 [87.6 kB] Get: 320 http://deb.debian.org/debian trixie/main amd64 libxz-java all 1.9-1 [143 kB] Get: 321 http://deb.debian.org/debian trixie/main amd64 libplexus-archiver-java all 4.6.1-1 [187 kB] Get: 322 http://deb.debian.org/debian trixie/main amd64 libmaven-archiver-java all 3.6.2-1 [26.1 kB] Get: 323 http://deb.debian.org/debian trixie/main amd64 libmaven-jar-plugin-java all 3.3.0-2 [24.0 kB] Get: 324 http://deb.debian.org/debian trixie/main amd64 libcommons-text-java all 1.13.1-1 [228 kB] Get: 325 http://deb.debian.org/debian trixie/main amd64 sgml-base all 1.31+nmu1 [10.9 kB] Get: 326 http://deb.debian.org/debian trixie/main amd64 libcommons-validator-java all 1:1.9.0-1 [191 kB] Get: 327 http://deb.debian.org/debian trixie/main amd64 libsasl2-modules-db amd64 2.1.28+dfsg1-9 [19.8 kB] Get: 328 http://deb.debian.org/debian trixie/main amd64 libsasl2-2 amd64 2.1.28+dfsg1-9 [57.5 kB] Get: 329 http://deb.debian.org/debian trixie/main amd64 libldap2 amd64 2.6.10+dfsg-1 [194 kB] Get: 330 http://deb.debian.org/debian trixie/main amd64 libnghttp2-14 amd64 1.64.0-1.1 [76.0 kB] Get: 331 http://deb.debian.org/debian trixie/main amd64 libnghttp3-9 amd64 1.8.0-1 [67.7 kB] Get: 332 http://deb.debian.org/debian trixie/main amd64 libpsl5t64 amd64 0.21.2-1.1+b1 [57.2 kB] Get: 333 http://deb.debian.org/debian trixie/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2+b5 [58.8 kB] Get: 334 http://deb.debian.org/debian trixie/main amd64 libssh2-1t64 amd64 1.11.1-1 [245 kB] Get: 335 http://deb.debian.org/debian trixie/main amd64 libcurl4t64 amd64 8.14.1-2 [391 kB] Get: 336 http://deb.debian.org/debian trixie/main amd64 libdistlib-java all 1.0-5 [72.5 kB] Get: 337 http://deb.debian.org/debian trixie/main amd64 libjaxen-java all 1.1.6-5 [214 kB] Get: 338 http://deb.debian.org/debian trixie/main amd64 libdom4j-java all 2.1.4-1 [312 kB] Get: 339 http://deb.debian.org/debian trixie/main amd64 libdoxia-core-java all 2.0.0-1 [149 kB] Get: 340 http://deb.debian.org/debian trixie/main amd64 libplexus-xml-java all 3.0.1-2 [93.7 kB] Get: 341 http://deb.debian.org/debian trixie/main amd64 libdoxia-java all 2.0.0-1 [113 kB] Get: 342 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-api-java all 4.0.0-1 [6724 B] Get: 343 http://deb.debian.org/debian trixie/main amd64 libxbean-reflect-java all 4.5-9 [132 kB] Get: 344 http://deb.debian.org/debian trixie/main amd64 libplexus-container-default-java all 2.1.1-1 [193 kB] Get: 345 http://deb.debian.org/debian trixie/main amd64 libplexus-i18n-java all 1.0-beta-10-6 [13.4 kB] Get: 346 http://deb.debian.org/debian trixie/main amd64 velocity all 1.7-7 [431 kB] Get: 347 http://deb.debian.org/debian trixie/main amd64 libplexus-velocity-java all 1.2-4 [9676 B] Get: 348 http://deb.debian.org/debian trixie/main amd64 liboro-java all 2.0.8a-15 [69.3 kB] Get: 349 http://deb.debian.org/debian trixie/main amd64 libvelocity-tools-java all 2.0-9 [311 kB] Get: 350 http://deb.debian.org/debian trixie/main amd64 libdoxia-sitetools-java all 2.0.0-1 [176 kB] Get: 351 http://deb.debian.org/debian trixie/main amd64 libfastutil-java all 8.5.15+dfsg-1 [20.0 MB] Get: 352 http://deb.debian.org/debian trixie/main amd64 libxpp3-java all 1.1.4c-4 [294 kB] Get: 353 http://deb.debian.org/debian trixie/main amd64 libxstream-java all 1.4.21-1 [567 kB] Get: 354 http://deb.debian.org/debian trixie/main amd64 libjsap-java all 2.1-5 [102 kB] Get: 355 http://deb.debian.org/debian trixie/main amd64 liblogback-java all 1:1.2.11-6 [701 kB] Get: 356 http://deb.debian.org/debian trixie/main amd64 libdsiutils-java all 2.7.3+dfsg-1 [524 kB] Get: 357 http://deb.debian.org/debian trixie/main amd64 libobjenesis-java all 3.4-2 [41.3 kB] Get: 358 http://deb.debian.org/debian trixie/main amd64 libeasymock-java all 5.5.0-1 [134 kB] Get: 359 http://deb.debian.org/debian trixie/main amd64 libel-api-java all 3.0.0-3 [64.9 kB] Get: 360 http://deb.debian.org/debian trixie/main amd64 libexec-maven-plugin-java all 3.1.0-2 [66.7 kB] Get: 361 http://deb.debian.org/debian trixie/main amd64 libezmorph-java all 1.0.6-4 [75.9 kB] Get: 362 http://deb.debian.org/debian trixie/main amd64 libgatk-native-bindings-java all 1.0.0+dfsg-2 [8024 B] Get: 363 http://deb.debian.org/debian trixie/main amd64 libgfortran5 amd64 14.2.0-19 [836 kB] Get: 364 http://deb.debian.org/debian trixie/main amd64 libxml-commons-external-java all 1.4.01-6 [240 kB] Get: 365 http://deb.debian.org/debian trixie/main amd64 libxml-commons-resolver1.1-java all 1.2-11 [98.3 kB] Get: 366 http://deb.debian.org/debian trixie/main amd64 libxerces2-java all 2.12.2-1 [1440 kB] Get: 367 http://deb.debian.org/debian trixie/main amd64 libxom-java all 1.3.9-1 [174 kB] Get: 368 http://deb.debian.org/debian trixie/main amd64 libjson-java all 3.1.0+dfsg-2 [142 kB] Get: 369 http://deb.debian.org/debian trixie/main amd64 libmbedcrypto16 amd64 3.6.4-2 [360 kB] Get: 370 http://deb.debian.org/debian trixie/main amd64 libmbedx509-7 amd64 3.6.4-2 [151 kB] Get: 371 http://deb.debian.org/debian trixie/main amd64 libmbedtls21 amd64 3.6.4-2 [242 kB] Get: 372 http://deb.debian.org/debian trixie/main amd64 ncbi-vdb-data all 3.2.1+dfsg-2 [88.5 kB] Get: 373 http://deb.debian.org/debian trixie/main amd64 libncbi-vdb3 amd64 3.2.1+dfsg-2 [1164 kB] Get: 374 http://deb.debian.org/debian trixie/main amd64 libncbi-ngs3 amd64 3.2.1+dfsg-4 [159 kB] Get: 375 http://deb.debian.org/debian trixie/main amd64 libngs-jni amd64 3.2.1+dfsg-4 [27.7 kB] Get: 376 http://deb.debian.org/debian trixie/main amd64 libngs-java amd64 3.2.1+dfsg-4 [114 kB] Get: 377 http://deb.debian.org/debian trixie/main amd64 librhino-java all 1.7.15-1 [1382 kB] Get: 378 http://deb.debian.org/debian trixie/main amd64 libhtsjdk-java all 4.1.3+dfsg-2 [1841 kB] Get: 379 http://deb.debian.org/debian trixie/main amd64 libgkl-java all 0.8.11+dfsg-2 [24.7 kB] Get: 380 http://deb.debian.org/debian trixie/main amd64 libicu4j-java all 73.2-1 [16.4 MB] Get: 381 http://deb.debian.org/debian trixie/main amd64 liblog4j1.2-java all 1.2.17-11 [444 kB] Get: 382 http://deb.debian.org/debian trixie/main amd64 libicb-utils-java all 2.0.1+git20161002.afee1d9-5 [81.5 kB] Get: 383 http://deb.debian.org/debian trixie/main amd64 libice6 amd64 2:1.1.1-1 [65.4 kB] Get: 384 http://deb.debian.org/debian trixie/main amd64 libicu76 amd64 76.1-4 [9722 kB] Get: 385 http://deb.debian.org/debian trixie/main amd64 libjansi-java all 2.4.1-2 [100 kB] Get: 386 http://deb.debian.org/debian trixie/main amd64 libjavassist-java all 1:3.27.0-1 [731 kB] Get: 387 http://deb.debian.org/debian trixie/main amd64 libjaxb-api-java all 2.3.1-1 [119 kB] Get: 388 http://deb.debian.org/debian trixie/main amd64 libjboss-logging-java all 3.5.3-1 [56.2 kB] Get: 389 http://deb.debian.org/debian trixie/main amd64 libjboss-vfs-java all 3.2.15.Final-3 [130 kB] Get: 390 http://deb.debian.org/debian trixie/main amd64 libjbzip2-java all 0.9.1-8 [42.7 kB] Get: 391 http://deb.debian.org/debian trixie/main amd64 libjcommander-java all 1.71-4 [73.0 kB] Get: 392 http://deb.debian.org/debian trixie/main amd64 libjsp-api-java all 2.3.4-3 [53.7 kB] Get: 393 http://deb.debian.org/debian trixie/main amd64 libservlet-api-java all 4.0.1-2 [81.0 kB] Get: 394 http://deb.debian.org/debian trixie/main amd64 libwebsocket-api-java all 1.1-2 [40.1 kB] Get: 395 http://deb.debian.org/debian trixie/main amd64 libjetty9-java all 9.4.57-1 [2965 kB] Get: 396 http://deb.debian.org/debian trixie/main amd64 libjsoup-java all 1.15.3-1 [431 kB] Get: 397 http://deb.debian.org/debian trixie/main amd64 libjtidy-java all 7+svn20110807-6 [251 kB] Get: 398 http://deb.debian.org/debian trixie/main amd64 liblapack3 amd64 3.12.1-4 [2447 kB] Get: 399 http://deb.debian.org/debian trixie/main amd64 libmaven-antrun-plugin-java all 3.1.0-1 [36.9 kB] Get: 400 http://deb.debian.org/debian trixie/main amd64 libmaven-common-artifact-filters-java all 3.4.0-1 [47.7 kB] Get: 401 http://deb.debian.org/debian trixie/main amd64 libmaven-artifact-transfer-java all 0.13.1-3 [158 kB] Get: 402 http://deb.debian.org/debian trixie/main amd64 libplexus-build-api-java all 0.0.7-4 [10.3 kB] Get: 403 http://deb.debian.org/debian trixie/main amd64 libmaven-filtering-java all 3.4.0-1 [51.4 kB] Get: 404 http://deb.debian.org/debian trixie/main amd64 libmaven-assembly-plugin-java all 3.4.2-2 [242 kB] Get: 405 http://deb.debian.org/debian trixie/main amd64 libmaven-clean-plugin-java all 3.2.0-2 [32.2 kB] Get: 406 http://deb.debian.org/debian trixie/main amd64 libmaven-shared-incremental-java all 1.1-6 [9916 B] Get: 407 http://deb.debian.org/debian trixie/main amd64 libplexus-compiler-java all 2.13.0-1 [99.5 kB] Get: 408 http://deb.debian.org/debian trixie/main amd64 libqdox2-java all 2.0.3-1 [296 kB] Get: 409 http://deb.debian.org/debian trixie/main amd64 libplexus-languages-java all 1.1.1-3 [47.8 kB] Get: 410 http://deb.debian.org/debian trixie/main amd64 libmaven-compiler-plugin-java all 3.13.0-1 [78.8 kB] Get: 411 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-analyzer-java all 1.15.1-1 [38.5 kB] Get: 412 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-tree-java all 3.3.0-1 [35.0 kB] Get: 413 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-impl-java all 4.0.0-1 [17.6 kB] Get: 414 http://deb.debian.org/debian trixie/main amd64 libmaven-dependency-plugin-java all 3.8.1-1 [191 kB] Get: 415 http://deb.debian.org/debian trixie/main amd64 libmaven-invoker-java all 3.3.0-1 [29.1 kB] Get: 416 http://deb.debian.org/debian trixie/main amd64 libplexus-interactivity-api-java all 1.3-1 [11.6 kB] Get: 417 http://deb.debian.org/debian trixie/main amd64 libmaven-javadoc-plugin-java all 3.10.1-2 [451 kB] Get: 418 http://deb.debian.org/debian trixie/main amd64 libplexus-ant-factory-java all 1.0~alpha2.1-5 [11.7 kB] Get: 419 http://deb.debian.org/debian trixie/main amd64 libplexus-container-default1.5-java all 2.1.1-1 [4476 B] Get: 420 http://deb.debian.org/debian trixie/main amd64 libplexus-bsh-factory-java all 1.0~alpha7-5 [8360 B] Get: 421 http://deb.debian.org/debian trixie/main amd64 libmaven-plugin-tools-java all 3.10.2-2 [245 kB] Get: 422 http://deb.debian.org/debian trixie/main amd64 libmaven-reporting-exec-java all 2.0.0-1 [23.9 kB] Get: 423 http://deb.debian.org/debian trixie/main amd64 libmaven-resources-plugin-java all 3.3.1-1 [27.5 kB] Get: 424 http://deb.debian.org/debian trixie/main amd64 libmaven-site-plugin-java all 3.21.0-1 [106 kB] Get: 425 http://deb.debian.org/debian trixie/main amd64 libmaven-source-plugin-java all 3.3.1-1 [27.7 kB] Get: 426 http://deb.debian.org/debian trixie/main amd64 libpaper2 amd64 2.2.5-0.3+b2 [16.7 kB] Get: 427 http://deb.debian.org/debian trixie/main amd64 libpaper-utils amd64 2.2.5-0.3+b2 [16.5 kB] Get: 428 http://deb.debian.org/debian trixie/main amd64 libpicard-java all 3.3.0+dfsg-2 [1778 kB] Get: 429 http://deb.debian.org/debian trixie/main amd64 libpj-java all 0.0~20150107+dfsg-5 [1389 kB] Get: 430 http://deb.debian.org/debian trixie/main amd64 libpkgconf3 amd64 1.8.1-4 [36.4 kB] Get: 431 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] Get: 432 http://deb.debian.org/debian trixie/main amd64 libprotobuf32t64 amd64 3.21.12-11 [983 kB] Get: 433 http://deb.debian.org/debian trixie/main amd64 libprotobuf-lite32t64 amd64 3.21.12-11 [274 kB] Get: 434 http://deb.debian.org/debian trixie/main amd64 libprotobuf-dev amd64 3.21.12-11 [1328 kB] Get: 435 http://deb.debian.org/debian trixie/main amd64 libprotobuf-java all 3.21.12-11 [1267 kB] Get: 436 http://deb.debian.org/debian trixie/main amd64 libprotoc32t64 amd64 3.21.12-11 [922 kB] Get: 437 http://deb.debian.org/debian trixie/main amd64 libreflections-java all 0.10.2+dfsg-2 [125 kB] Get: 438 http://deb.debian.org/debian trixie/main amd64 libsm6 amd64 2:1.2.6-1 [37.3 kB] Get: 439 http://deb.debian.org/debian trixie/main amd64 libsurefire-java all 2.22.3-4 [1391 kB] Get: 440 http://deb.debian.org/debian trixie/main amd64 libtcl8.6 amd64 8.6.16+dfsg-1 [1042 kB] Get: 441 http://deb.debian.org/debian trixie/main amd64 libtirpc-common all 1.3.6+ds-1 [11.0 kB] Get: 442 http://deb.debian.org/debian trixie/main amd64 libtirpc3t64 amd64 1.3.6+ds-1 [83.3 kB] Get: 443 http://deb.debian.org/debian trixie/main amd64 libxft2 amd64 2.3.6-1+b4 [54.5 kB] Get: 444 http://deb.debian.org/debian trixie/main amd64 libxss1 amd64 1:1.2.3-1+b3 [17.0 kB] Get: 445 http://deb.debian.org/debian trixie/main amd64 libtk8.6 amd64 8.6.16-1 [793 kB] Get: 446 http://deb.debian.org/debian trixie/main amd64 libwagon-file-java all 3.5.3-2 [8452 B] Get: 447 http://deb.debian.org/debian trixie/main amd64 libwagon-http-java all 3.5.3-2 [49.6 kB] Get: 448 http://deb.debian.org/debian trixie/main amd64 libxml2-utils amd64 2.12.7+dfsg+really2.9.14-2.1 [100 kB] Get: 449 http://deb.debian.org/debian trixie/main amd64 libxt6t64 amd64 1:1.2.1-1.2+b2 [188 kB] Get: 450 http://deb.debian.org/debian trixie/main amd64 maven all 3.9.9-1 [19.7 kB] Get: 451 http://deb.debian.org/debian trixie/main amd64 maven-repo-helper all 1.11 [142 kB] Get: 452 http://deb.debian.org/debian trixie/main amd64 unzip amd64 6.0-29 [173 kB] Get: 453 http://deb.debian.org/debian trixie/main amd64 maven-debian-helper all 2.6.7 [108 kB] Get: 454 http://deb.debian.org/debian trixie/main amd64 pkgconf-bin amd64 1.8.1-4 [30.2 kB] Get: 455 http://deb.debian.org/debian trixie/main amd64 pkgconf amd64 1.8.1-4 [26.2 kB] Get: 456 http://deb.debian.org/debian trixie/main amd64 protobuf-compiler amd64 3.21.12-11 [84.7 kB] Get: 457 http://deb.debian.org/debian trixie/main amd64 zip amd64 3.0-15 [235 kB] Get: 458 http://deb.debian.org/debian trixie/main amd64 xdg-utils all 1.2.1-2 [75.8 kB] Get: 459 http://deb.debian.org/debian trixie/main amd64 r-base-core amd64 4.5.0-3 [28.6 MB] Get: 460 http://deb.debian.org/debian trixie/main amd64 r-cran-rjava amd64 1.0-11-2 [713 kB] Get: 461 http://deb.debian.org/debian trixie/main amd64 testng all 6.9.12-4 [795 kB] Fetched 386 MB in 10s (38.8 MB/s) Preconfiguring packages ... Selecting previously unselected package libsystemd-shared:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19851 files and directories currently installed.) Preparing to unpack .../libsystemd-shared_257.7-1_amd64.deb ... Unpacking libsystemd-shared:amd64 (257.7-1) ... Selecting previously unselected package libapparmor1:amd64. Preparing to unpack .../libapparmor1_4.1.0-1_amd64.deb ... Unpacking libapparmor1:amd64 (4.1.0-1) ... Setting up libsystemd-shared:amd64 (257.7-1) ... Selecting previously unselected package systemd. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19864 files and directories currently installed.) Preparing to unpack .../systemd_257.7-1_amd64.deb ... Unpacking systemd (257.7-1) ... Setting up libapparmor1:amd64 (4.1.0-1) ... Setting up systemd (257.7-1) ... Created symlink '/etc/systemd/system/getty.target.wants/getty@tty1.service' -> '/usr/lib/systemd/system/getty@.service'. Created symlink '/etc/systemd/system/multi-user.target.wants/remote-fs.target' -> '/usr/lib/systemd/system/remote-fs.target'. Created symlink '/etc/systemd/system/sysinit.target.wants/systemd-pstore.service' -> '/usr/lib/systemd/system/systemd-pstore.service'. Initializing machine ID from random generator. Creating group 'systemd-journal' with GID 999. Creating group 'systemd-network' with GID 998. Creating user 'systemd-network' (systemd Network Management) with UID 998 and GID 998. /usr/lib/tmpfiles.d/legacy.conf:14: Duplicate line for path "/run/lock", ignoring. Selecting previously unselected package systemd-sysv. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20802 files and directories currently installed.) Preparing to unpack .../00-systemd-sysv_257.7-1_amd64.deb ... Unpacking systemd-sysv (257.7-1) ... Selecting previously unselected package libdbus-1-3:amd64. Preparing to unpack .../01-libdbus-1-3_1.16.2-2_amd64.deb ... Unpacking libdbus-1-3:amd64 (1.16.2-2) ... Selecting previously unselected package dbus-bin. Preparing to unpack .../02-dbus-bin_1.16.2-2_amd64.deb ... Unpacking dbus-bin (1.16.2-2) ... Selecting previously unselected package dbus-session-bus-common. Preparing to unpack .../03-dbus-session-bus-common_1.16.2-2_all.deb ... Unpacking dbus-session-bus-common (1.16.2-2) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../04-libexpat1_2.7.1-2_amd64.deb ... Unpacking libexpat1:amd64 (2.7.1-2) ... Selecting previously unselected package dbus-daemon. Preparing to unpack .../05-dbus-daemon_1.16.2-2_amd64.deb ... Unpacking dbus-daemon (1.16.2-2) ... Selecting previously unselected package dbus-system-bus-common. Preparing to unpack .../06-dbus-system-bus-common_1.16.2-2_all.deb ... Unpacking dbus-system-bus-common (1.16.2-2) ... Selecting previously unselected package dbus. Preparing to unpack .../07-dbus_1.16.2-2_amd64.deb ... Unpacking dbus (1.16.2-2) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../08-libpipeline1_1.5.8-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.8-1) ... Selecting previously unselected package binfmt-support. Preparing to unpack .../09-binfmt-support_2.2.2-7_amd64.deb ... Unpacking binfmt-support (2.2.2-7) ... Selecting previously unselected package libpython3.13-minimal:amd64. Preparing to unpack .../10-libpython3.13-minimal_3.13.5-2_amd64.deb ... Unpacking libpython3.13-minimal:amd64 (3.13.5-2) ... Selecting previously unselected package python3.13-minimal. Preparing to unpack .../11-python3.13-minimal_3.13.5-2_amd64.deb ... Unpacking python3.13-minimal (3.13.5-2) ... Setting up libpython3.13-minimal:amd64 (3.13.5-2) ... Setting up libexpat1:amd64 (2.7.1-2) ... Setting up python3.13-minimal (3.13.5-2) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21251 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.13.5-1_amd64.deb ... Unpacking python3-minimal (3.13.5-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_13.0.0_all.deb ... Unpacking media-types (13.0.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.5_all.deb ... Unpacking netbase (6.5) ... Selecting previously unselected package tzdata. Preparing to unpack .../3-tzdata_2025b-4_all.deb ... Unpacking tzdata (2025b-4) ... Selecting previously unselected package libffi8:amd64. Preparing to unpack .../4-libffi8_3.4.8-2_amd64.deb ... Unpacking libffi8:amd64 (3.4.8-2) ... Selecting previously unselected package readline-common. Preparing to unpack .../5-readline-common_8.2-6_all.deb ... Unpacking readline-common (8.2-6) ... Selecting previously unselected package libreadline8t64:amd64. Preparing to unpack .../6-libreadline8t64_8.2-6_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8 to /lib/x86_64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libhistory.so.8.2 to /lib/x86_64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8 to /lib/x86_64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/x86_64-linux-gnu/libreadline.so.8.2 to /lib/x86_64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:amd64 (8.2-6) ... Selecting previously unselected package libpython3.13-stdlib:amd64. Preparing to unpack .../7-libpython3.13-stdlib_3.13.5-2_amd64.deb ... Unpacking libpython3.13-stdlib:amd64 (3.13.5-2) ... Selecting previously unselected package python3.13. Preparing to unpack .../8-python3.13_3.13.5-2_amd64.deb ... Unpacking python3.13 (3.13.5-2) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../9-libpython3-stdlib_3.13.5-1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.13.5-1) ... Setting up python3-minimal (3.13.5-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 22266 files and directories currently installed.) Preparing to unpack .../000-python3_3.13.5-1_amd64.deb ... Unpacking python3 (3.13.5-1) ... Selecting previously unselected package libproc2-0:amd64. Preparing to unpack .../001-libproc2-0_2%3a4.0.4-9_amd64.deb ... Unpacking libproc2-0:amd64 (2:4.0.4-9) ... Selecting previously unselected package procps. Preparing to unpack .../002-procps_2%3a4.0.4-9_amd64.deb ... Unpacking procps (2:4.0.4-9) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../003-sensible-utils_0.0.25_all.deb ... Unpacking sensible-utils (0.0.25) ... Selecting previously unselected package openssl. Preparing to unpack .../004-openssl_3.5.1-1_amd64.deb ... Unpacking openssl (3.5.1-1) ... Selecting previously unselected package ca-certificates. Preparing to unpack .../005-ca-certificates_20250419_all.deb ... Unpacking ca-certificates (20250419) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../006-libmagic-mgc_1%3a5.46-5_amd64.deb ... Unpacking libmagic-mgc (1:5.46-5) ... Selecting previously unselected package libmagic1t64:amd64. Preparing to unpack .../007-libmagic1t64_1%3a5.46-5_amd64.deb ... Unpacking libmagic1t64:amd64 (1:5.46-5) ... Selecting previously unselected package file. Preparing to unpack .../008-file_1%3a5.46-5_amd64.deb ... Unpacking file (1:5.46-5) ... Selecting previously unselected package gettext-base. Preparing to unpack .../009-gettext-base_0.23.1-2_amd64.deb ... Unpacking gettext-base (0.23.1-2) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../010-libuchardet0_0.0.8-1+b2_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../011-groff-base_1.23.0-9_amd64.deb ... Unpacking groff-base (1.23.0-9) ... Selecting previously unselected package libpam-systemd:amd64. Preparing to unpack .../012-libpam-systemd_257.7-1_amd64.deb ... Unpacking libpam-systemd:amd64 (257.7-1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../013-bsdextrautils_2.41-5_amd64.deb ... Unpacking bsdextrautils (2.41-5) ... Selecting previously unselected package man-db. Preparing to unpack .../014-man-db_2.13.1-1_amd64.deb ... Unpacking man-db (2.13.1-1) ... Selecting previously unselected package libtext-charwidth-perl:amd64. Preparing to unpack .../015-libtext-charwidth-perl_0.04-11+b4_amd64.deb ... Unpacking libtext-charwidth-perl:amd64 (0.04-11+b4) ... Selecting previously unselected package libtext-wrapi18n-perl. Preparing to unpack .../016-libtext-wrapi18n-perl_0.06-10_all.deb ... Unpacking libtext-wrapi18n-perl (0.06-10) ... Selecting previously unselected package ucf. Preparing to unpack .../017-ucf_3.0052_all.deb ... Moving old data out of the way Unpacking ucf (3.0052) ... Selecting previously unselected package libgdk-pixbuf2.0-common. Preparing to unpack .../018-libgdk-pixbuf2.0-common_2.42.12+dfsg-4_all.deb ... Unpacking libgdk-pixbuf2.0-common (2.42.12+dfsg-4) ... Selecting previously unselected package libglib2.0-0t64:amd64. Preparing to unpack .../019-libglib2.0-0t64_2.84.3-1_amd64.deb ... Unpacking libglib2.0-0t64:amd64 (2.84.3-1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../020-libxml2_2.12.7+dfsg+really2.9.14-2.1_amd64.deb ... Unpacking libxml2:amd64 (2.12.7+dfsg+really2.9.14-2.1) ... Selecting previously unselected package shared-mime-info. Preparing to unpack .../021-shared-mime-info_2.4-5+b2_amd64.deb ... Unpacking shared-mime-info (2.4-5+b2) ... Selecting previously unselected package libjpeg62-turbo:amd64. Preparing to unpack .../022-libjpeg62-turbo_1%3a2.1.5-4_amd64.deb ... Unpacking libjpeg62-turbo:amd64 (1:2.1.5-4) ... Selecting previously unselected package libpng16-16t64:amd64. Preparing to unpack .../023-libpng16-16t64_1.6.48-1_amd64.deb ... Unpacking libpng16-16t64:amd64 (1.6.48-1) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../024-libdeflate0_1.23-2_amd64.deb ... Unpacking libdeflate0:amd64 (1.23-2) ... Selecting previously unselected package libjbig0:amd64. Preparing to unpack .../025-libjbig0_2.1-6.1+b2_amd64.deb ... Unpacking libjbig0:amd64 (2.1-6.1+b2) ... Selecting previously unselected package liblerc4:amd64. Preparing to unpack .../026-liblerc4_4.0.0+ds-5_amd64.deb ... Unpacking liblerc4:amd64 (4.0.0+ds-5) ... Selecting previously unselected package libsharpyuv0:amd64. Preparing to unpack .../027-libsharpyuv0_1.5.0-0.1_amd64.deb ... Unpacking libsharpyuv0:amd64 (1.5.0-0.1) ... Selecting previously unselected package libwebp7:amd64. Preparing to unpack .../028-libwebp7_1.5.0-0.1_amd64.deb ... Unpacking libwebp7:amd64 (1.5.0-0.1) ... Selecting previously unselected package libtiff6:amd64. Preparing to unpack .../029-libtiff6_4.7.0-3_amd64.deb ... Unpacking libtiff6:amd64 (4.7.0-3) ... Selecting previously unselected package libgdk-pixbuf-2.0-0:amd64. Preparing to unpack .../030-libgdk-pixbuf-2.0-0_2.42.12+dfsg-4_amd64.deb ... Unpacking libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-4) ... Selecting previously unselected package gtk-update-icon-cache. Preparing to unpack .../031-gtk-update-icon-cache_4.18.6+ds-2_amd64.deb ... No diversion 'diversion of /usr/sbin/update-icon-caches to /usr/sbin/update-icon-caches.gtk2 by libgtk-3-bin', none removed. No diversion 'diversion of /usr/share/man/man8/update-icon-caches.8.gz to /usr/share/man/man8/update-icon-caches.gtk2.8.gz by libgtk-3-bin', none removed. Unpacking gtk-update-icon-cache (4.18.6+ds-2) ... Selecting previously unselected package hicolor-icon-theme. Preparing to unpack .../032-hicolor-icon-theme_0.18-2_all.deb ... Unpacking hicolor-icon-theme (0.18-2) ... Selecting previously unselected package adwaita-icon-theme. Preparing to unpack .../033-adwaita-icon-theme_48.1-1_all.deb ... Unpacking adwaita-icon-theme (48.1-1) ... Selecting previously unselected package ca-certificates-java. Preparing to unpack .../034-ca-certificates-java_20240118_all.deb ... Unpacking ca-certificates-java (20240118) ... Selecting previously unselected package java-common. Preparing to unpack .../035-java-common_0.76_all.deb ... Unpacking java-common (0.76) ... Selecting previously unselected package liblcms2-2:amd64. Preparing to unpack .../036-liblcms2-2_2.16-2_amd64.deb ... Unpacking liblcms2-2:amd64 (2.16-2) ... Selecting previously unselected package libnspr4:amd64. Preparing to unpack .../037-libnspr4_2%3a4.36-1_amd64.deb ... Unpacking libnspr4:amd64 (2:4.36-1) ... Selecting previously unselected package libnss3:amd64. Preparing to unpack .../038-libnss3_2%3a3.110-1_amd64.deb ... Unpacking libnss3:amd64 (2:3.110-1) ... Selecting previously unselected package libpcsclite1:amd64. Preparing to unpack .../039-libpcsclite1_2.3.3-1_amd64.deb ... Unpacking libpcsclite1:amd64 (2.3.3-1) ... Selecting previously unselected package openjdk-21-jre-headless:amd64. Preparing to unpack .../040-openjdk-21-jre-headless_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jre-headless:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jre-headless. Preparing to unpack .../041-default-jre-headless_2%3a1.21-76_amd64.deb ... Unpacking default-jre-headless (2:1.21-76) ... Selecting previously unselected package ant. Preparing to unpack .../042-ant_1.10.15-1_all.deb ... Unpacking ant (1.10.15-1) ... Selecting previously unselected package ant-contrib. Preparing to unpack .../043-ant-contrib_1.0~b3+svn177-12_all.deb ... Unpacking ant-contrib (1.0~b3+svn177-12) ... Selecting previously unselected package at-spi2-common. Preparing to unpack .../044-at-spi2-common_2.56.2-1_all.deb ... Unpacking at-spi2-common (2.56.2-1) ... Selecting previously unselected package m4. Preparing to unpack .../045-m4_1.4.19-8_amd64.deb ... Unpacking m4 (1.4.19-8) ... Selecting previously unselected package autoconf. Preparing to unpack .../046-autoconf_2.72-3.1_all.deb ... Unpacking autoconf (2.72-3.1) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../047-autotools-dev_20240727.1_all.deb ... Unpacking autotools-dev (20240727.1) ... Selecting previously unselected package automake. Preparing to unpack .../048-automake_1%3a1.17-4_all.deb ... Unpacking automake (1:1.17-4) ... Selecting previously unselected package autopoint. Preparing to unpack .../049-autopoint_0.23.1-2_all.deb ... Unpacking autopoint (0.23.1-2) ... Selecting previously unselected package dbus-user-session. Preparing to unpack .../050-dbus-user-session_1.16.2-2_amd64.deb ... Unpacking dbus-user-session (1.16.2-2) ... Selecting previously unselected package libdconf1:amd64. Preparing to unpack .../051-libdconf1_0.40.0-5_amd64.deb ... Unpacking libdconf1:amd64 (0.40.0-5) ... Selecting previously unselected package dconf-service. Preparing to unpack .../052-dconf-service_0.40.0-5_amd64.deb ... Unpacking dconf-service (0.40.0-5) ... Selecting previously unselected package dconf-gsettings-backend:amd64. Preparing to unpack .../053-dconf-gsettings-backend_0.40.0-5_amd64.deb ... Unpacking dconf-gsettings-backend:amd64 (0.40.0-5) ... Selecting previously unselected package dctrl-tools. Preparing to unpack .../054-dctrl-tools_2.24-3+b1_amd64.deb ... Unpacking dctrl-tools (2.24-3+b1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../055-libdebhelper-perl_13.24.2_all.deb ... Unpacking libdebhelper-perl (13.24.2) ... Selecting previously unselected package libtool. Preparing to unpack .../056-libtool_2.5.4-4_all.deb ... Unpacking libtool (2.5.4-4) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../057-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../058-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../059-libfile-stripnondeterminism-perl_1.14.1-2_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.1-2) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../060-dh-strip-nondeterminism_1.14.1-2_all.deb ... Unpacking dh-strip-nondeterminism (1.14.1-2) ... Selecting previously unselected package libelf1t64:amd64. Preparing to unpack .../061-libelf1t64_0.192-4_amd64.deb ... Unpacking libelf1t64:amd64 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../062-dwz_0.15-1+b1_amd64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libunistring5:amd64. Preparing to unpack .../063-libunistring5_1.3-2_amd64.deb ... Unpacking libunistring5:amd64 (1.3-2) ... Selecting previously unselected package gettext. Preparing to unpack .../064-gettext_0.23.1-2_amd64.deb ... Unpacking gettext (0.23.1-2) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../065-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../066-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../067-debhelper_13.24.2_all.deb ... Unpacking debhelper (13.24.2) ... Selecting previously unselected package libatk1.0-0t64:amd64. Preparing to unpack .../068-libatk1.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatk1.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libxau6:amd64. Preparing to unpack .../069-libxau6_1%3a1.0.11-1_amd64.deb ... Unpacking libxau6:amd64 (1:1.0.11-1) ... Selecting previously unselected package libxdmcp6:amd64. Preparing to unpack .../070-libxdmcp6_1%3a1.1.5-1_amd64.deb ... Unpacking libxdmcp6:amd64 (1:1.1.5-1) ... Selecting previously unselected package libxcb1:amd64. Preparing to unpack .../071-libxcb1_1.17.0-2+b1_amd64.deb ... Unpacking libxcb1:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libx11-data. Preparing to unpack .../072-libx11-data_2%3a1.8.12-1_all.deb ... Unpacking libx11-data (2:1.8.12-1) ... Selecting previously unselected package libx11-6:amd64. Preparing to unpack .../073-libx11-6_2%3a1.8.12-1_amd64.deb ... Unpacking libx11-6:amd64 (2:1.8.12-1) ... Selecting previously unselected package libxext6:amd64. Preparing to unpack .../074-libxext6_2%3a1.3.4-1+b3_amd64.deb ... Unpacking libxext6:amd64 (2:1.3.4-1+b3) ... Selecting previously unselected package libxi6:amd64. Preparing to unpack .../075-libxi6_2%3a1.8.2-1_amd64.deb ... Unpacking libxi6:amd64 (2:1.8.2-1) ... Selecting previously unselected package libatspi2.0-0t64:amd64. Preparing to unpack .../076-libatspi2.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatspi2.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libatk-bridge2.0-0t64:amd64. Preparing to unpack .../077-libatk-bridge2.0-0t64_2.56.2-1_amd64.deb ... Unpacking libatk-bridge2.0-0t64:amd64 (2.56.2-1) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../078-libbrotli1_1.1.0-2+b7_amd64.deb ... Unpacking libbrotli1:amd64 (1.1.0-2+b7) ... Selecting previously unselected package libfreetype6:amd64. Preparing to unpack .../079-libfreetype6_2.13.3+dfsg-1_amd64.deb ... Unpacking libfreetype6:amd64 (2.13.3+dfsg-1) ... Selecting previously unselected package fonts-dejavu-mono. Preparing to unpack .../080-fonts-dejavu-mono_2.37-8_all.deb ... Unpacking fonts-dejavu-mono (2.37-8) ... Selecting previously unselected package fonts-dejavu-core. Preparing to unpack .../081-fonts-dejavu-core_2.37-8_all.deb ... Unpacking fonts-dejavu-core (2.37-8) ... Selecting previously unselected package fontconfig-config. Preparing to unpack .../082-fontconfig-config_2.15.0-2.3_amd64.deb ... Unpacking fontconfig-config (2.15.0-2.3) ... Selecting previously unselected package libfontconfig1:amd64. Preparing to unpack .../083-libfontconfig1_2.15.0-2.3_amd64.deb ... Unpacking libfontconfig1:amd64 (2.15.0-2.3) ... Selecting previously unselected package libpixman-1-0:amd64. Preparing to unpack .../084-libpixman-1-0_0.44.0-3_amd64.deb ... Unpacking libpixman-1-0:amd64 (0.44.0-3) ... Selecting previously unselected package libxcb-render0:amd64. Preparing to unpack .../085-libxcb-render0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-render0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-shm0:amd64. Preparing to unpack .../086-libxcb-shm0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-shm0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxrender1:amd64. Preparing to unpack .../087-libxrender1_1%3a0.9.12-1_amd64.deb ... Unpacking libxrender1:amd64 (1:0.9.12-1) ... Selecting previously unselected package libcairo2:amd64. Preparing to unpack .../088-libcairo2_1.18.4-1+b1_amd64.deb ... Unpacking libcairo2:amd64 (1.18.4-1+b1) ... Selecting previously unselected package libcairo-gobject2:amd64. Preparing to unpack .../089-libcairo-gobject2_1.18.4-1+b1_amd64.deb ... Unpacking libcairo-gobject2:amd64 (1.18.4-1+b1) ... Selecting previously unselected package libcloudproviders0:amd64. Preparing to unpack .../090-libcloudproviders0_0.3.6-2_amd64.deb ... Unpacking libcloudproviders0:amd64 (0.3.6-2) ... Selecting previously unselected package libcolord2:amd64. Preparing to unpack .../091-libcolord2_1.4.7-3_amd64.deb ... Unpacking libcolord2:amd64 (1.4.7-3) ... Selecting previously unselected package libavahi-common-data:amd64. Preparing to unpack .../092-libavahi-common-data_0.8-16_amd64.deb ... Unpacking libavahi-common-data:amd64 (0.8-16) ... Selecting previously unselected package libavahi-common3:amd64. Preparing to unpack .../093-libavahi-common3_0.8-16_amd64.deb ... Unpacking libavahi-common3:amd64 (0.8-16) ... Selecting previously unselected package libavahi-client3:amd64. Preparing to unpack .../094-libavahi-client3_0.8-16_amd64.deb ... Unpacking libavahi-client3:amd64 (0.8-16) ... Selecting previously unselected package libidn2-0:amd64. Preparing to unpack .../095-libidn2-0_2.3.8-2_amd64.deb ... Unpacking libidn2-0:amd64 (2.3.8-2) ... Selecting previously unselected package libp11-kit0:amd64. Preparing to unpack .../096-libp11-kit0_0.25.5-3_amd64.deb ... Unpacking libp11-kit0:amd64 (0.25.5-3) ... Selecting previously unselected package libtasn1-6:amd64. Preparing to unpack .../097-libtasn1-6_4.20.0-2_amd64.deb ... Unpacking libtasn1-6:amd64 (4.20.0-2) ... Selecting previously unselected package libgnutls30t64:amd64. Preparing to unpack .../098-libgnutls30t64_3.8.9-3_amd64.deb ... Unpacking libgnutls30t64:amd64 (3.8.9-3) ... Selecting previously unselected package libkrb5support0:amd64. Preparing to unpack .../099-libkrb5support0_1.21.3-5_amd64.deb ... Unpacking libkrb5support0:amd64 (1.21.3-5) ... Selecting previously unselected package libcom-err2:amd64. Preparing to unpack .../100-libcom-err2_1.47.2-3+b3_amd64.deb ... Unpacking libcom-err2:amd64 (1.47.2-3+b3) ... Selecting previously unselected package libk5crypto3:amd64. Preparing to unpack .../101-libk5crypto3_1.21.3-5_amd64.deb ... Unpacking libk5crypto3:amd64 (1.21.3-5) ... Selecting previously unselected package libkeyutils1:amd64. Preparing to unpack .../102-libkeyutils1_1.6.3-6_amd64.deb ... Unpacking libkeyutils1:amd64 (1.6.3-6) ... Selecting previously unselected package libkrb5-3:amd64. Preparing to unpack .../103-libkrb5-3_1.21.3-5_amd64.deb ... Unpacking libkrb5-3:amd64 (1.21.3-5) ... Selecting previously unselected package libgssapi-krb5-2:amd64. Preparing to unpack .../104-libgssapi-krb5-2_1.21.3-5_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.21.3-5) ... Selecting previously unselected package libcups2t64:amd64. Preparing to unpack .../105-libcups2t64_2.4.10-3_amd64.deb ... Unpacking libcups2t64:amd64 (2.4.10-3) ... Selecting previously unselected package libepoxy0:amd64. Preparing to unpack .../106-libepoxy0_1.5.10-2_amd64.deb ... Unpacking libepoxy0:amd64 (1.5.10-2) ... Selecting previously unselected package libfribidi0:amd64. Preparing to unpack .../107-libfribidi0_1.0.16-1_amd64.deb ... Unpacking libfribidi0:amd64 (1.0.16-1) ... Selecting previously unselected package libgraphite2-3:amd64. Preparing to unpack .../108-libgraphite2-3_1.3.14-2+b1_amd64.deb ... Unpacking libgraphite2-3:amd64 (1.3.14-2+b1) ... Selecting previously unselected package libharfbuzz0b:amd64. Preparing to unpack .../109-libharfbuzz0b_10.2.0-1+b1_amd64.deb ... Unpacking libharfbuzz0b:amd64 (10.2.0-1+b1) ... Selecting previously unselected package fontconfig. Preparing to unpack .../110-fontconfig_2.15.0-2.3_amd64.deb ... Unpacking fontconfig (2.15.0-2.3) ... Selecting previously unselected package libthai-data. Preparing to unpack .../111-libthai-data_0.1.29-2_all.deb ... Unpacking libthai-data (0.1.29-2) ... Selecting previously unselected package libdatrie1:amd64. Preparing to unpack .../112-libdatrie1_0.2.13-3+b1_amd64.deb ... Unpacking libdatrie1:amd64 (0.2.13-3+b1) ... Selecting previously unselected package libthai0:amd64. Preparing to unpack .../113-libthai0_0.1.29-2+b1_amd64.deb ... Unpacking libthai0:amd64 (0.1.29-2+b1) ... Selecting previously unselected package libpango-1.0-0:amd64. Preparing to unpack .../114-libpango-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpango-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libpangoft2-1.0-0:amd64. Preparing to unpack .../115-libpangoft2-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpangoft2-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libpangocairo-1.0-0:amd64. Preparing to unpack .../116-libpangocairo-1.0-0_1.56.3-1_amd64.deb ... Unpacking libpangocairo-1.0-0:amd64 (1.56.3-1) ... Selecting previously unselected package libwayland-client0:amd64. Preparing to unpack .../117-libwayland-client0_1.23.1-3_amd64.deb ... Unpacking libwayland-client0:amd64 (1.23.1-3) ... Selecting previously unselected package libwayland-cursor0:amd64. Preparing to unpack .../118-libwayland-cursor0_1.23.1-3_amd64.deb ... Unpacking libwayland-cursor0:amd64 (1.23.1-3) ... Selecting previously unselected package libwayland-egl1:amd64. Preparing to unpack .../119-libwayland-egl1_1.23.1-3_amd64.deb ... Unpacking libwayland-egl1:amd64 (1.23.1-3) ... Selecting previously unselected package libxcomposite1:amd64. Preparing to unpack .../120-libxcomposite1_1%3a0.4.6-1_amd64.deb ... Unpacking libxcomposite1:amd64 (1:0.4.6-1) ... Selecting previously unselected package libxfixes3:amd64. Preparing to unpack .../121-libxfixes3_1%3a6.0.0-2+b4_amd64.deb ... Unpacking libxfixes3:amd64 (1:6.0.0-2+b4) ... Selecting previously unselected package libxcursor1:amd64. Preparing to unpack .../122-libxcursor1_1%3a1.2.3-1_amd64.deb ... Unpacking libxcursor1:amd64 (1:1.2.3-1) ... Selecting previously unselected package libxdamage1:amd64. Preparing to unpack .../123-libxdamage1_1%3a1.1.6-1+b2_amd64.deb ... Unpacking libxdamage1:amd64 (1:1.1.6-1+b2) ... Selecting previously unselected package libxinerama1:amd64. Preparing to unpack .../124-libxinerama1_2%3a1.1.4-3+b4_amd64.deb ... Unpacking libxinerama1:amd64 (2:1.1.4-3+b4) ... Selecting previously unselected package xkb-data. Preparing to unpack .../125-xkb-data_2.42-1_all.deb ... Unpacking xkb-data (2.42-1) ... Selecting previously unselected package libxkbcommon0:amd64. Preparing to unpack .../126-libxkbcommon0_1.7.0-2_amd64.deb ... Unpacking libxkbcommon0:amd64 (1.7.0-2) ... Selecting previously unselected package libxrandr2:amd64. Preparing to unpack .../127-libxrandr2_2%3a1.5.4-1+b3_amd64.deb ... Unpacking libxrandr2:amd64 (2:1.5.4-1+b3) ... Selecting previously unselected package libgtk-3-common. Preparing to unpack .../128-libgtk-3-common_3.24.49-3_all.deb ... Unpacking libgtk-3-common (3.24.49-3) ... Selecting previously unselected package libgtk-3-0t64:amd64. Preparing to unpack .../129-libgtk-3-0t64_3.24.49-3_amd64.deb ... Unpacking libgtk-3-0t64:amd64 (3.24.49-3) ... Selecting previously unselected package libglvnd0:amd64. Preparing to unpack .../130-libglvnd0_1.7.0-1+b2_amd64.deb ... Unpacking libglvnd0:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libdrm-common. Preparing to unpack .../131-libdrm-common_2.4.124-2_all.deb ... Unpacking libdrm-common (2.4.124-2) ... Selecting previously unselected package libdrm2:amd64. Preparing to unpack .../132-libdrm2_2.4.124-2_amd64.deb ... Unpacking libdrm2:amd64 (2.4.124-2) ... Selecting previously unselected package libx11-xcb1:amd64. Preparing to unpack .../133-libx11-xcb1_2%3a1.8.12-1_amd64.deb ... Unpacking libx11-xcb1:amd64 (2:1.8.12-1) ... Selecting previously unselected package libxcb-dri3-0:amd64. Preparing to unpack .../134-libxcb-dri3-0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-dri3-0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-glx0:amd64. Preparing to unpack .../135-libxcb-glx0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-glx0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-present0:amd64. Preparing to unpack .../136-libxcb-present0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-present0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-xfixes0:amd64. Preparing to unpack .../137-libxcb-xfixes0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-xfixes0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxxf86vm1:amd64. Preparing to unpack .../138-libxxf86vm1_1%3a1.1.4-1+b4_amd64.deb ... Unpacking libxxf86vm1:amd64 (1:1.1.4-1+b4) ... Selecting previously unselected package libdrm-amdgpu1:amd64. Preparing to unpack .../139-libdrm-amdgpu1_2.4.124-2_amd64.deb ... Unpacking libdrm-amdgpu1:amd64 (2.4.124-2) ... Selecting previously unselected package libpciaccess0:amd64. Preparing to unpack .../140-libpciaccess0_0.17-3+b3_amd64.deb ... Unpacking libpciaccess0:amd64 (0.17-3+b3) ... Selecting previously unselected package libdrm-intel1:amd64. Preparing to unpack .../141-libdrm-intel1_2.4.124-2_amd64.deb ... Unpacking libdrm-intel1:amd64 (2.4.124-2) ... Selecting previously unselected package libedit2:amd64. Preparing to unpack .../142-libedit2_3.1-20250104-1_amd64.deb ... Unpacking libedit2:amd64 (3.1-20250104-1) ... Selecting previously unselected package libz3-4:amd64. Preparing to unpack .../143-libz3-4_4.13.3-1_amd64.deb ... Unpacking libz3-4:amd64 (4.13.3-1) ... Selecting previously unselected package libllvm19:amd64. Preparing to unpack .../144-libllvm19_1%3a19.1.7-3+b1_amd64.deb ... Unpacking libllvm19:amd64 (1:19.1.7-3+b1) ... Selecting previously unselected package libsensors-config. Preparing to unpack .../145-libsensors-config_1%3a3.6.2-2_all.deb ... Unpacking libsensors-config (1:3.6.2-2) ... Selecting previously unselected package libsensors5:amd64. Preparing to unpack .../146-libsensors5_1%3a3.6.2-2_amd64.deb ... Unpacking libsensors5:amd64 (1:3.6.2-2) ... Selecting previously unselected package libxcb-randr0:amd64. Preparing to unpack .../147-libxcb-randr0_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-randr0:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxcb-sync1:amd64. Preparing to unpack .../148-libxcb-sync1_1.17.0-2+b1_amd64.deb ... Unpacking libxcb-sync1:amd64 (1.17.0-2+b1) ... Selecting previously unselected package libxshmfence1:amd64. Preparing to unpack .../149-libxshmfence1_1.3.3-1_amd64.deb ... Unpacking libxshmfence1:amd64 (1.3.3-1) ... Selecting previously unselected package mesa-libgallium:amd64. Preparing to unpack .../150-mesa-libgallium_25.0.7-2_amd64.deb ... Unpacking mesa-libgallium:amd64 (25.0.7-2) ... Selecting previously unselected package libwayland-server0:amd64. Preparing to unpack .../151-libwayland-server0_1.23.1-3_amd64.deb ... Unpacking libwayland-server0:amd64 (1.23.1-3) ... Selecting previously unselected package libgbm1:amd64. Preparing to unpack .../152-libgbm1_25.0.7-2_amd64.deb ... Unpacking libgbm1:amd64 (25.0.7-2) ... Selecting previously unselected package libvulkan1:amd64. Preparing to unpack .../153-libvulkan1_1.4.309.0-1_amd64.deb ... Unpacking libvulkan1:amd64 (1.4.309.0-1) ... Selecting previously unselected package libgl1-mesa-dri:amd64. Preparing to unpack .../154-libgl1-mesa-dri_25.0.7-2_amd64.deb ... Unpacking libgl1-mesa-dri:amd64 (25.0.7-2) ... Selecting previously unselected package libglx-mesa0:amd64. Preparing to unpack .../155-libglx-mesa0_25.0.7-2_amd64.deb ... Unpacking libglx-mesa0:amd64 (25.0.7-2) ... Selecting previously unselected package libglx0:amd64. Preparing to unpack .../156-libglx0_1.7.0-1+b2_amd64.deb ... Unpacking libglx0:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libgl1:amd64. Preparing to unpack .../157-libgl1_1.7.0-1+b2_amd64.deb ... Unpacking libgl1:amd64 (1.7.0-1+b2) ... Selecting previously unselected package libasound2-data. Preparing to unpack .../158-libasound2-data_1.2.14-1_all.deb ... Unpacking libasound2-data (1.2.14-1) ... Selecting previously unselected package libasound2t64:amd64. Preparing to unpack .../159-libasound2t64_1.2.14-1_amd64.deb ... Unpacking libasound2t64:amd64 (1.2.14-1) ... Selecting previously unselected package libgif7:amd64. Preparing to unpack .../160-libgif7_5.2.2-1+b1_amd64.deb ... Unpacking libgif7:amd64 (5.2.2-1+b1) ... Selecting previously unselected package x11-common. Preparing to unpack .../161-x11-common_1%3a7.7+24_all.deb ... Unpacking x11-common (1:7.7+24) ... Selecting previously unselected package libxtst6:amd64. Preparing to unpack .../162-libxtst6_2%3a1.2.5-1_amd64.deb ... Unpacking libxtst6:amd64 (2:1.2.5-1) ... Selecting previously unselected package openjdk-21-jre:amd64. Preparing to unpack .../163-openjdk-21-jre_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jre:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jre. Preparing to unpack .../164-default-jre_2%3a1.21-76_amd64.deb ... Unpacking default-jre (2:1.21-76) ... Selecting previously unselected package openjdk-21-jdk-headless:amd64. Preparing to unpack .../165-openjdk-21-jdk-headless_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jdk-headless:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jdk-headless. Preparing to unpack .../166-default-jdk-headless_2%3a1.21-76_amd64.deb ... Unpacking default-jdk-headless (2:1.21-76) ... Selecting previously unselected package openjdk-21-jdk:amd64. Preparing to unpack .../167-openjdk-21-jdk_21.0.8+9-1_amd64.deb ... Unpacking openjdk-21-jdk:amd64 (21.0.8+9-1) ... Selecting previously unselected package default-jdk. Preparing to unpack .../168-default-jdk_2%3a1.21-76_amd64.deb ... Unpacking default-jdk (2:1.21-76) ... Selecting previously unselected package libgpg-error0:amd64. Preparing to unpack .../169-libgpg-error0_1.51-4_amd64.deb ... Unpacking libgpg-error0:amd64 (1.51-4) ... Selecting previously unselected package libassuan9:amd64. Preparing to unpack .../170-libassuan9_3.0.2-2_amd64.deb ... Unpacking libassuan9:amd64 (3.0.2-2) ... Selecting previously unselected package libgcrypt20:amd64. Preparing to unpack .../171-libgcrypt20_1.11.0-7_amd64.deb ... Unpacking libgcrypt20:amd64 (1.11.0-7) ... Selecting previously unselected package gpgconf. Preparing to unpack .../172-gpgconf_2.4.7-21+b3_amd64.deb ... Unpacking gpgconf (2.4.7-21+b3) ... Selecting previously unselected package libksba8:amd64. Preparing to unpack .../173-libksba8_1.6.7-2+b1_amd64.deb ... Unpacking libksba8:amd64 (1.6.7-2+b1) ... Selecting previously unselected package libnpth0t64:amd64. Preparing to unpack .../174-libnpth0t64_1.8-3_amd64.deb ... Unpacking libnpth0t64:amd64 (1.8-3) ... Selecting previously unselected package gpg. Preparing to unpack .../175-gpg_2.4.7-21+b3_amd64.deb ... Unpacking gpg (2.4.7-21+b3) ... Selecting previously unselected package pinentry-curses. Preparing to unpack .../176-pinentry-curses_1.3.1-2_amd64.deb ... Unpacking pinentry-curses (1.3.1-2) ... Selecting previously unselected package gpg-agent. Preparing to unpack .../177-gpg-agent_2.4.7-21+b3_amd64.deb ... Unpacking gpg-agent (2.4.7-21+b3) ... Selecting previously unselected package libfile-dirlist-perl. Preparing to unpack .../178-libfile-dirlist-perl_0.05-3_all.deb ... Unpacking libfile-dirlist-perl (0.05-3) ... Selecting previously unselected package libfile-which-perl. Preparing to unpack .../179-libfile-which-perl_1.27-2_all.deb ... Unpacking libfile-which-perl (1.27-2) ... Selecting previously unselected package libfile-homedir-perl. Preparing to unpack .../180-libfile-homedir-perl_1.006-2_all.deb ... Unpacking libfile-homedir-perl (1.006-2) ... Selecting previously unselected package libfile-touch-perl. Preparing to unpack .../181-libfile-touch-perl_0.12-2_all.deb ... Unpacking libfile-touch-perl (0.12-2) ... Selecting previously unselected package libclass-method-modifiers-perl. Preparing to unpack .../182-libclass-method-modifiers-perl_2.15-1_all.deb ... Unpacking libclass-method-modifiers-perl (2.15-1) ... Selecting previously unselected package libclass-xsaccessor-perl. Preparing to unpack .../183-libclass-xsaccessor-perl_1.19-4+b5_amd64.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b5) ... Selecting previously unselected package libb-hooks-op-check-perl:amd64. Preparing to unpack .../184-libb-hooks-op-check-perl_0.22-3+b2_amd64.deb ... Unpacking libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Selecting previously unselected package libdynaloader-functions-perl. Preparing to unpack .../185-libdynaloader-functions-perl_0.004-2_all.deb ... Unpacking libdynaloader-functions-perl (0.004-2) ... Selecting previously unselected package libdevel-callchecker-perl:amd64. Preparing to unpack .../186-libdevel-callchecker-perl_0.009-2_amd64.deb ... Unpacking libdevel-callchecker-perl:amd64 (0.009-2) ... Selecting previously unselected package libparams-classify-perl:amd64. Preparing to unpack .../187-libparams-classify-perl_0.015-2+b4_amd64.deb ... Unpacking libparams-classify-perl:amd64 (0.015-2+b4) ... Selecting previously unselected package libmodule-runtime-perl. Preparing to unpack .../188-libmodule-runtime-perl_0.018-1_all.deb ... Unpacking libmodule-runtime-perl (0.018-1) ... Selecting previously unselected package libimport-into-perl. Preparing to unpack .../189-libimport-into-perl_1.002005-2_all.deb ... Unpacking libimport-into-perl (1.002005-2) ... Selecting previously unselected package librole-tiny-perl. Preparing to unpack .../190-librole-tiny-perl_2.002004-1_all.deb ... Unpacking librole-tiny-perl (2.002004-1) ... Selecting previously unselected package libsub-quote-perl. Preparing to unpack .../191-libsub-quote-perl_2.006008-1_all.deb ... Unpacking libsub-quote-perl (2.006008-1) ... Selecting previously unselected package libmoo-perl. Preparing to unpack .../192-libmoo-perl_2.005005-1_all.deb ... Unpacking libmoo-perl (2.005005-1) ... Selecting previously unselected package libencode-locale-perl. Preparing to unpack .../193-libencode-locale-perl_1.05-3_all.deb ... Unpacking libencode-locale-perl (1.05-3) ... Selecting previously unselected package libtimedate-perl. Preparing to unpack .../194-libtimedate-perl_2.3300-2_all.deb ... Unpacking libtimedate-perl (2.3300-2) ... Selecting previously unselected package libhttp-date-perl. Preparing to unpack .../195-libhttp-date-perl_6.06-1_all.deb ... Unpacking libhttp-date-perl (6.06-1) ... Selecting previously unselected package libfile-listing-perl. Preparing to unpack .../196-libfile-listing-perl_6.16-1_all.deb ... Unpacking libfile-listing-perl (6.16-1) ... Selecting previously unselected package libhtml-tagset-perl. Preparing to unpack .../197-libhtml-tagset-perl_3.24-1_all.deb ... Unpacking libhtml-tagset-perl (3.24-1) ... Selecting previously unselected package liburi-perl. Preparing to unpack .../198-liburi-perl_5.30-1_all.deb ... Unpacking liburi-perl (5.30-1) ... Selecting previously unselected package libhtml-parser-perl:amd64. Preparing to unpack .../199-libhtml-parser-perl_3.83-1+b2_amd64.deb ... Unpacking libhtml-parser-perl:amd64 (3.83-1+b2) ... Selecting previously unselected package libhtml-tree-perl. Preparing to unpack .../200-libhtml-tree-perl_5.07-3_all.deb ... Unpacking libhtml-tree-perl (5.07-3) ... Selecting previously unselected package libclone-perl:amd64. Preparing to unpack .../201-libclone-perl_0.47-1+b1_amd64.deb ... Unpacking libclone-perl:amd64 (0.47-1+b1) ... Selecting previously unselected package libio-html-perl. Preparing to unpack .../202-libio-html-perl_1.004-3_all.deb ... Unpacking libio-html-perl (1.004-3) ... Selecting previously unselected package liblwp-mediatypes-perl. Preparing to unpack .../203-liblwp-mediatypes-perl_6.04-2_all.deb ... Unpacking liblwp-mediatypes-perl (6.04-2) ... Selecting previously unselected package libhttp-message-perl. Preparing to unpack .../204-libhttp-message-perl_7.00-2_all.deb ... Unpacking libhttp-message-perl (7.00-2) ... Selecting previously unselected package libhttp-cookies-perl. Preparing to unpack .../205-libhttp-cookies-perl_6.11-1_all.deb ... Unpacking libhttp-cookies-perl (6.11-1) ... Selecting previously unselected package libhttp-negotiate-perl. Preparing to unpack .../206-libhttp-negotiate-perl_6.01-2_all.deb ... Unpacking libhttp-negotiate-perl (6.01-2) ... Selecting previously unselected package perl-openssl-defaults:amd64. Preparing to unpack .../207-perl-openssl-defaults_7+b2_amd64.deb ... Unpacking perl-openssl-defaults:amd64 (7+b2) ... Selecting previously unselected package libnet-ssleay-perl:amd64. Preparing to unpack .../208-libnet-ssleay-perl_1.94-3_amd64.deb ... Unpacking libnet-ssleay-perl:amd64 (1.94-3) ... Selecting previously unselected package libio-socket-ssl-perl. Preparing to unpack .../209-libio-socket-ssl-perl_2.089-1_all.deb ... Unpacking libio-socket-ssl-perl (2.089-1) ... Selecting previously unselected package libnet-http-perl. Preparing to unpack .../210-libnet-http-perl_6.23-1_all.deb ... Unpacking libnet-http-perl (6.23-1) ... Selecting previously unselected package liblwp-protocol-https-perl. Preparing to unpack .../211-liblwp-protocol-https-perl_6.14-1_all.deb ... Unpacking liblwp-protocol-https-perl (6.14-1) ... Selecting previously unselected package libtry-tiny-perl. Preparing to unpack .../212-libtry-tiny-perl_0.32-1_all.deb ... Unpacking libtry-tiny-perl (0.32-1) ... Selecting previously unselected package libwww-robotrules-perl. Preparing to unpack .../213-libwww-robotrules-perl_6.02-1_all.deb ... Unpacking libwww-robotrules-perl (6.02-1) ... Selecting previously unselected package libwww-perl. Preparing to unpack .../214-libwww-perl_6.78-1_all.deb ... Unpacking libwww-perl (6.78-1) ... Selecting previously unselected package patchutils. Preparing to unpack .../215-patchutils_0.4.2-1_amd64.deb ... Unpacking patchutils (0.4.2-1) ... Selecting previously unselected package gpgv. Preparing to unpack .../216-gpgv_2.4.7-21+b3_amd64.deb ... Unpacking gpgv (2.4.7-21+b3) ... Selecting previously unselected package sopv-gpgv. Preparing to unpack .../217-sopv-gpgv_0.1.4-1_all.deb ... Unpacking sopv-gpgv (0.1.4-1) ... Selecting previously unselected package wdiff. Preparing to unpack .../218-wdiff_1.2.2-9_amd64.deb ... Unpacking wdiff (1.2.2-9) ... Selecting previously unselected package devscripts. Preparing to unpack .../219-devscripts_2.25.15_all.deb ... Unpacking devscripts (2.25.15) ... Selecting previously unselected package fastjar. Preparing to unpack .../220-fastjar_2%3a0.98-7_amd64.deb ... Unpacking fastjar (2:0.98-7) ... Selecting previously unselected package jarwrapper. Preparing to unpack .../221-jarwrapper_0.80_all.deb ... Unpacking jarwrapper (0.80) ... Selecting previously unselected package javahelper. Preparing to unpack .../222-javahelper_0.80_all.deb ... Unpacking javahelper (0.80) ... Selecting previously unselected package libhamcrest-java. Preparing to unpack .../223-libhamcrest-java_2.2-2_all.deb ... Unpacking libhamcrest-java (2.2-2) ... Selecting previously unselected package junit4. Preparing to unpack .../224-junit4_4.13.2-5_all.deb ... Unpacking junit4 (4.13.2-5) ... Selecting previously unselected package libapiguardian-java. Preparing to unpack .../225-libapiguardian-java_1.1.2-1_all.deb ... Unpacking libapiguardian-java (1.1.2-1) ... Selecting previously unselected package libopentest4j-java. Preparing to unpack .../226-libopentest4j-java_1.2.0-4_all.deb ... Unpacking libopentest4j-java (1.2.0-4) ... Selecting previously unselected package libopentest4j-reporting-java. Preparing to unpack .../227-libopentest4j-reporting-java_0.1.0-M1-2_all.deb ... Unpacking libopentest4j-reporting-java (0.1.0-M1-2) ... Selecting previously unselected package libpicocli-java. Preparing to unpack .../228-libpicocli-java_4.6.2-2_all.deb ... Unpacking libpicocli-java (4.6.2-2) ... Selecting previously unselected package libunivocity-parsers-java. Preparing to unpack .../229-libunivocity-parsers-java_2.9.1-1_all.deb ... Unpacking libunivocity-parsers-java (2.9.1-1) ... Selecting previously unselected package junit5. Preparing to unpack .../230-junit5_5.10.3-1_all.deb ... Unpacking junit5 (5.10.3-1) ... Selecting previously unselected package libactivation-java. Preparing to unpack .../231-libactivation-java_1.2.0-2_all.deb ... Unpacking libactivation-java (1.2.0-2) ... Selecting previously unselected package libaopalliance-java. Preparing to unpack .../232-libaopalliance-java_20070526-7_all.deb ... Unpacking libaopalliance-java (20070526-7) ... Selecting previously unselected package libapache-pom-java. Preparing to unpack .../233-libapache-pom-java_33-2_all.deb ... Unpacking libapache-pom-java (33-2) ... Selecting previously unselected package libasm-java. Preparing to unpack .../234-libasm-java_9.8-1_all.deb ... Unpacking libasm-java (9.8-1) ... Selecting previously unselected package libatinject-jsr330-api-java. Preparing to unpack .../235-libatinject-jsr330-api-java_1.0+ds1-6_all.deb ... Unpacking libatinject-jsr330-api-java (1.0+ds1-6) ... Selecting previously unselected package libcommons-parent-java. Preparing to unpack .../236-libcommons-parent-java_56-1_all.deb ... Unpacking libcommons-parent-java (56-1) ... Selecting previously unselected package libcommons-lang3-java. Preparing to unpack .../237-libcommons-lang3-java_3.17.0-1_all.deb ... Unpacking libcommons-lang3-java (3.17.0-1) ... Selecting previously unselected package libfreemarker-java. Preparing to unpack .../238-libfreemarker-java_2.3.32-2.1_all.deb ... Unpacking libfreemarker-java (2.3.32-2.1) ... Selecting previously unselected package libgoogle-gson-java. Preparing to unpack .../239-libgoogle-gson-java_2.10.1-1_all.deb ... Unpacking libgoogle-gson-java (2.10.1-1) ... Selecting previously unselected package libjoptsimple-java. Preparing to unpack .../240-libjoptsimple-java_5.0.4-7_all.deb ... Unpacking libjoptsimple-java (5.0.4-7) ... Selecting previously unselected package libcommons-codec-java. Preparing to unpack .../241-libcommons-codec-java_1.18.0-1_all.deb ... Unpacking libcommons-codec-java (1.18.0-1) ... Selecting previously unselected package libcommons-logging-java. Preparing to unpack .../242-libcommons-logging-java_1.3.0-2_all.deb ... Unpacking libcommons-logging-java (1.3.0-2) ... Selecting previously unselected package libhttpcore-java. Preparing to unpack .../243-libhttpcore-java_4.4.16-1_all.deb ... Unpacking libhttpcore-java (4.4.16-1) ... Selecting previously unselected package libhttpclient-java. Preparing to unpack .../244-libhttpclient-java_4.5.14-1_all.deb ... Unpacking libhttpclient-java (4.5.14-1) ... Selecting previously unselected package liblightcouch-java. Preparing to unpack .../245-liblightcouch-java_0.2.0-1_all.deb ... Unpacking liblightcouch-java (0.2.0-1) ... Selecting previously unselected package libmongodb-java. Preparing to unpack .../246-libmongodb-java_3.6.3-2_all.deb ... Unpacking libmongodb-java (3.6.3-2) ... Selecting previously unselected package libslf4j-java. Preparing to unpack .../247-libslf4j-java_1.7.32-2_all.deb ... Unpacking libslf4j-java (1.7.32-2) ... Selecting previously unselected package liblog4j2-java. Preparing to unpack .../248-liblog4j2-java_2.19.0-2_all.deb ... Unpacking liblog4j2-java (2.19.0-2) ... Selecting previously unselected package libbarclay-java. Preparing to unpack .../249-libbarclay-java_5.0.0+dfsg-1_all.deb ... Unpacking libbarclay-java (5.0.0+dfsg-1) ... Selecting previously unselected package libblas3:amd64. Preparing to unpack .../250-libblas3_3.12.1-4_amd64.deb ... Unpacking libblas3:amd64 (3.12.1-4) ... Selecting previously unselected package libbsh-java. Preparing to unpack .../251-libbsh-java_2.0b4-20_all.deb ... Unpacking libbsh-java (2.0b4-20) ... Selecting previously unselected package libcommons-io-java. Preparing to unpack .../252-libcommons-io-java_2.19.0-1_all.deb ... Unpacking libcommons-io-java (2.19.0-1) ... Selecting previously unselected package libmaven-shared-utils-java. Preparing to unpack .../253-libmaven-shared-utils-java_3.4.2-1_all.deb ... Unpacking libmaven-shared-utils-java (3.4.2-1) ... Selecting previously unselected package libcommons-cli-java. Preparing to unpack .../254-libcommons-cli-java_1.6.0-1_all.deb ... Unpacking libcommons-cli-java (1.6.0-1) ... Selecting previously unselected package libgeronimo-annotation-1.3-spec-java. Preparing to unpack .../255-libgeronimo-annotation-1.3-spec-java_1.3-1_all.deb ... Unpacking libgeronimo-annotation-1.3-spec-java (1.3-1) ... Selecting previously unselected package liberror-prone-java. Preparing to unpack .../256-liberror-prone-java_2.18.0-1_all.deb ... Unpacking liberror-prone-java (2.18.0-1) ... Selecting previously unselected package libjsr305-java. Preparing to unpack .../257-libjsr305-java_0.1~+svn49-12_all.deb ... Unpacking libjsr305-java (0.1~+svn49-12) ... Selecting previously unselected package libguava-java. Preparing to unpack .../258-libguava-java_32.0.1-1_all.deb ... Unpacking libguava-java (32.0.1-1) ... Selecting previously unselected package libguice-java. Preparing to unpack .../259-libguice-java_5.1.0-1_all.deb ... Unpacking libguice-java (5.1.0-1) ... Selecting previously unselected package libmaven-parent-java. Preparing to unpack .../260-libmaven-parent-java_43-2_all.deb ... Unpacking libmaven-parent-java (43-2) ... Selecting previously unselected package libplexus-utils2-java. Preparing to unpack .../261-libplexus-utils2-java_3.4.2-1_all.deb ... Unpacking libplexus-utils2-java (3.4.2-1) ... Selecting previously unselected package libwagon-provider-api-java. Preparing to unpack .../262-libwagon-provider-api-java_3.5.3-2_all.deb ... Unpacking libwagon-provider-api-java (3.5.3-2) ... Selecting previously unselected package libmaven-resolver-java. Preparing to unpack .../263-libmaven-resolver-java_1.9.22-1_all.deb ... Unpacking libmaven-resolver-java (1.9.22-1) ... Selecting previously unselected package libplexus-cipher-java. Preparing to unpack .../264-libplexus-cipher-java_2.0-1_all.deb ... Unpacking libplexus-cipher-java (2.0-1) ... Selecting previously unselected package libplexus-classworlds-java. Preparing to unpack .../265-libplexus-classworlds-java_2.7.0-1_all.deb ... Unpacking libplexus-classworlds-java (2.7.0-1) ... Selecting previously unselected package libplexus-component-annotations-java. Preparing to unpack .../266-libplexus-component-annotations-java_2.1.1-1_all.deb ... Unpacking libplexus-component-annotations-java (2.1.1-1) ... Selecting previously unselected package libplexus-interpolation-java. Preparing to unpack .../267-libplexus-interpolation-java_1.27-1_all.deb ... Unpacking libplexus-interpolation-java (1.27-1) ... Selecting previously unselected package libplexus-sec-dispatcher-java. Preparing to unpack .../268-libplexus-sec-dispatcher-java_2.0-3_all.deb ... Unpacking libplexus-sec-dispatcher-java (2.0-3) ... Selecting previously unselected package libgeronimo-interceptor-3.0-spec-java. Preparing to unpack .../269-libgeronimo-interceptor-3.0-spec-java_1.0.1-5_all.deb ... Unpacking libgeronimo-interceptor-3.0-spec-java (1.0.1-5) ... Selecting previously unselected package libcdi-api-java. Preparing to unpack .../270-libcdi-api-java_1.2-4_all.deb ... Unpacking libcdi-api-java (1.2-4) ... Selecting previously unselected package libsisu-inject-java. Preparing to unpack .../271-libsisu-inject-java_0.3.5-1_all.deb ... Unpacking libsisu-inject-java (0.3.5-1) ... Selecting previously unselected package libsisu-plexus-java. Preparing to unpack .../272-libsisu-plexus-java_0.3.5-1_all.deb ... Unpacking libsisu-plexus-java (0.3.5-1) ... Selecting previously unselected package libmaven3-core-java. Preparing to unpack .../273-libmaven3-core-java_3.9.9-1_all.deb ... Unpacking libmaven3-core-java (3.9.9-1) ... Selecting previously unselected package libmaven-shared-io-java. Preparing to unpack .../274-libmaven-shared-io-java_3.0.0-4_all.deb ... Unpacking libmaven-shared-io-java (3.0.0-4) ... Selecting previously unselected package libmaven-file-management-java. Preparing to unpack .../275-libmaven-file-management-java_3.0.0-2_all.deb ... Unpacking libmaven-file-management-java (3.0.0-2) ... Selecting previously unselected package libbuild-helper-maven-plugin-java. Preparing to unpack .../276-libbuild-helper-maven-plugin-java_3.3.0-1_all.deb ... Unpacking libbuild-helper-maven-plugin-java (3.3.0-1) ... Selecting previously unselected package libbyte-buddy-java. Preparing to unpack .../277-libbyte-buddy-java_1.14.19-1_all.deb ... Unpacking libbyte-buddy-java (1.14.19-1) ... Selecting previously unselected package libcolt-free-java. Preparing to unpack .../278-libcolt-free-java_1.2.0+dfsg-8_all.deb ... Unpacking libcolt-free-java (1.2.0+dfsg-8) ... Selecting previously unselected package libcommons-collections3-java. Preparing to unpack .../279-libcommons-collections3-java_3.2.2-3_all.deb ... Unpacking libcommons-collections3-java (3.2.2-3) ... Selecting previously unselected package libcommons-beanutils-java. Preparing to unpack .../280-libcommons-beanutils-java_1.10.1-1.1_all.deb ... Unpacking libcommons-beanutils-java (1.10.1-1.1) ... Selecting previously unselected package libcommons-collections4-java. Preparing to unpack .../281-libcommons-collections4-java_4.4-2_all.deb ... Unpacking libcommons-collections4-java (4.4-2) ... Selecting previously unselected package libcommons-compress-java. Preparing to unpack .../282-libcommons-compress-java_1.27.1-2_all.deb ... Unpacking libcommons-compress-java (1.27.1-2) ... Selecting previously unselected package libcommons-lang-java. Preparing to unpack .../283-libcommons-lang-java_2.6-10_all.deb ... Unpacking libcommons-lang-java (2.6-10) ... Selecting previously unselected package libcommons-configuration-java. Preparing to unpack .../284-libcommons-configuration-java_1.10-7_all.deb ... Unpacking libcommons-configuration-java (1.10-7) ... Selecting previously unselected package libcommons-digester-java. Preparing to unpack .../285-libcommons-digester-java_1.8.1-7_all.deb ... Unpacking libcommons-digester-java (1.8.1-7) ... Selecting previously unselected package libcommons-exec-java. Preparing to unpack .../286-libcommons-exec-java_1.3-3_all.deb ... Unpacking libcommons-exec-java (1.3-3) ... Selecting previously unselected package libcommons-jexl2-java. Preparing to unpack .../287-libcommons-jexl2-java_2.1.1-6_all.deb ... Unpacking libcommons-jexl2-java (2.1.1-6) ... Selecting previously unselected package libcommons-math-java. Preparing to unpack .../288-libcommons-math-java_2.2-9_all.deb ... Unpacking libcommons-math-java (2.2-9) ... Selecting previously unselected package libcommons-math3-java. Preparing to unpack .../289-libcommons-math3-java_3.6.1-4_all.deb ... Unpacking libcommons-math3-java (3.6.1-4) ... Selecting previously unselected package libplexus-io-java. Preparing to unpack .../290-libplexus-io-java_3.3.1-2_all.deb ... Unpacking libplexus-io-java (3.3.1-2) ... Selecting previously unselected package libsnappy1v5:amd64. Preparing to unpack .../291-libsnappy1v5_1.2.2-1_amd64.deb ... Unpacking libsnappy1v5:amd64 (1.2.2-1) ... Selecting previously unselected package libsnappy-jni. Preparing to unpack .../292-libsnappy-jni_1.1.10.7-1_amd64.deb ... Unpacking libsnappy-jni (1.1.10.7-1) ... Selecting previously unselected package libsnappy-java. Preparing to unpack .../293-libsnappy-java_1.1.10.7-1_all.deb ... Unpacking libsnappy-java (1.1.10.7-1) ... Selecting previously unselected package libxz-java. Preparing to unpack .../294-libxz-java_1.9-1_all.deb ... Unpacking libxz-java (1.9-1) ... Selecting previously unselected package libplexus-archiver-java. Preparing to unpack .../295-libplexus-archiver-java_4.6.1-1_all.deb ... Unpacking libplexus-archiver-java (4.6.1-1) ... Selecting previously unselected package libmaven-archiver-java. Preparing to unpack .../296-libmaven-archiver-java_3.6.2-1_all.deb ... Unpacking libmaven-archiver-java (3.6.2-1) ... Selecting previously unselected package libmaven-jar-plugin-java. Preparing to unpack .../297-libmaven-jar-plugin-java_3.3.0-2_all.deb ... Unpacking libmaven-jar-plugin-java (3.3.0-2) ... Selecting previously unselected package libcommons-text-java. Preparing to unpack .../298-libcommons-text-java_1.13.1-1_all.deb ... Unpacking libcommons-text-java (1.13.1-1) ... Selecting previously unselected package sgml-base. Preparing to unpack .../299-sgml-base_1.31+nmu1_all.deb ... Unpacking sgml-base (1.31+nmu1) ... Selecting previously unselected package libcommons-validator-java. Preparing to unpack .../300-libcommons-validator-java_1%3a1.9.0-1_all.deb ... Unpacking libcommons-validator-java (1:1.9.0-1) ... Selecting previously unselected package libsasl2-modules-db:amd64. Preparing to unpack .../301-libsasl2-modules-db_2.1.28+dfsg1-9_amd64.deb ... Unpacking libsasl2-modules-db:amd64 (2.1.28+dfsg1-9) ... Selecting previously unselected package libsasl2-2:amd64. Preparing to unpack .../302-libsasl2-2_2.1.28+dfsg1-9_amd64.deb ... Unpacking libsasl2-2:amd64 (2.1.28+dfsg1-9) ... Selecting previously unselected package libldap2:amd64. Preparing to unpack .../303-libldap2_2.6.10+dfsg-1_amd64.deb ... Unpacking libldap2:amd64 (2.6.10+dfsg-1) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../304-libnghttp2-14_1.64.0-1.1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.64.0-1.1) ... Selecting previously unselected package libnghttp3-9:amd64. Preparing to unpack .../305-libnghttp3-9_1.8.0-1_amd64.deb ... Unpacking libnghttp3-9:amd64 (1.8.0-1) ... Selecting previously unselected package libpsl5t64:amd64. Preparing to unpack .../306-libpsl5t64_0.21.2-1.1+b1_amd64.deb ... Unpacking libpsl5t64:amd64 (0.21.2-1.1+b1) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../307-librtmp1_2.4+20151223.gitfa8646d.1-2+b5_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b5) ... Selecting previously unselected package libssh2-1t64:amd64. Preparing to unpack .../308-libssh2-1t64_1.11.1-1_amd64.deb ... Unpacking libssh2-1t64:amd64 (1.11.1-1) ... Selecting previously unselected package libcurl4t64:amd64. Preparing to unpack .../309-libcurl4t64_8.14.1-2_amd64.deb ... Unpacking libcurl4t64:amd64 (8.14.1-2) ... Selecting previously unselected package libdistlib-java. Preparing to unpack .../310-libdistlib-java_1.0-5_all.deb ... Unpacking libdistlib-java (1.0-5) ... Selecting previously unselected package libjaxen-java. Preparing to unpack .../311-libjaxen-java_1.1.6-5_all.deb ... Unpacking libjaxen-java (1.1.6-5) ... Selecting previously unselected package libdom4j-java. Preparing to unpack .../312-libdom4j-java_2.1.4-1_all.deb ... Unpacking libdom4j-java (2.1.4-1) ... Selecting previously unselected package libdoxia-core-java. Preparing to unpack .../313-libdoxia-core-java_2.0.0-1_all.deb ... Unpacking libdoxia-core-java (2.0.0-1) ... Selecting previously unselected package libplexus-xml-java. Preparing to unpack .../314-libplexus-xml-java_3.0.1-2_all.deb ... Unpacking libplexus-xml-java (3.0.1-2) ... Selecting previously unselected package libdoxia-java. Preparing to unpack .../315-libdoxia-java_2.0.0-1_all.deb ... Unpacking libdoxia-java (2.0.0-1) ... Selecting previously unselected package libmaven-reporting-api-java. Preparing to unpack .../316-libmaven-reporting-api-java_4.0.0-1_all.deb ... Unpacking libmaven-reporting-api-java (4.0.0-1) ... Selecting previously unselected package libxbean-reflect-java. Preparing to unpack .../317-libxbean-reflect-java_4.5-9_all.deb ... Unpacking libxbean-reflect-java (4.5-9) ... Selecting previously unselected package libplexus-container-default-java. Preparing to unpack .../318-libplexus-container-default-java_2.1.1-1_all.deb ... Unpacking libplexus-container-default-java (2.1.1-1) ... Selecting previously unselected package libplexus-i18n-java. Preparing to unpack .../319-libplexus-i18n-java_1.0-beta-10-6_all.deb ... Unpacking libplexus-i18n-java (1.0-beta-10-6) ... Selecting previously unselected package velocity. Preparing to unpack .../320-velocity_1.7-7_all.deb ... Unpacking velocity (1.7-7) ... Selecting previously unselected package libplexus-velocity-java. Preparing to unpack .../321-libplexus-velocity-java_1.2-4_all.deb ... Unpacking libplexus-velocity-java (1.2-4) ... Selecting previously unselected package liboro-java. Preparing to unpack .../322-liboro-java_2.0.8a-15_all.deb ... Unpacking liboro-java (2.0.8a-15) ... Selecting previously unselected package libvelocity-tools-java. Preparing to unpack .../323-libvelocity-tools-java_2.0-9_all.deb ... Unpacking libvelocity-tools-java (2.0-9) ... Selecting previously unselected package libdoxia-sitetools-java. Preparing to unpack .../324-libdoxia-sitetools-java_2.0.0-1_all.deb ... Unpacking libdoxia-sitetools-java (2.0.0-1) ... Selecting previously unselected package libfastutil-java. Preparing to unpack .../325-libfastutil-java_8.5.15+dfsg-1_all.deb ... Unpacking libfastutil-java (8.5.15+dfsg-1) ... Selecting previously unselected package libxpp3-java. Preparing to unpack .../326-libxpp3-java_1.1.4c-4_all.deb ... Unpacking libxpp3-java (1.1.4c-4) ... Selecting previously unselected package libxstream-java. Preparing to unpack .../327-libxstream-java_1.4.21-1_all.deb ... Unpacking libxstream-java (1.4.21-1) ... Selecting previously unselected package libjsap-java. Preparing to unpack .../328-libjsap-java_2.1-5_all.deb ... Unpacking libjsap-java (2.1-5) ... Selecting previously unselected package liblogback-java. Preparing to unpack .../329-liblogback-java_1%3a1.2.11-6_all.deb ... Unpacking liblogback-java (1:1.2.11-6) ... Selecting previously unselected package libdsiutils-java. Preparing to unpack .../330-libdsiutils-java_2.7.3+dfsg-1_all.deb ... Unpacking libdsiutils-java (2.7.3+dfsg-1) ... Selecting previously unselected package libobjenesis-java. Preparing to unpack .../331-libobjenesis-java_3.4-2_all.deb ... Unpacking libobjenesis-java (3.4-2) ... Selecting previously unselected package libeasymock-java. Preparing to unpack .../332-libeasymock-java_5.5.0-1_all.deb ... Unpacking libeasymock-java (5.5.0-1) ... Selecting previously unselected package libel-api-java. Preparing to unpack .../333-libel-api-java_3.0.0-3_all.deb ... Unpacking libel-api-java (3.0.0-3) ... Selecting previously unselected package libexec-maven-plugin-java. Preparing to unpack .../334-libexec-maven-plugin-java_3.1.0-2_all.deb ... Unpacking libexec-maven-plugin-java (3.1.0-2) ... Selecting previously unselected package libezmorph-java. Preparing to unpack .../335-libezmorph-java_1.0.6-4_all.deb ... Unpacking libezmorph-java (1.0.6-4) ... Selecting previously unselected package libgatk-native-bindings-java. Preparing to unpack .../336-libgatk-native-bindings-java_1.0.0+dfsg-2_all.deb ... Unpacking libgatk-native-bindings-java (1.0.0+dfsg-2) ... Selecting previously unselected package libgfortran5:amd64. Preparing to unpack .../337-libgfortran5_14.2.0-19_amd64.deb ... Unpacking libgfortran5:amd64 (14.2.0-19) ... Selecting previously unselected package libxml-commons-external-java. Preparing to unpack .../338-libxml-commons-external-java_1.4.01-6_all.deb ... Unpacking libxml-commons-external-java (1.4.01-6) ... Selecting previously unselected package libxml-commons-resolver1.1-java. Preparing to unpack .../339-libxml-commons-resolver1.1-java_1.2-11_all.deb ... Unpacking libxml-commons-resolver1.1-java (1.2-11) ... Selecting previously unselected package libxerces2-java. Preparing to unpack .../340-libxerces2-java_2.12.2-1_all.deb ... Unpacking libxerces2-java (2.12.2-1) ... Selecting previously unselected package libxom-java. Preparing to unpack .../341-libxom-java_1.3.9-1_all.deb ... Unpacking libxom-java (1.3.9-1) ... Selecting previously unselected package libjson-java. Preparing to unpack .../342-libjson-java_3.1.0+dfsg-2_all.deb ... Unpacking libjson-java (3.1.0+dfsg-2) ... Selecting previously unselected package libmbedcrypto16:amd64. Preparing to unpack .../343-libmbedcrypto16_3.6.4-2_amd64.deb ... Unpacking libmbedcrypto16:amd64 (3.6.4-2) ... Selecting previously unselected package libmbedx509-7:amd64. Preparing to unpack .../344-libmbedx509-7_3.6.4-2_amd64.deb ... Unpacking libmbedx509-7:amd64 (3.6.4-2) ... Selecting previously unselected package libmbedtls21:amd64. Preparing to unpack .../345-libmbedtls21_3.6.4-2_amd64.deb ... Unpacking libmbedtls21:amd64 (3.6.4-2) ... Selecting previously unselected package ncbi-vdb-data. Preparing to unpack .../346-ncbi-vdb-data_3.2.1+dfsg-2_all.deb ... Unpacking ncbi-vdb-data (3.2.1+dfsg-2) ... Selecting previously unselected package libncbi-vdb3:amd64. Preparing to unpack .../347-libncbi-vdb3_3.2.1+dfsg-2_amd64.deb ... Unpacking libncbi-vdb3:amd64 (3.2.1+dfsg-2) ... Selecting previously unselected package libncbi-ngs3:amd64. Preparing to unpack .../348-libncbi-ngs3_3.2.1+dfsg-4_amd64.deb ... Unpacking libncbi-ngs3:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package libngs-jni:amd64. Preparing to unpack .../349-libngs-jni_3.2.1+dfsg-4_amd64.deb ... Unpacking libngs-jni:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package libngs-java:amd64. Preparing to unpack .../350-libngs-java_3.2.1+dfsg-4_amd64.deb ... Unpacking libngs-java:amd64 (3.2.1+dfsg-4) ... Selecting previously unselected package librhino-java. Preparing to unpack .../351-librhino-java_1.7.15-1_all.deb ... Unpacking librhino-java (1.7.15-1) ... Selecting previously unselected package libhtsjdk-java. Preparing to unpack .../352-libhtsjdk-java_4.1.3+dfsg-2_all.deb ... Unpacking libhtsjdk-java (4.1.3+dfsg-2) ... Selecting previously unselected package libgkl-java. Preparing to unpack .../353-libgkl-java_0.8.11+dfsg-2_all.deb ... Unpacking libgkl-java (0.8.11+dfsg-2) ... Selecting previously unselected package libicu4j-java. Preparing to unpack .../354-libicu4j-java_73.2-1_all.deb ... Unpacking libicu4j-java (73.2-1) ... Selecting previously unselected package liblog4j1.2-java. Preparing to unpack .../355-liblog4j1.2-java_1.2.17-11_all.deb ... Unpacking liblog4j1.2-java (1.2.17-11) ... Selecting previously unselected package libicb-utils-java. Preparing to unpack .../356-libicb-utils-java_2.0.1+git20161002.afee1d9-5_all.deb ... Unpacking libicb-utils-java (2.0.1+git20161002.afee1d9-5) ... Selecting previously unselected package libice6:amd64. Preparing to unpack .../357-libice6_2%3a1.1.1-1_amd64.deb ... Unpacking libice6:amd64 (2:1.1.1-1) ... Selecting previously unselected package libicu76:amd64. Preparing to unpack .../358-libicu76_76.1-4_amd64.deb ... Unpacking libicu76:amd64 (76.1-4) ... Selecting previously unselected package libjansi-java. Preparing to unpack .../359-libjansi-java_2.4.1-2_all.deb ... Unpacking libjansi-java (2.4.1-2) ... Selecting previously unselected package libjavassist-java. Preparing to unpack .../360-libjavassist-java_1%3a3.27.0-1_all.deb ... Unpacking libjavassist-java (1:3.27.0-1) ... Selecting previously unselected package libjaxb-api-java. Preparing to unpack .../361-libjaxb-api-java_2.3.1-1_all.deb ... Unpacking libjaxb-api-java (2.3.1-1) ... Selecting previously unselected package libjboss-logging-java. Preparing to unpack .../362-libjboss-logging-java_3.5.3-1_all.deb ... Unpacking libjboss-logging-java (3.5.3-1) ... Selecting previously unselected package libjboss-vfs-java. Preparing to unpack .../363-libjboss-vfs-java_3.2.15.Final-3_all.deb ... Unpacking libjboss-vfs-java (3.2.15.Final-3) ... Selecting previously unselected package libjbzip2-java. Preparing to unpack .../364-libjbzip2-java_0.9.1-8_all.deb ... Unpacking libjbzip2-java (0.9.1-8) ... Selecting previously unselected package libjcommander-java. Preparing to unpack .../365-libjcommander-java_1.71-4_all.deb ... Unpacking libjcommander-java (1.71-4) ... Selecting previously unselected package libjsp-api-java. Preparing to unpack .../366-libjsp-api-java_2.3.4-3_all.deb ... Unpacking libjsp-api-java (2.3.4-3) ... Selecting previously unselected package libservlet-api-java. Preparing to unpack .../367-libservlet-api-java_4.0.1-2_all.deb ... Unpacking libservlet-api-java (4.0.1-2) ... Selecting previously unselected package libwebsocket-api-java. Preparing to unpack .../368-libwebsocket-api-java_1.1-2_all.deb ... Unpacking libwebsocket-api-java (1.1-2) ... Selecting previously unselected package libjetty9-java. Preparing to unpack .../369-libjetty9-java_9.4.57-1_all.deb ... Unpacking libjetty9-java (9.4.57-1) ... Selecting previously unselected package libjsoup-java. Preparing to unpack .../370-libjsoup-java_1.15.3-1_all.deb ... Unpacking libjsoup-java (1.15.3-1) ... Selecting previously unselected package libjtidy-java. Preparing to unpack .../371-libjtidy-java_7+svn20110807-6_all.deb ... Unpacking libjtidy-java (7+svn20110807-6) ... Selecting previously unselected package liblapack3:amd64. Preparing to unpack .../372-liblapack3_3.12.1-4_amd64.deb ... Unpacking liblapack3:amd64 (3.12.1-4) ... Selecting previously unselected package libmaven-antrun-plugin-java. Preparing to unpack .../373-libmaven-antrun-plugin-java_3.1.0-1_all.deb ... Unpacking libmaven-antrun-plugin-java (3.1.0-1) ... Selecting previously unselected package libmaven-common-artifact-filters-java. Preparing to unpack .../374-libmaven-common-artifact-filters-java_3.4.0-1_all.deb ... Unpacking libmaven-common-artifact-filters-java (3.4.0-1) ... Selecting previously unselected package libmaven-artifact-transfer-java. Preparing to unpack .../375-libmaven-artifact-transfer-java_0.13.1-3_all.deb ... Unpacking libmaven-artifact-transfer-java (0.13.1-3) ... Selecting previously unselected package libplexus-build-api-java. Preparing to unpack .../376-libplexus-build-api-java_0.0.7-4_all.deb ... Unpacking libplexus-build-api-java (0.0.7-4) ... Selecting previously unselected package libmaven-filtering-java. Preparing to unpack .../377-libmaven-filtering-java_3.4.0-1_all.deb ... Unpacking libmaven-filtering-java (3.4.0-1) ... Selecting previously unselected package libmaven-assembly-plugin-java. Preparing to unpack .../378-libmaven-assembly-plugin-java_3.4.2-2_all.deb ... Unpacking libmaven-assembly-plugin-java (3.4.2-2) ... Selecting previously unselected package libmaven-clean-plugin-java. Preparing to unpack .../379-libmaven-clean-plugin-java_3.2.0-2_all.deb ... Unpacking libmaven-clean-plugin-java (3.2.0-2) ... Selecting previously unselected package libmaven-shared-incremental-java. Preparing to unpack .../380-libmaven-shared-incremental-java_1.1-6_all.deb ... Unpacking libmaven-shared-incremental-java (1.1-6) ... Selecting previously unselected package libplexus-compiler-java. Preparing to unpack .../381-libplexus-compiler-java_2.13.0-1_all.deb ... Unpacking libplexus-compiler-java (2.13.0-1) ... Selecting previously unselected package libqdox2-java. Preparing to unpack .../382-libqdox2-java_2.0.3-1_all.deb ... Unpacking libqdox2-java (2.0.3-1) ... Selecting previously unselected package libplexus-languages-java. Preparing to unpack .../383-libplexus-languages-java_1.1.1-3_all.deb ... Unpacking libplexus-languages-java (1.1.1-3) ... Selecting previously unselected package libmaven-compiler-plugin-java. Preparing to unpack .../384-libmaven-compiler-plugin-java_3.13.0-1_all.deb ... Unpacking libmaven-compiler-plugin-java (3.13.0-1) ... Selecting previously unselected package libmaven-dependency-analyzer-java. Preparing to unpack .../385-libmaven-dependency-analyzer-java_1.15.1-1_all.deb ... Unpacking libmaven-dependency-analyzer-java (1.15.1-1) ... Selecting previously unselected package libmaven-dependency-tree-java. Preparing to unpack .../386-libmaven-dependency-tree-java_3.3.0-1_all.deb ... Unpacking libmaven-dependency-tree-java (3.3.0-1) ... Selecting previously unselected package libmaven-reporting-impl-java. Preparing to unpack .../387-libmaven-reporting-impl-java_4.0.0-1_all.deb ... Unpacking libmaven-reporting-impl-java (4.0.0-1) ... Selecting previously unselected package libmaven-dependency-plugin-java. Preparing to unpack .../388-libmaven-dependency-plugin-java_3.8.1-1_all.deb ... Unpacking libmaven-dependency-plugin-java (3.8.1-1) ... Selecting previously unselected package libmaven-invoker-java. Preparing to unpack .../389-libmaven-invoker-java_3.3.0-1_all.deb ... Unpacking libmaven-invoker-java (3.3.0-1) ... Selecting previously unselected package libplexus-interactivity-api-java. Preparing to unpack .../390-libplexus-interactivity-api-java_1.3-1_all.deb ... Unpacking libplexus-interactivity-api-java (1.3-1) ... Selecting previously unselected package libmaven-javadoc-plugin-java. Preparing to unpack .../391-libmaven-javadoc-plugin-java_3.10.1-2_all.deb ... Unpacking libmaven-javadoc-plugin-java (3.10.1-2) ... Selecting previously unselected package libplexus-ant-factory-java. Preparing to unpack .../392-libplexus-ant-factory-java_1.0~alpha2.1-5_all.deb ... Unpacking libplexus-ant-factory-java (1.0~alpha2.1-5) ... Selecting previously unselected package libplexus-container-default1.5-java. Preparing to unpack .../393-libplexus-container-default1.5-java_2.1.1-1_all.deb ... Unpacking libplexus-container-default1.5-java (2.1.1-1) ... Selecting previously unselected package libplexus-bsh-factory-java. Preparing to unpack .../394-libplexus-bsh-factory-java_1.0~alpha7-5_all.deb ... Unpacking libplexus-bsh-factory-java (1.0~alpha7-5) ... Selecting previously unselected package libmaven-plugin-tools-java. Preparing to unpack .../395-libmaven-plugin-tools-java_3.10.2-2_all.deb ... Unpacking libmaven-plugin-tools-java (3.10.2-2) ... Selecting previously unselected package libmaven-reporting-exec-java. Preparing to unpack .../396-libmaven-reporting-exec-java_2.0.0-1_all.deb ... Unpacking libmaven-reporting-exec-java (2.0.0-1) ... Selecting previously unselected package libmaven-resources-plugin-java. Preparing to unpack .../397-libmaven-resources-plugin-java_3.3.1-1_all.deb ... Unpacking libmaven-resources-plugin-java (3.3.1-1) ... Selecting previously unselected package libmaven-site-plugin-java. Preparing to unpack .../398-libmaven-site-plugin-java_3.21.0-1_all.deb ... Unpacking libmaven-site-plugin-java (3.21.0-1) ... Selecting previously unselected package libmaven-source-plugin-java. Preparing to unpack .../399-libmaven-source-plugin-java_3.3.1-1_all.deb ... Unpacking libmaven-source-plugin-java (3.3.1-1) ... Selecting previously unselected package libpaper2:amd64. Preparing to unpack .../400-libpaper2_2.2.5-0.3+b2_amd64.deb ... Unpacking libpaper2:amd64 (2.2.5-0.3+b2) ... Selecting previously unselected package libpaper-utils. Preparing to unpack .../401-libpaper-utils_2.2.5-0.3+b2_amd64.deb ... Unpacking libpaper-utils (2.2.5-0.3+b2) ... Selecting previously unselected package libpicard-java. Preparing to unpack .../402-libpicard-java_3.3.0+dfsg-2_all.deb ... Unpacking libpicard-java (3.3.0+dfsg-2) ... Selecting previously unselected package libpj-java. Preparing to unpack .../403-libpj-java_0.0~20150107+dfsg-5_all.deb ... Unpacking libpj-java (0.0~20150107+dfsg-5) ... Selecting previously unselected package libpkgconf3:amd64. Preparing to unpack .../404-libpkgconf3_1.8.1-4_amd64.deb ... Unpacking libpkgconf3:amd64 (1.8.1-4) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../405-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Selecting previously unselected package libprotobuf32t64:amd64. Preparing to unpack .../406-libprotobuf32t64_3.21.12-11_amd64.deb ... Unpacking libprotobuf32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-lite32t64:amd64. Preparing to unpack .../407-libprotobuf-lite32t64_3.21.12-11_amd64.deb ... Unpacking libprotobuf-lite32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-dev:amd64. Preparing to unpack .../408-libprotobuf-dev_3.21.12-11_amd64.deb ... Unpacking libprotobuf-dev:amd64 (3.21.12-11) ... Selecting previously unselected package libprotobuf-java. Preparing to unpack .../409-libprotobuf-java_3.21.12-11_all.deb ... Unpacking libprotobuf-java (3.21.12-11) ... Selecting previously unselected package libprotoc32t64:amd64. Preparing to unpack .../410-libprotoc32t64_3.21.12-11_amd64.deb ... Unpacking libprotoc32t64:amd64 (3.21.12-11) ... Selecting previously unselected package libreflections-java. Preparing to unpack .../411-libreflections-java_0.10.2+dfsg-2_all.deb ... Unpacking libreflections-java (0.10.2+dfsg-2) ... Selecting previously unselected package libsm6:amd64. Preparing to unpack .../412-libsm6_2%3a1.2.6-1_amd64.deb ... Unpacking libsm6:amd64 (2:1.2.6-1) ... Selecting previously unselected package libsurefire-java. Preparing to unpack .../413-libsurefire-java_2.22.3-4_all.deb ... Unpacking libsurefire-java (2.22.3-4) ... Selecting previously unselected package libtcl8.6:amd64. Preparing to unpack .../414-libtcl8.6_8.6.16+dfsg-1_amd64.deb ... Unpacking libtcl8.6:amd64 (8.6.16+dfsg-1) ... Selecting previously unselected package libtirpc-common. Preparing to unpack .../415-libtirpc-common_1.3.6+ds-1_all.deb ... Unpacking libtirpc-common (1.3.6+ds-1) ... Selecting previously unselected package libtirpc3t64:amd64. Preparing to unpack .../416-libtirpc3t64_1.3.6+ds-1_amd64.deb ... Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3 to /lib/x86_64-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' Adding 'diversion of /lib/x86_64-linux-gnu/libtirpc.so.3.0.0 to /lib/x86_64-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' Unpacking libtirpc3t64:amd64 (1.3.6+ds-1) ... Selecting previously unselected package libxft2:amd64. Preparing to unpack .../417-libxft2_2.3.6-1+b4_amd64.deb ... Unpacking libxft2:amd64 (2.3.6-1+b4) ... Selecting previously unselected package libxss1:amd64. Preparing to unpack .../418-libxss1_1%3a1.2.3-1+b3_amd64.deb ... Unpacking libxss1:amd64 (1:1.2.3-1+b3) ... Selecting previously unselected package libtk8.6:amd64. Preparing to unpack .../419-libtk8.6_8.6.16-1_amd64.deb ... Unpacking libtk8.6:amd64 (8.6.16-1) ... Selecting previously unselected package libwagon-file-java. Preparing to unpack .../420-libwagon-file-java_3.5.3-2_all.deb ... Unpacking libwagon-file-java (3.5.3-2) ... Selecting previously unselected package libwagon-http-java. Preparing to unpack .../421-libwagon-http-java_3.5.3-2_all.deb ... Unpacking libwagon-http-java (3.5.3-2) ... Selecting previously unselected package libxml2-utils. Preparing to unpack .../422-libxml2-utils_2.12.7+dfsg+really2.9.14-2.1_amd64.deb ... Unpacking libxml2-utils (2.12.7+dfsg+really2.9.14-2.1) ... Selecting previously unselected package libxt6t64:amd64. Preparing to unpack .../423-libxt6t64_1%3a1.2.1-1.2+b2_amd64.deb ... Unpacking libxt6t64:amd64 (1:1.2.1-1.2+b2) ... Selecting previously unselected package maven. Preparing to unpack .../424-maven_3.9.9-1_all.deb ... Unpacking maven (3.9.9-1) ... Selecting previously unselected package maven-repo-helper. Preparing to unpack .../425-maven-repo-helper_1.11_all.deb ... Unpacking maven-repo-helper (1.11) ... Selecting previously unselected package unzip. Preparing to unpack .../426-unzip_6.0-29_amd64.deb ... Unpacking unzip (6.0-29) ... Selecting previously unselected package maven-debian-helper. Preparing to unpack .../427-maven-debian-helper_2.6.7_all.deb ... Unpacking maven-debian-helper (2.6.7) ... Selecting previously unselected package pkgconf-bin. Preparing to unpack .../428-pkgconf-bin_1.8.1-4_amd64.deb ... Unpacking pkgconf-bin (1.8.1-4) ... Selecting previously unselected package pkgconf:amd64. Preparing to unpack .../429-pkgconf_1.8.1-4_amd64.deb ... Unpacking pkgconf:amd64 (1.8.1-4) ... Selecting previously unselected package protobuf-compiler. Preparing to unpack .../430-protobuf-compiler_3.21.12-11_amd64.deb ... Unpacking protobuf-compiler (3.21.12-11) ... Selecting previously unselected package zip. Preparing to unpack .../431-zip_3.0-15_amd64.deb ... Unpacking zip (3.0-15) ... Selecting previously unselected package xdg-utils. Preparing to unpack .../432-xdg-utils_1.2.1-2_all.deb ... Unpacking xdg-utils (1.2.1-2) ... Selecting previously unselected package r-base-core. Preparing to unpack .../433-r-base-core_4.5.0-3_amd64.deb ... Unpacking r-base-core (4.5.0-3) ... Selecting previously unselected package r-cran-rjava. Preparing to unpack .../434-r-cran-rjava_1.0-11-2_amd64.deb ... Unpacking r-cran-rjava (1.0-11-2) ... Selecting previously unselected package testng. Preparing to unpack .../435-testng_6.9.12-4_all.deb ... Unpacking testng (6.9.12-4) ... Setting up libprotobuf-lite32t64:amd64 (3.21.12-11) ... Setting up media-types (13.0.0) ... Setting up libpipeline1:amd64 (1.5.8-1) ... Setting up fastjar (2:0.98-7) ... Setting up libgraphite2-3:amd64 (1.3.14-2+b1) ... Setting up liblcms2-2:amd64 (2.16-2) ... Setting up libpixman-1-0:amd64 (0.44.0-3) ... Setting up libjcommander-java (1.71-4) ... Setting up libfastutil-java (8.5.15+dfsg-1) ... Setting up libtext-charwidth-perl:amd64 (0.04-11+b4) ... Setting up wdiff (1.2.2-9) ... Setting up libsharpyuv0:amd64 (1.5.0-0.1) ... Setting up libpciaccess0:amd64 (0.17-3+b3) ... Setting up libslf4j-java (1.7.32-2) ... Setting up libprotobuf32t64:amd64 (3.21.12-11) ... Setting up libfile-which-perl (1.27-2) ... Setting up systemd-sysv (257.7-1) ... Setting up libxau6:amd64 (1:1.0.11-1) ... Setting up libxdmcp6:amd64 (1:1.1.5-1) ... Setting up libplexus-utils2-java (3.4.2-1) ... Setting up libnpth0t64:amd64 (1.8-3) ... Setting up libkeyutils1:amd64 (1.6.3-6) ... Setting up libplexus-classworlds-java (2.7.0-1) ... Setting up libxcb1:amd64 (1.17.0-2+b1) ... Setting up libopentest4j-reporting-java (0.1.0-M1-2) ... Setting up libplexus-build-api-java (0.0.7-4) ... Setting up libxcb-xfixes0:amd64 (1.17.0-2+b1) ... Setting up liblerc4:amd64 (4.0.0+ds-5) ... Setting up libjsr305-java (0.1~+svn49-12) ... Setting up bsdextrautils (2.41-5) ... Setting up hicolor-icon-theme (0.18-2) ... Setting up libgatk-native-bindings-java (1.0.0+dfsg-2) ... Setting up libgpg-error0:amd64 (1.51-4) ... Setting up libicu4j-java (73.2-1) ... Setting up java-common (0.76) ... Setting up libdynaloader-functions-perl (0.004-2) ... Setting up libdatrie1:amd64 (0.2.13-3+b1) ... Setting up libobjenesis-java (3.4-2) ... Setting up libclass-method-modifiers-perl (2.15-1) ... Setting up libqdox2-java (2.0.3-1) ... Setting up libaopalliance-java (20070526-7) ... Setting up libcommons-cli-java (1.6.0-1) ... Setting up libmagic-mgc (1:5.46-5) ... Setting up libcommons-exec-java (1.3-3) ... Setting up libxcb-render0:amd64 (1.17.0-2+b1) ... Setting up liblogback-java (1:1.2.11-6) ... Setting up libclone-perl:amd64 (0.47-1+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libglvnd0:amd64 (1.7.0-1+b2) ... Setting up libgoogle-gson-java (2.10.1-1) ... Setting up libtirpc-common (1.3.6+ds-1) ... Setting up libhtml-tagset-perl (3.24-1) ... Setting up libxcb-glx0:amd64 (1.17.0-2+b1) ... Setting up unzip (6.0-29) ... Setting up libdebhelper-perl (13.24.2) ... Setting up libbrotli1:amd64 (1.1.0-2+b7) ... Setting up libedit2:amd64 (3.1-20250104-1) ... Setting up liblwp-mediatypes-perl (6.04-2) ... Setting up libgdk-pixbuf2.0-common (2.42.12+dfsg-4) ... Setting up libmagic1t64:amd64 (1:5.46-5) ... Setting up libpicocli-java (4.6.2-2) ... Setting up libasm-java (9.8-1) ... Setting up x11-common (1:7.7+24) ... Running in chroot, ignoring request. Setting up X socket directories... /tmp/.X11-unix /tmp/.ICE-unix. Setting up libtry-tiny-perl (0.32-1) ... Setting up libsensors-config (1:3.6.2-2) ... Setting up libnghttp2-14:amd64 (1.64.0-1.1) ... Setting up libdeflate0:amd64 (1.23-2) ... Setting up perl-openssl-defaults:amd64 (7+b2) ... Setting up liblog4j1.2-java (1.2.17-11) ... Setting up gettext-base (0.23.1-2) ... Setting up m4 (1.4.19-8) ... Setting up libel-api-java (3.0.0-3) ... Setting up libgcrypt20:amd64 (1.11.0-7) ... Setting up xkb-data (2.42-1) ... Setting up libencode-locale-perl (1.05-3) ... Setting up libplexus-component-annotations-java (2.1.1-1) ... Setting up libxcb-shm0:amd64 (1.17.0-2+b1) ... Setting up libcom-err2:amd64 (1.47.2-3+b3) ... Setting up file (1:5.46-5) ... Setting up libjboss-logging-java (3.5.3-1) ... Setting up libunivocity-parsers-java (2.9.1-1) ... Setting up libtext-wrapi18n-perl (0.06-10) ... Setting up libjbig0:amd64 (2.1-6.1+b2) ... Setting up libelf1t64:amd64 (0.192-4) ... Setting up liboro-java (2.0.8a-15) ... Setting up libsnappy1v5:amd64 (1.2.2-1) ... Setting up libkrb5support0:amd64 (1.21.3-5) ... Setting up libexec-maven-plugin-java (3.1.0-2) ... Setting up libsasl2-modules-db:amd64 (2.1.28+dfsg1-9) ... Setting up tzdata (2025b-4) ... Current default time zone: 'Etc/UTC' Local time is now: Wed Aug 6 17:19:45 UTC 2025. Universal Time is now: Wed Aug 6 17:19:45 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libxcb-present0:amd64 (1.17.0-2+b1) ... Setting up libgeronimo-annotation-1.3-spec-java (1.3-1) ... Setting up libgeronimo-interceptor-3.0-spec-java (1.0.1-5) ... Setting up libcommons-collections3-java (3.2.2-3) ... Setting up libasound2-data (1.2.14-1) ... Setting up libjavassist-java (1:3.27.0-1) ... Setting up zip (3.0-15) ... Setting up librhino-java (1.7.15-1) ... Setting up autotools-dev (20240727.1) ... Setting up libz3-4:amd64 (4.13.3-1) ... Setting up libblas3:amd64 (3.12.1-4) ... update-alternatives: using /usr/lib/x86_64-linux-gnu/blas/libblas.so.3 to provide /usr/lib/x86_64-linux-gnu/libblas.so.3 (libblas.so.3-x86_64-linux-gnu) in auto mode Setting up libpkgconf3:amd64 (1.8.1-4) ... Setting up libasound2t64:amd64 (1.2.14-1) ... Setting up libjpeg62-turbo:amd64 (1:2.1.5-4) ... Setting up libjaxen-java (1.1.6-5) ... Setting up libapiguardian-java (1.1.2-1) ... Setting up libx11-data (2:1.8.12-1) ... Setting up libepoxy0:amd64 (1.5.10-2) ... Setting up libnspr4:amd64 (2:4.36-1) ... Setting up libxcb-sync1:amd64 (1.17.0-2+b1) ... Setting up libjtidy-java (7+svn20110807-6) ... Setting up libjansi-java (2.4.1-2) ... Setting up libapache-pom-java (33-2) ... Setting up libavahi-common-data:amd64 (0.8-16) ... Setting up libxpp3-java (1.1.4c-4) ... Setting up libatinject-jsr330-api-java (1.0+ds1-6) ... Setting up libdbus-1-3:amd64 (1.16.2-2) ... Setting up libwebsocket-api-java (1.1-2) ... Setting up libfribidi0:amd64 (1.0.16-1) ... Setting up libproc2-0:amd64 (2:4.0.4-9) ... Setting up libplexus-interpolation-java (1.27-1) ... Setting up libunistring5:amd64 (1.3-2) ... Setting up fonts-dejavu-mono (2.37-8) ... Setting up libpng16-16t64:amd64 (1.6.48-1) ... Setting up libxml-commons-resolver1.1-java (1.2-11) ... Setting up libxz-java (1.9-1) ... Setting up libio-html-perl (1.004-3) ... Setting up libtcl8.6:amd64 (8.6.16+dfsg-1) ... Setting up autopoint (0.23.1-2) ... Setting up binfmt-support (2.2.2-7) ... Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of start. Created symlink '/etc/systemd/system/multi-user.target.wants/binfmt-support.service' -> '/usr/lib/systemd/system/binfmt-support.service'. Setting up libb-hooks-op-check-perl:amd64 (0.22-3+b2) ... Setting up fonts-dejavu-core (2.37-8) ... Setting up libjbzip2-java (0.9.1-8) ... Setting up libpcsclite1:amd64 (2.3.3-1) ... Setting up pkgconf-bin (1.8.1-4) ... Setting up libsensors5:amd64 (1:3.6.2-2) ... Setting up libmongodb-java (3.6.3-2) ... Setting up libk5crypto3:amd64 (1.21.3-5) ... Setting up libactivation-java (1.2.0-2) ... Setting up libhamcrest-java (2.2-2) ... Setting up libbsh-java (2.0b4-20) ... Setting up libjsp-api-java (2.3.4-3) ... Setting up libsasl2-2:amd64 (2.1.28+dfsg1-9) ... Setting up libgfortran5:amd64 (14.2.0-19) ... Setting up libvulkan1:amd64 (1.4.309.0-1) ... Setting up autoconf (2.72-3.1) ... Setting up libnghttp3-9:amd64 (1.8.0-1) ... Setting up libwebp7:amd64 (1.5.0-0.1) ... Setting up libcolt-free-java (1.2.0+dfsg-8) ... Setting up libtimedate-perl (2.3300-2) ... Setting up libgif7:amd64 (5.2.2-1+b1) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up libffi8:amd64 (3.4.8-2) ... Setting up dwz (0.15-1+b1) ... Setting up libplexus-interactivity-api-java (1.3-1) ... Setting up libfreemarker-java (2.3.32-2.1) ... Setting up sensible-utils (0.0.25) ... Setting up libxshmfence1:amd64 (1.3.3-1) ... Setting up libjsoup-java (1.15.3-1) ... Setting up at-spi2-common (2.56.2-1) ... Setting up libcommons-math-java (2.2-9) ... Setting up gpgv (2.4.7-21+b3) ... Setting up libtiff6:amd64 (4.7.0-3) ... Setting up libxcb-randr0:amd64 (1.17.0-2+b1) ... Setting up dbus-session-bus-common (1.16.2-2) ... Setting up libuchardet0:amd64 (0.0.8-1+b2) ... Setting up libassuan9:amd64 (3.0.2-2) ... Setting up libxml-commons-external-java (1.4.01-6) ... Setting up procps (2:4.0.4-9) ... Setting up libxbean-reflect-java (4.5-9) ... Setting up libservlet-api-java (4.0.1-2) ... Setting up libplexus-xml-java (3.0.1-2) ... Setting up librole-tiny-perl (2.002004-1) ... Setting up libopentest4j-java (1.2.0-4) ... Setting up libtasn1-6:amd64 (4.20.0-2) ... Setting up libx11-6:amd64 (2:1.8.12-1) ... Setting up ncbi-vdb-data (3.2.1+dfsg-2) ... Setting up libthai-data (0.1.29-2) ... Setting up netbase (6.5) ... Setting up libcommons-math3-java (3.6.1-4) ... Setting up sgml-base (1.31+nmu1) ... Setting up libsub-quote-perl (2.006008-1) ... Setting up libclass-xsaccessor-perl (1.19-4+b5) ... Setting up libkrb5-3:amd64 (1.21.3-5) ... Setting up libwayland-egl1:amd64 (1.23.1-3) ... Setting up libicu76:amd64 (76.1-4) ... Setting up libmbedcrypto16:amd64 (3.6.4-2) ... Setting up libpaper2:amd64 (2.2.5-0.3+b2) ... Setting up libssh2-1t64:amd64 (1.11.1-1) ... Setting up libhttpcore-java (4.4.16-1) ... Setting up libjoptsimple-java (5.0.4-7) ... Setting up libprotoc32t64:amd64 (3.21.12-11) ... Setting up libxerces2-java (2.12.2-1) ... Setting up libfile-dirlist-perl (0.05-3) ... Setting up dbus-system-bus-common (1.16.2-2) ... Creating group 'messagebus' with GID 997. Creating user 'messagebus' (System Message Bus) with UID 997 and GID 997. Setting up libfile-homedir-perl (1.006-2) ... Setting up libpj-java (0.0~20150107+dfsg-5) ... Setting up openssl (3.5.1-1) ... Setting up libdrm-common (2.4.124-2) ... Setting up libcdi-api-java (1.2-4) ... Setting up libsnappy-jni (1.1.10.7-1) ... Setting up libezmorph-java (1.0.6-4) ... Setting up libxcomposite1:amd64 (1:0.4.6-1) ... Setting up readline-common (8.2-6) ... Setting up libxml2:amd64 (2.12.7+dfsg+really2.9.14-2.1) ... Setting up xdg-utils (1.2.1-2) ... update-alternatives: using /usr/bin/xdg-open to provide /usr/bin/open (open) in auto mode Setting up libldap2:amd64 (2.6.10+dfsg-1) ... Setting up liburi-perl (5.30-1) ... Setting up dbus-bin (1.16.2-2) ... Setting up libfile-touch-perl (0.12-2) ... Setting up dctrl-tools (2.24-3+b1) ... Setting up libxkbcommon0:amd64 (1.7.0-2) ... Setting up libwayland-client0:amd64 (1.23.1-3) ... Setting up libnet-ssleay-perl:amd64 (1.94-3) ... Setting up automake (1:1.17-4) ... update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode Setting up libksba8:amd64 (1.6.7-2+b1) ... Setting up pinentry-curses (1.3.1-2) ... Setting up libdom4j-java (2.1.4-1) ... Setting up libjaxb-api-java (2.3.1-1) ... Setting up libfile-stripnondeterminism-perl (1.14.1-2) ... Setting up libxcb-dri3-0:amd64 (1.17.0-2+b1) ... Setting up libwagon-provider-api-java (3.5.3-2) ... Setting up libllvm19:amd64 (1:19.1.7-3+b1) ... Setting up libwayland-server0:amd64 (1.23.1-3) ... Setting up libx11-xcb1:amd64 (2:1.8.12-1) ... Setting up libice6:amd64 (2:1.1.1-1) ... Setting up libhttp-date-perl (6.06-1) ... Setting up libxstream-java (1.4.21-1) ... Setting up liblapack3:amd64 (3.12.1-4) ... update-alternatives: using /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/x86_64-linux-gnu/liblapack.so.3 (liblapack.so.3-x86_64-linux-gnu) in auto mode Setting up gettext (0.23.1-2) ... Setting up libjetty9-java (9.4.57-1) ... Setting up libxdamage1:amd64 (1:1.1.6-1+b2) ... Setting up libfile-listing-perl (6.16-1) ... Setting up libplexus-languages-java (1.1.1-3) ... Setting up protobuf-compiler (3.21.12-11) ... Setting up libjboss-vfs-java (3.2.15.Final-3) ... Setting up libxrender1:amd64 (1:0.9.12-1) ... Setting up jarwrapper (0.80) ... Setting up libtool (2.5.4-4) ... Setting up fontconfig-config (2.15.0-2.3) ... Setting up libmaven-parent-java (43-2) ... Setting up libcommons-parent-java (56-1) ... Setting up libavahi-common3:amd64 (0.8-16) ... Setting up libcommons-logging-java (1.3.0-2) ... Setting up libxext6:amd64 (2:1.3.4-1+b3) ... Setting up libnet-http-perl (6.23-1) ... Setting up libsisu-inject-java (0.3.5-1) ... Setting up libidn2-0:amd64 (2.3.8-2) ... Setting up libnss3:amd64 (2:3.110-1) ... Setting up dbus-daemon (1.16.2-2) ... Setting up libpaper-utils (2.2.5-0.3+b2) ... Setting up libxom-java (1.3.9-1) ... Setting up libdevel-callchecker-perl:amd64 (0.009-2) ... Setting up libcommons-lang-java (2.6-10) ... Setting up libmaven-dependency-analyzer-java (1.15.1-1) ... Setting up libplexus-cipher-java (2.0-1) ... Setting up pkgconf:amd64 (1.8.1-4) ... Setting up libxxf86vm1:amd64 (1:1.1.4-1+b4) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up libprotobuf-dev:amd64 (3.21.12-11) ... Setting up dh-autoreconf (20) ... Setting up patchutils (0.4.2-1) ... Setting up libcommons-jexl2-java (2.1.1-6) ... Setting up libthai0:amd64 (0.1.29-2+b1) ... Setting up ca-certificates (20250419) ... Updating certificates in /etc/ssl/certs... 150 added, 0 removed; done. Setting up libsisu-plexus-java (0.3.5-1) ... Setting up libglib2.0-0t64:amd64 (2.84.3-1) ... Setting up libmbedx509-7:amd64 (3.6.4-2) ... Setting up libfreetype6:amd64 (2.13.3+dfsg-1) ... Setting up libxfixes3:amd64 (1:6.0.0-2+b4) ... Setting up testng (6.9.12-4) ... Setting up dbus (1.16.2-2) ... Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of start. Setting up shared-mime-info (2.4-5+b2) ... Setting up libp11-kit0:amd64 (0.25.5-3) ... Setting up libxinerama1:amd64 (2:1.1.4-3+b4) ... Setting up libgssapi-krb5-2:amd64 (1.21.3-5) ... Setting up libxrandr2:amd64 (2:1.5.4-1+b3) ... Setting up libcommons-collections4-java (4.4-2) ... Setting up ucf (3.0052) ... Setting up libcommons-lang3-java (3.17.0-1) ... Setting up libmbedtls21:amd64 (3.6.4-2) ... Setting up libreadline8t64:amd64 (8.2-6) ... Setting up dh-strip-nondeterminism (1.14.1-2) ... Setting up libwww-robotrules-perl (6.02-1) ... Setting up libdrm2:amd64 (2.4.124-2) ... Setting up groff-base (1.23.0-9) ... Setting up libwayland-cursor0:amd64 (1.23.1-3) ... Setting up libhtml-parser-perl:amd64 (3.83-1+b2) ... Setting up gpgconf (2.4.7-21+b3) ... Setting up libpam-systemd:amd64 (257.7-1) ... Setting up libcommons-beanutils-java (1.10.1-1.1) ... Setting up libplexus-sec-dispatcher-java (2.0-3) ... Setting up libharfbuzz0b:amd64 (10.2.0-1+b1) ... Setting up libgdk-pixbuf-2.0-0:amd64 (2.42.12+dfsg-4) ... Setting up libsnappy-java (1.1.10.7-1) ... Setting up libxss1:amd64 (1:1.2.3-1+b3) ... Setting up libfontconfig1:amd64 (2.15.0-2.3) ... Setting up ca-certificates-java (20240118) ... No JRE found. Skipping Java certificates setup. Setting up libcommons-configuration-java (1.10-7) ... Setting up libwagon-file-java (3.5.3-2) ... Setting up libxml2-utils (2.12.7+dfsg+really2.9.14-2.1) ... Setting up libcommons-codec-java (1.18.0-1) ... Setting up libsm6:amd64 (2:1.2.6-1) ... Setting up libreflections-java (0.10.2+dfsg-2) ... Setting up libpython3.13-stdlib:amd64 (3.13.5-2) ... Setting up libavahi-client3:amd64 (0.8-16) ... Setting up libio-socket-ssl-perl (2.089-1) ... Setting up gpg (2.4.7-21+b3) ... Created symlink '/etc/systemd/user/sockets.target.wants/keyboxd.socket' -> '/usr/lib/systemd/user/keyboxd.socket'. Setting up libpython3-stdlib:amd64 (3.13.5-1) ... Setting up libhttp-message-perl (7.00-2) ... Setting up libdrm-amdgpu1:amd64 (2.4.124-2) ... Setting up libgnutls30t64:amd64 (3.8.9-3) ... Setting up gtk-update-icon-cache (4.18.6+ds-2) ... Setting up libhttp-negotiate-perl (6.01-2) ... Setting up velocity (1.7-7) ... Setting up fontconfig (2.15.0-2.3) ... Regenerating fonts cache... done. Setting up libxft2:amd64 (2.3.6-1+b4) ... Setting up gpg-agent (2.4.7-21+b3) ... Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-browser.socket' -> '/usr/lib/systemd/user/gpg-agent-browser.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-extra.socket' -> '/usr/lib/systemd/user/gpg-agent-extra.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent-ssh.socket' -> '/usr/lib/systemd/user/gpg-agent-ssh.socket'. Created symlink '/etc/systemd/user/sockets.target.wants/gpg-agent.socket' -> '/usr/lib/systemd/user/gpg-agent.socket'. Setting up libatk1.0-0t64:amd64 (2.56.2-1) ... Setting up openjdk-21-jre-headless:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/java to provide /usr/bin/java (java) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jpackage to provide /usr/bin/jpackage (jpackage) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/keytool to provide /usr/bin/keytool (keytool) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/rmiregistry to provide /usr/bin/rmiregistry (rmiregistry) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/lib/jexec to provide /usr/bin/jexec (jexec) in auto mode Setting up libxi6:amd64 (2:1.8.2-1) ... Setting up libtirpc3t64:amd64 (1.3.6+ds-1) ... Setting up libhttp-cookies-perl (6.11-1) ... Setting up python3.13 (3.13.5-2) ... Setting up libcommons-io-java (2.19.0-1) ... Setting up libcommons-digester-java (1.8.1-7) ... Setting up libxtst6:amd64 (2:1.2.5-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libhtml-tree-perl (5.07-3) ... Setting up libtk8.6:amd64 (8.6.16-1) ... Setting up libdistlib-java (1.0-5) ... Setting up libxcursor1:amd64 (1:1.2.3-1) ... Setting up libparams-classify-perl:amd64 (0.015-2+b4) ... Setting up libpango-1.0-0:amd64 (1.56.3-1) ... Setting up libdrm-intel1:amd64 (2.4.124-2) ... Setting up libpsl5t64:amd64 (0.21.2-1.1+b1) ... Setting up libncbi-vdb3:amd64 (3.2.1+dfsg-2) ... Setting up libcloudproviders0:amd64 (0.3.6-2) ... Setting up python3 (3.13.5-1) ... Setting up sopv-gpgv (0.1.4-1) ... update-alternatives: using /usr/bin/sopv-gpgv to provide /usr/bin/sopv (sopv) in auto mode Setting up man-db (2.13.1-1) ... Not building database; man-db/auto-update is not 'true'. Created symlink '/etc/systemd/system/timers.target.wants/man-db.timer' -> '/usr/lib/systemd/system/man-db.timer'. Setting up libcairo2:amd64 (1.18.4-1+b1) ... Setting up libcolord2:amd64 (1.4.7-3) ... Setting up libdconf1:amd64 (0.40.0-5) ... Setting up libmaven-filtering-java (3.4.0-1) ... Setting up dbus-user-session (1.16.2-2) ... Setting up libmaven-resolver-java (1.9.22-1) ... Setting up adwaita-icon-theme (48.1-1) ... update-alternatives: using /usr/share/icons/Adwaita/cursor.theme to provide /usr/share/icons/default/index.theme (x-cursor-theme) in auto mode Setting up libmodule-runtime-perl (0.018-1) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2+b5) ... Setting up libatspi2.0-0t64:amd64 (2.56.2-1) ... Setting up libxt6t64:amd64 (1:1.2.1-1.2+b2) ... Setting up libhttpclient-java (4.5.14-1) ... Setting up libmaven-common-artifact-filters-java (3.4.0-1) ... Setting up libmaven-dependency-tree-java (3.3.0-1) ... Setting up liblightcouch-java (0.2.0-1) ... Setting up libwagon-http-java (3.5.3-2) ... Setting up libcairo-gobject2:amd64 (1.18.4-1+b1) ... Setting up libmaven-shared-utils-java (3.4.2-1) ... Setting up libpangoft2-1.0-0:amd64 (1.56.3-1) ... Setting up libmaven-resources-plugin-java (3.3.1-1) ... Setting up libcups2t64:amd64 (2.4.10-3) ... Setting up libpangocairo-1.0-0:amd64 (1.56.3-1) ... Setting up libncbi-ngs3:amd64 (3.2.1+dfsg-4) ... Setting up libatk-bridge2.0-0t64:amd64 (2.56.2-1) ... Setting up mesa-libgallium:amd64 (25.0.7-2) ... Setting up libngs-jni:amd64 (3.2.1+dfsg-4) ... Setting up libplexus-io-java (3.3.1-2) ... Setting up libcommons-compress-java (1.27.1-2) ... Setting up libcurl4t64:amd64 (8.14.1-2) ... Setting up libcommons-validator-java (1:1.9.0-1) ... Setting up libgbm1:amd64 (25.0.7-2) ... Setting up libimport-into-perl (1.002005-2) ... Setting up libmoo-perl (2.005005-1) ... Setting up liblog4j2-java (2.19.0-2) ... Setting up libgl1-mesa-dri:amd64 (25.0.7-2) ... Setting up libmaven-invoker-java (3.3.0-1) ... Setting up debhelper (13.24.2) ... Setting up dconf-service (0.40.0-5) ... Setting up r-base-core (4.5.0-3) ... Creating config file /etc/R/Renviron with new version Setting up libmaven-clean-plugin-java (3.2.0-2) ... Setting up libplexus-archiver-java (4.6.1-1) ... Setting up libngs-java:amd64 (3.2.1+dfsg-4) ... Setting up libbarclay-java (5.0.0+dfsg-1) ... Setting up libglx-mesa0:amd64 (25.0.7-2) ... Setting up libglx0:amd64 (1.7.0-1+b2) ... Setting up dconf-gsettings-backend:amd64 (0.40.0-5) ... Setting up libmaven-archiver-java (3.6.2-1) ... Setting up libgl1:amd64 (1.7.0-1+b2) ... Setting up libmaven-source-plugin-java (3.3.1-1) ... Setting up libgtk-3-common (3.24.49-3) ... Setting up libgtk-3-0t64:amd64 (3.24.49-3) ... Setting up liberror-prone-java (2.18.0-1) ... Setting up libwww-perl (6.78-1) ... Setting up devscripts (2.25.15) ... Setting up libguava-java (32.0.1-1) ... Setting up javahelper (0.80) ... Setting up libprotobuf-java (3.21.12-11) ... Setting up libplexus-container-default-java (2.1.1-1) ... Setting up liblwp-protocol-https-perl (6.14-1) ... Setting up libguice-java (5.1.0-1) ... Setting up libplexus-i18n-java (1.0-beta-10-6) ... Setting up libplexus-container-default1.5-java (2.1.1-1) ... Setting up libplexus-velocity-java (1.2-4) ... Setting up libmaven3-core-java (3.9.9-1) ... Setting up libmaven-shared-incremental-java (1.1-6) ... Setting up libmaven-shared-io-java (3.0.0-4) ... Setting up libplexus-bsh-factory-java (1.0~alpha7-5) ... Setting up libplexus-compiler-java (2.13.0-1) ... Setting up libmaven-compiler-plugin-java (3.13.0-1) ... Setting up libmaven-artifact-transfer-java (0.13.1-3) ... Setting up libmaven-file-management-java (3.0.0-2) ... Setting up libbyte-buddy-java (1.14.19-1) ... Setting up libbuild-helper-maven-plugin-java (3.3.0-1) ... Setting up libeasymock-java (5.5.0-1) ... Setting up libmaven-jar-plugin-java (3.3.0-2) ... Setting up libmaven-assembly-plugin-java (3.4.2-2) ... Setting up libcommons-text-java (1.13.1-1) ... Setting up libdoxia-core-java (2.0.0-1) ... Setting up libdoxia-java (2.0.0-1) ... Setting up libmaven-reporting-api-java (4.0.0-1) ... Setting up libmaven-reporting-exec-java (2.0.0-1) ... Processing triggers for libc-bin (2.41-11) ... Processing triggers for systemd (257.7-1) ... Processing triggers for ca-certificates-java (20240118) ... Adding debian:ACCVRAIZ1.pem Adding debian:AC_RAIZ_FNMT-RCM.pem Adding debian:AC_RAIZ_FNMT-RCM_SERVIDORES_SEGUROS.pem Adding debian:ANF_Secure_Server_Root_CA.pem Adding debian:Actalis_Authentication_Root_CA.pem Adding debian:AffirmTrust_Commercial.pem Adding debian:AffirmTrust_Networking.pem Adding debian:AffirmTrust_Premium.pem Adding debian:AffirmTrust_Premium_ECC.pem Adding debian:Amazon_Root_CA_1.pem Adding debian:Amazon_Root_CA_2.pem Adding debian:Amazon_Root_CA_3.pem Adding debian:Amazon_Root_CA_4.pem Adding debian:Atos_TrustedRoot_2011.pem Adding debian:Atos_TrustedRoot_Root_CA_ECC_TLS_2021.pem Adding debian:Atos_TrustedRoot_Root_CA_RSA_TLS_2021.pem Adding debian:Autoridad_de_Certificacion_Firmaprofesional_CIF_A62634068.pem Adding debian:BJCA_Global_Root_CA1.pem Adding debian:BJCA_Global_Root_CA2.pem Adding debian:Baltimore_CyberTrust_Root.pem Adding debian:Buypass_Class_2_Root_CA.pem Adding debian:Buypass_Class_3_Root_CA.pem Adding debian:CA_Disig_Root_R2.pem Adding debian:CFCA_EV_ROOT.pem Adding debian:COMODO_Certification_Authority.pem Adding debian:COMODO_ECC_Certification_Authority.pem Adding debian:COMODO_RSA_Certification_Authority.pem Adding debian:Certainly_Root_E1.pem Adding debian:Certainly_Root_R1.pem Adding debian:Certigna.pem Adding debian:Certigna_Root_CA.pem Adding debian:Certum_EC-384_CA.pem Adding debian:Certum_Trusted_Network_CA.pem Adding debian:Certum_Trusted_Network_CA_2.pem Adding debian:Certum_Trusted_Root_CA.pem Adding debian:CommScope_Public_Trust_ECC_Root-01.pem Adding debian:CommScope_Public_Trust_ECC_Root-02.pem Adding debian:CommScope_Public_Trust_RSA_Root-01.pem Adding debian:CommScope_Public_Trust_RSA_Root-02.pem Adding debian:Comodo_AAA_Services_root.pem Adding debian:D-TRUST_BR_Root_CA_1_2020.pem Adding debian:D-TRUST_BR_Root_CA_2_2023.pem Adding debian:D-TRUST_EV_Root_CA_1_2020.pem Adding debian:D-TRUST_EV_Root_CA_2_2023.pem Adding debian:D-TRUST_Root_Class_3_CA_2_2009.pem Adding debian:D-TRUST_Root_Class_3_CA_2_EV_2009.pem Adding debian:DigiCert_Assured_ID_Root_CA.pem Adding debian:DigiCert_Assured_ID_Root_G2.pem Adding debian:DigiCert_Assured_ID_Root_G3.pem Adding debian:DigiCert_Global_Root_CA.pem Adding debian:DigiCert_Global_Root_G2.pem Adding debian:DigiCert_Global_Root_G3.pem Adding debian:DigiCert_High_Assurance_EV_Root_CA.pem Adding debian:DigiCert_TLS_ECC_P384_Root_G5.pem Adding debian:DigiCert_TLS_RSA4096_Root_G5.pem Adding debian:DigiCert_Trusted_Root_G4.pem Adding debian:Entrust.net_Premium_2048_Secure_Server_CA.pem Adding debian:Entrust_Root_Certification_Authority.pem Adding debian:Entrust_Root_Certification_Authority_-_EC1.pem Adding debian:Entrust_Root_Certification_Authority_-_G2.pem Adding debian:FIRMAPROFESIONAL_CA_ROOT-A_WEB.pem Adding debian:GDCA_TrustAUTH_R5_ROOT.pem Adding debian:GLOBALTRUST_2020.pem Adding debian:GTS_Root_R1.pem Adding debian:GTS_Root_R2.pem Adding debian:GTS_Root_R3.pem Adding debian:GTS_Root_R4.pem Adding debian:GlobalSign_ECC_Root_CA_-_R4.pem Adding debian:GlobalSign_ECC_Root_CA_-_R5.pem Adding debian:GlobalSign_Root_CA.pem Adding debian:GlobalSign_Root_CA_-_R3.pem Adding debian:GlobalSign_Root_CA_-_R6.pem Adding debian:GlobalSign_Root_E46.pem Adding debian:GlobalSign_Root_R46.pem Adding debian:Go_Daddy_Class_2_CA.pem Adding debian:Go_Daddy_Root_Certificate_Authority_-_G2.pem Adding debian:HARICA_TLS_ECC_Root_CA_2021.pem Adding debian:HARICA_TLS_RSA_Root_CA_2021.pem Adding debian:Hellenic_Academic_and_Research_Institutions_ECC_RootCA_2015.pem Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2015.pem Adding debian:HiPKI_Root_CA_-_G1.pem Adding debian:Hongkong_Post_Root_CA_3.pem Adding debian:ISRG_Root_X1.pem Adding debian:ISRG_Root_X2.pem Adding debian:IdenTrust_Commercial_Root_CA_1.pem Adding debian:IdenTrust_Public_Sector_Root_CA_1.pem Adding debian:Izenpe.com.pem Adding debian:Microsec_e-Szigno_Root_CA_2009.pem Adding debian:Microsoft_ECC_Root_Certificate_Authority_2017.pem Adding debian:Microsoft_RSA_Root_Certificate_Authority_2017.pem Adding debian:NAVER_Global_Root_Certification_Authority.pem Adding debian:NetLock_Arany_=Class_Gold=_Főtanúsítvány.pem Adding debian:OISTE_WISeKey_Global_Root_GB_CA.pem Adding debian:OISTE_WISeKey_Global_Root_GC_CA.pem Adding debian:QuoVadis_Root_CA_1_G3.pem Adding debian:QuoVadis_Root_CA_2.pem Adding debian:QuoVadis_Root_CA_2_G3.pem Adding debian:QuoVadis_Root_CA_3.pem Adding debian:QuoVadis_Root_CA_3_G3.pem Adding debian:SSL.com_EV_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_EV_Root_Certification_Authority_RSA_R2.pem Adding debian:SSL.com_Root_Certification_Authority_ECC.pem Adding debian:SSL.com_Root_Certification_Authority_RSA.pem Adding debian:SSL.com_TLS_ECC_Root_CA_2022.pem Adding debian:SSL.com_TLS_RSA_Root_CA_2022.pem Adding debian:SZAFIR_ROOT_CA2.pem Adding debian:Sectigo_Public_Server_Authentication_Root_E46.pem Adding debian:Sectigo_Public_Server_Authentication_Root_R46.pem Adding debian:SecureSign_Root_CA12.pem Adding debian:SecureSign_Root_CA14.pem Adding debian:SecureSign_Root_CA15.pem Adding debian:SecureTrust_CA.pem Adding debian:Secure_Global_CA.pem Adding debian:Security_Communication_ECC_RootCA1.pem Adding debian:Security_Communication_RootCA2.pem Adding debian:Starfield_Class_2_CA.pem Adding debian:Starfield_Root_Certificate_Authority_-_G2.pem Adding debian:Starfield_Services_Root_Certificate_Authority_-_G2.pem Adding debian:SwissSign_Gold_CA_-_G2.pem Adding debian:T-TeleSec_GlobalRoot_Class_2.pem Adding debian:T-TeleSec_GlobalRoot_Class_3.pem Adding debian:TUBITAK_Kamu_SM_SSL_Kok_Sertifikasi_-_Surum_1.pem Adding debian:TWCA_CYBER_Root_CA.pem Adding debian:TWCA_Global_Root_CA.pem Adding debian:TWCA_Root_Certification_Authority.pem Adding debian:Telekom_Security_TLS_ECC_Root_2020.pem Adding debian:Telekom_Security_TLS_RSA_Root_2023.pem Adding debian:TeliaSonera_Root_CA_v1.pem Adding debian:Telia_Root_CA_v2.pem Adding debian:TrustAsia_Global_Root_CA_G3.pem Adding debian:TrustAsia_Global_Root_CA_G4.pem Adding debian:Trustwave_Global_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P256_Certification_Authority.pem Adding debian:Trustwave_Global_ECC_P384_Certification_Authority.pem Adding debian:TunTrust_Root_CA.pem Adding debian:UCA_Extended_Validation_Root.pem Adding debian:UCA_Global_G2_Root.pem Adding debian:USERTrust_ECC_Certification_Authority.pem Adding debian:USERTrust_RSA_Certification_Authority.pem Adding debian:XRamp_Global_CA_Root.pem Adding debian:certSIGN_ROOT_CA.pem Adding debian:certSIGN_Root_CA_G2.pem Adding debian:e-Szigno_Root_CA_2017.pem Adding debian:ePKI_Root_Certification_Authority.pem Adding debian:emSign_ECC_Root_CA_-_C3.pem Adding debian:emSign_ECC_Root_CA_-_G3.pem Adding debian:emSign_Root_CA_-_C1.pem Adding debian:emSign_Root_CA_-_G1.pem Adding debian:vTrus_ECC_Root_CA.pem Adding debian:vTrus_Root_CA.pem done. Setting up maven (3.9.9-1) ... update-alternatives: using /usr/share/maven/bin/mvn to provide /usr/bin/mvn (mvn) in auto mode Setting up openjdk-21-jre:amd64 (21.0.8+9-1) ... Setting up ant (1.10.15-1) ... Setting up junit4 (4.13.2-5) ... Setting up openjdk-21-jdk-headless:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jar to provide /usr/bin/jar (jar) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jarsigner to provide /usr/bin/jarsigner (jarsigner) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javac to provide /usr/bin/javac (javac) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javadoc to provide /usr/bin/javadoc (javadoc) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/javap to provide /usr/bin/javap (javap) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jcmd to provide /usr/bin/jcmd (jcmd) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdb to provide /usr/bin/jdb (jdb) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdeprscan to provide /usr/bin/jdeprscan (jdeprscan) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jdeps to provide /usr/bin/jdeps (jdeps) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jfr to provide /usr/bin/jfr (jfr) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jimage to provide /usr/bin/jimage (jimage) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jinfo to provide /usr/bin/jinfo (jinfo) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jlink to provide /usr/bin/jlink (jlink) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jmap to provide /usr/bin/jmap (jmap) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jmod to provide /usr/bin/jmod (jmod) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jps to provide /usr/bin/jps (jps) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jrunscript to provide /usr/bin/jrunscript (jrunscript) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jshell to provide /usr/bin/jshell (jshell) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstack to provide /usr/bin/jstack (jstack) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstat to provide /usr/bin/jstat (jstat) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jstatd to provide /usr/bin/jstatd (jstatd) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jwebserver to provide /usr/bin/jwebserver (jwebserver) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/serialver to provide /usr/bin/serialver (serialver) in auto mode update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jhsdb to provide /usr/bin/jhsdb (jhsdb) in auto mode Setting up default-jre-headless (2:1.21-76) ... Setting up ant-contrib (1.0~b3+svn177-12) ... Setting up maven-repo-helper (1.11) ... Setting up default-jre (2:1.21-76) ... Setting up libmaven-antrun-plugin-java (3.1.0-1) ... Setting up libplexus-ant-factory-java (1.0~alpha2.1-5) ... Setting up openjdk-21-jdk:amd64 (21.0.8+9-1) ... update-alternatives: using /usr/lib/jvm/java-21-openjdk-amd64/bin/jconsole to provide /usr/bin/jconsole (jconsole) in auto mode Setting up default-jdk-headless (2:1.21-76) ... Setting up libjsap-java (2.1-5) ... Setting up r-cran-rjava (1.0-11-2) ... Setting up libdsiutils-java (2.7.3+dfsg-1) ... Setting up junit5 (5.10.3-1) ... Setting up libjson-java (3.1.0+dfsg-2) ... Setting up libhtsjdk-java (4.1.3+dfsg-2) ... Setting up libmaven-plugin-tools-java (3.10.2-2) ... Setting up libgkl-java (0.8.11+dfsg-2) ... Setting up default-jdk (2:1.21-76) ... Setting up libpicard-java (3.3.0+dfsg-2) ... Setting up libicb-utils-java (2.0.1+git20161002.afee1d9-5) ... Processing triggers for sgml-base (1.31+nmu1) ... Setting up libvelocity-tools-java (2.0-9) ... Setting up libdoxia-sitetools-java (2.0.0-1) ... Setting up libmaven-site-plugin-java (3.21.0-1) ... Setting up libmaven-javadoc-plugin-java (3.10.1-2) ... Setting up libmaven-reporting-impl-java (4.0.0-1) ... Setting up libsurefire-java (2.22.3-4) ... Setting up libmaven-dependency-plugin-java (3.8.1-1) ... Setting up maven-debian-helper (2.6.7) ... Processing triggers for ca-certificates (20250419) ... Updating certificates in /etc/ssl/certs... 0 added, 0 removed; done. Running hooks in /etc/ca-certificates/update.d... done. Processing triggers for ca-certificates-java (20240118) ... done. Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: user script /srv/workspace/pbuilder/902668/tmp/hooks/A99_set_merged_usr starting Not re-configuring usrmerge for trixie I: user script /srv/workspace/pbuilder/902668/tmp/hooks/A99_set_merged_usr finished hostname: Name or service not known I: Running cd /build/reproducible-path/libgoby-java-3.3.1+dfsg2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../libgoby-java_3.3.1+dfsg2-11_source.changes dpkg-buildpackage: info: source package libgoby-java dpkg-buildpackage: info: source version 3.3.1+dfsg2-11 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Pierre Gruet dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean --with javahelper dh_auto_clean bash -c "for dir in \$(find . -name target -type d); do if [ -f \$(echo \$dir | sed -e s/target\$/pom.xml/) ]; then rm -Rf \$dir; fi done" mh_unpatchpoms -plibgoby-io-java jh_clean Duplicate specification "u=s" for option "u" debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' dh_clean rm -rf goby-distribution/test-data goby-distribution/test-results rm -rf test-results/ make[1]: Leaving directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' debian/rules binary dh binary --with javahelper dh_update_autotools_config dh_autoreconf dh_auto_configure mh_patchpoms -plibgoby-io-java --debian-build --keep-pom-version --maven-repo=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo jh_linkjars dh_auto_build /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode package -DskipTests -Dnotimestamp=true -Dlocale=en_US OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] The artifact org.apache.maven.plugins:maven-surefire-plugin:jar:2.17 has been relocated to org.apache.maven.plugins:maven-surefire-plugin:jar:2.22.3 [WARNING] The artifact org.apache.maven.plugins:maven-jar-plugin:jar:3.1.2 has been relocated to org.apache.maven.plugins:maven-jar-plugin:jar:3.3.0 [WARNING] Parameter 'additionalparam' is unknown for plugin 'maven-javadoc-plugin:3.10.1:jar (attach-javadocs)' [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] [mkdir] Created dir: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-io --- [INFO] Copying 2 resources from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-io --- [INFO] Recompiling the module because of changed source code. [INFO] Compiling 260 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- antrun:3.1.0:run (default) @ goby-io --- [WARNING] Parameter 'tasks' is deprecated: Use target instead. For version 3.0.0, this parameter is only defined to break the build if you use it! [WARNING] Parameter tasks is deprecated, use target instead [INFO] Executing tasks [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2 [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/classes [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-io --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-io --- [INFO] No sources to compile [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-io --- [INFO] Tests are skipped. [INFO] [INFO] --- jar:3.3.0:jar (default-jar) @ goby-io --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1.jar [INFO] [INFO] >>> source:3.3.1:jar (attach-sources) > generate-sources @ goby-io >>> [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] <<< source:3.3.1:jar (attach-sources) < generate-sources @ goby-io <<< [INFO] [INFO] [INFO] --- source:3.3.1:jar (attach-sources) @ goby-io --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1-sources.jar [INFO] [INFO] --- javadoc:3.10.1:jar (attach-javadocs) @ goby-io --- [INFO] Adding the --ignore-source-errors option [INFO] No previous run data found, generating javadoc. [WARNING] Javadoc Warnings [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/methylation/MethylSimilarityScan.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlRootElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:31: error: cannot find symbol [WARNING] @XmlRootElement [WARNING] ^ [WARNING] symbol: class XmlRootElement [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:27: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.REXP; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:28: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RVector; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:29: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:208: error: cannot find symbol [WARNING] private static Result evaluateFisherExpression(final Rengine rengine, [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class FisherExact [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:24: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:56: error: cannot find symbol [WARNING] private Rengine rengine; [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class GobyRengine [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:127: error: cannot find symbol [WARNING] public Rengine getRengine() { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class GobyRengine [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:21: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RMainLoopCallbacks; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:22: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:27: error: cannot find symbol [WARNING] class RConsoleMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ [WARNING] symbol: class RMainLoopCallbacks [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:35: error: cannot find symbol [WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:50: error: cannot find symbol [WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:70: error: cannot find symbol [WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:81: error: cannot find symbol [WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:92: error: cannot find symbol [WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:101: error: cannot find symbol [WARNING] public void rFlushConsole(final Rengine rengine) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:111: error: cannot find symbol [WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:120: error: cannot find symbol [WARNING] public void rLoadHistory(final Rengine re, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:23: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.RMainLoopCallbacks; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:24: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:29: error: cannot find symbol [WARNING] class RLoggerMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ [WARNING] symbol: class RMainLoopCallbacks [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:42: error: cannot find symbol [WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:57: error: cannot find symbol [WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:77: error: cannot find symbol [WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:88: error: cannot find symbol [WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:99: error: cannot find symbol [WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:108: error: cannot find symbol [WARNING] public void rFlushConsole(final Rengine rengine) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:118: error: cannot find symbol [WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:127: error: cannot find symbol [WARNING] public void rLoadHistory(final Rengine re, final String filename) { [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class RLoggerMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/EstimatedDistribution.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:32: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:43: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:44: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:45: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Unmarshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:76: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class StatsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:39: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:40: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelRegion; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:41: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:53: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:54: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:55: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Marshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:106: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:325: error: cannot find symbol [WARNING] protected synchronized ParallelTeam getParallelTeam() { [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:23: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlElementWrapper; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:24: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlRootElement; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:32: error: cannot find symbol [WARNING] @XmlRootElement(name = "info-output") [WARNING] ^ [WARNING] symbol: class XmlRootElement [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:441: error: cannot find symbol [WARNING] private void writeInfoOutput() throws JAXBException, IOException { [WARNING] ^ [WARNING] symbol: class JAXBException [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessorType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: class XmlAccessorType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:21: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:22: error: package javax.xml.bind.annotation does not exist [WARNING] import javax.xml.bind.annotation.XmlAccessorType; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: class XmlAccessorType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:283: error: cannot find symbol [WARNING] class BasenameParallelRegion extends ParallelRegion { [WARNING] ^ [WARNING] symbol: class ParallelRegion [WARNING] location: class CompactAlignmentToAnnotationCountsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:30: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.CommandLine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:31: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.DefaultExecutor; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:32: error: package org.apache.commons.exec does not exist [WARNING] import org.apache.commons.exec.PumpStreamHandler; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/SimulateBisulfiteReads.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:34: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBContext; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:35: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.JAXBException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:36: error: package javax.xml.bind does not exist [WARNING] import javax.xml.bind.Marshaller; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:696: error: cannot find symbol [WARNING] private void writeXml(PrintWriter output, String[] samples, MethylStats[] methylStats) throws JAXBException { [WARNING] ^ [WARNING] symbol: class JAXBException [WARNING] location: class MethylStatsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/PercentMismatchesQualityFilter.java:23: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/TestRConnectionMode.java:25: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/FastaToCompactMode.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.PJProperties; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/BetweenGroupSequenceVariationOutputFormat.java:40: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/MethylationRateVCFOutputFormat.java:45: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/CompareGroupsVCFOutputFormat.java:42: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/FisherExactTestAdaptor.java:23: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactTestCalculator.java:21: error: package DistLib does not exist [WARNING] import DistLib.hypergeometric; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:26: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:68: error: cannot find symbol [WARNING] Rengine rEngine; [WARNING] ^ [WARNING] symbol: class Rengine [WARNING] location: class FisherExactRCalculator [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AnnotationAveragingWriter.java:39: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:24: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelRegion; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:31: error: cannot find symbol [WARNING] class BasenameParallelRegion extends ParallelRegion { [WARNING] ^ [WARNING] symbol: class ParallelRegion [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:21: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.ParallelTeam; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:33: error: cannot find symbol [WARNING] private ParallelTeam team; [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class DoInParallel [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/DoInParallel.java:47: error: cannot find symbol [WARNING] protected synchronized ParallelTeam getParallelTeam() { [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class DoInParallel [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/PlantIndels.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/FoldChangeForExonPairs.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: variable XmlAccessType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:35: error: cannot find symbol [WARNING] @XmlElement(name = "al") [WARNING] ^ [WARNING] symbol: class XmlElement [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:36: error: cannot find symbol [WARNING] @XmlElementWrapper(name = "annotation-lengths") [WARNING] ^ [WARNING] symbol: class XmlElementWrapper [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/SampleTotalCount.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ [WARNING] symbol: variable XmlAccessType [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:39: error: cannot find symbol [WARNING] @XmlElement(name = "tc") [WARNING] ^ [WARNING] symbol: class XmlElement [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/InfoOutput.java:40: error: cannot find symbol [WARNING] @XmlElementWrapper(name = "total-counts") [WARNING] ^ [WARNING] symbol: class XmlElementWrapper [WARNING] location: class InfoOutput [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/dsv/CommonIndelArtifactFilter.java:17: warning: invalid input: '<' [WARNING] * larger than expected (P<0.05, with Poisson cumulative distribution) from prior observations (most of them are assumed to be errors). [WARNING] ^ [WARNING] 100 warnings [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/goby-io-3.3.1-javadoc.jar [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] Parameter 'additionalparam' is unknown for plugin 'maven-javadoc-plugin:3.10.1:jar (attach-javadocs)' [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-distribution --- [INFO] Copying 3 resources from src/main/resources to target/classes [INFO] Copying 72 resources from src/main/java to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 525 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-distribution --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 120 source files with javac [debug target 1.8] to target/test-classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-distribution --- [INFO] Tests are skipped. [INFO] [INFO] --- jar:3.3.0:jar (default-jar) @ goby-distribution --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1.jar [INFO] [INFO] >>> source:3.3.1:jar (attach-sources) > generate-sources @ goby-distribution >>> [INFO] [INFO] <<< source:3.3.1:jar (attach-sources) < generate-sources @ goby-distribution <<< [INFO] [INFO] [INFO] --- source:3.3.1:jar (attach-sources) @ goby-distribution --- [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1-sources.jar [INFO] [INFO] --- javadoc:3.10.1:jar (attach-javadocs) @ goby-distribution --- [INFO] Adding the --ignore-source-errors option [INFO] No previous run data found, generating javadoc. [WARNING] Javadoc Warnings [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/dsv/CommonIndelArtifactFilter.java:17: warning: invalid input: '<' [WARNING] * larger than expected (P<0.05, with Poisson cumulative distribution) from prior observations (most of them are assumed to be errors). [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticCoder.java:56: warning: reference not found: it.unimi.dsi.mg4j.io.ArithmeticDecoder [WARNING] * @see it.unimi.dsi.mg4j.io.ArithmeticDecoder (MG4J). [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoder.java:33: warning: reference not found: it.unimi.dsi.mg4j.io.ArithmeticDecoder [WARNING] * @see it.unimi.dsi.mg4j.io.ArithmeticDecoder (MG4J) [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:60: warning: @return tag cannot be used in method with void return type. [WARNING] void flush(InputBitStream ibs) throws IOException; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:51: warning: reference not found: #BITS [WARNING] * the call, exactly {@link #BITS} excess bits will be present in the [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/FastArithmeticDecoderI.java:65: warning: reference not found: #BITS [WARNING] * @return the current bit stream window in the lower {@link #BITS} bits. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:72: warning: reference not found: org.campagnelab.goby.aligners.LastagAligner [WARNING] * @see org.campagnelab.goby.aligners.LastagAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:79: warning: reference not found: org.campagnelab.goby.aligners.LastAligner [WARNING] * @see org.campagnelab.goby.aligners.LastAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:87: warning: reference not found: org.campagnelab.goby.aligners.BWAAligner [WARNING] * @see org.campagnelab.goby.aligners.BWAAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/config/GobyConfiguration.java:95: warning: reference not found: org.campagnelab.goby.aligners.GSnapAligner [WARNING] * @see org.campagnelab.goby.aligners.GSnapAligner [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:131: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * @return the next {@link edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/AlignmentReader.java:258: warning: invalid input: '<' [WARNING] * positions p are startPosition <= p < endPosition [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/compression/MoveToFrontCoder.java:42: warning: invalid input: '<' [WARNING] * @param symbol Symbol to encode with move to front (precondition: 0<= symbol ?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/QualityEncoding.java:41: warning: invalid input: '<' [WARNING] * !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparison.java:233: warning: @return tag cannot be used in method with void return type. [WARNING] public void setCountComparisonFailures(final boolean countComparisonFailures) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparison.java:275: warning: @return tag cannot be used in method with void return type. [WARNING] public void setAllowSourceNs(boolean allowSourceNs) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/sam/SamComparisonInterface.java:130: warning: @return tag cannot be used in method with void return type. [WARNING] public void setAllowSourceNs(boolean allowSourceNs); [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SAMComparisonMode.java:214: warning: @return tag cannot be used in method with void return type. [WARNING] public void setCheckMate(final boolean checkMate) { [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SamExtractReadsMode.java:44: warning: invalid input: '<' [WARNING] * WARNING: If the file contains pairs, the source SAM/BAM file >>MUST<< be sorted by read name. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SamExtractReadsMode.java:44: warning: invalid input: '<' [WARNING] * WARNING: If the file contains pairs, the source SAM/BAM file >>MUST<< be sorted by read name. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SampleQualityScoresMode.java:176: warning: invalid input: '<' [WARNING] * Set to <= 0 to process the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '&' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '&' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/Segment.java:137: warning: invalid input: '<' [WARNING] * Determine if the segment overlaps with position. This method evaluates to position>=start && position<=end; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/SortMode.java:142: warning: invalid input: '<' [WARNING] * Set to < 0 for auto-detect number of cores. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/vcf/VCFParser.java:179: warning: invalid input: '<' [WARNING] * Set to <= 0 to scan the entire file. This must be set before calling readHeader() for the value to be used. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/BullardUpperQuartileNormalization.java:133: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public final double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:216: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:186: warning: invalid input: '<' [WARNING] * Get the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:193: warning: invalid input: '<' [WARNING] * Number of reads observed because of sampleFraction value < 1.0d. If sampleFraction == 1.0d [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/ReadQualityStatsMode.java:185: warning: invalid input: '<' [WARNING] * Number of reads skipped because of sampleFraction value < 1.0d. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:364: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:388: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/core/TabToColumnInfoModeCore.java:224: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/modes/TabToColumnInfoMode.java:194: warning: invalid input: '<' [WARNING] * Set the number of input lines to read or set to <= 0 to read the entire file. [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:340: warning: reference not found: gominer.Fisher#fisher(int, int, int, int) [WARNING] * {@link gominer.Fisher#fisher(int, int, int, int)}. [WARNING] ^ [WARNING] 91 warnings [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-distribution-3.3.1-javadoc.jar [INFO] [INFO] --- assembly:3.4.2:single (make-assembly) @ goby-distribution --- [WARNING] Parameter 'finalName' is read-only, must not be used in configuration [INFO] Reading assembly descriptor: assembly/assembly.xml [INFO] Building jar: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/target/goby-bin.jar [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.052 s] [INFO] Goby I/O ........................................... SUCCESS [ 18.999 s] [INFO] Goby Full Distribution ............................. SUCCESS [ 19.551 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 38.710 s [INFO] Finished at: 2025-08-07T07:20:57+14:00 [INFO] ------------------------------------------------------------------------ debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' # Create a symlink to the directory with test data for tests run from the # goby-distribution directory. ln -s ../test-data goby-distribution/test-data # The test-results directory should exist because test classes will write inside. if [ ! -e test-results ]; then mkdir test-results/; fi # Putting the JRI location in the path, as indicated in GobyRengine.java. # Also indicating R_HOME, as found in http://rforge.net/JRI/. export LD_LIBRARY_PATH="$LD_LIBRARY_PATH:/usr/lib/R/site-library/rJava/jri" && \ export R_HOME="/usr/lib/R" && \ dh_auto_test --no-parallel /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode test OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [WARNING] The artifact org.apache.maven.plugins:maven-surefire-plugin:jar:2.17 has been relocated to org.apache.maven.plugins:maven-surefire-plugin:jar:2.22.3 [INFO] [INFO] --- build-helper:3.3.0:add-source (add-classes) @ goby-io --- [INFO] Source directory: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/generated-sources added. [INFO] [INFO] --- antrun:3.1.0:run (exec-java-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- antrun:3.1.0:run (exec-python-cpp-protoc) @ goby-io --- [INFO] Executing tasks [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-io --- [INFO] Copying 2 resources from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] Copying 1 resource from src/main/resources to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-io --- [INFO] Recompiling the module because of changed source code. [INFO] Compiling 260 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/dynoptions/DynamicOptionRegistry.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/ConcatAlignmentReader.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- antrun:3.1.0:run (default) @ goby-io --- [WARNING] Parameter 'tasks' is deprecated: Use target instead. For version 3.0.0, this parameter is only defined to break the build if you use it! [WARNING] Parameter tasks is deprecated, use target instead [INFO] Executing tasks [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2 [INFO] [copy] Copying 1 file to /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/target/classes [INFO] Executed tasks [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-io --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-io --- [INFO] No sources to compile [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-io --- [INFO] No tests to run. [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- resources:3.3.1:resources (default-resources) @ goby-distribution --- [INFO] Copying 3 resources from src/main/resources to target/classes [INFO] Copying 72 resources from src/main/java to target/classes [INFO] [INFO] --- compiler:3.13.0:compile (default-compile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 525 source files with javac [debug target 1.8] to target/classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[119,45] Integer(int) in java.lang.Integer has been deprecated and marked for removal [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/reads/ReadsToTextWriter.java:[146,39] Integer(int) in java.lang.Integer has been deprecated and marked for removal [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/alignments/PositionToBasesMap.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/util/VariantMapHelper.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- resources:3.3.1:testResources (default-testResources) @ goby-distribution --- [INFO] skip non existing resourceDirectory /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/resources [INFO] [INFO] --- compiler:3.13.0:testCompile (default-testCompile) @ goby-distribution --- [INFO] Recompiling the module because of changed dependency. [INFO] Compiling 120 source files with javac [debug target 1.8] to target/test-classes [WARNING] bootstrap class path not set in conjunction with -source 8 [WARNING] source value 8 is obsolete and will be removed in a future release [WARNING] target value 8 is obsolete and will be removed in a future release [WARNING] To suppress warnings about obsolete options, use -Xlint:-options. [INFO] Annotation processing is enabled because one or more processors were found on the class path. A future release of javac may disable annotation processing unless at least one processor is specified by name (-processor), or a search path is specified (--processor-path, --processor-module-path), or annotation processing is enabled explicitly (-proc:only, -proc:full). Use -Xlint:-options to suppress this message. Use -proc:none to disable annotation processing. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Some input files use or override a deprecated API. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/TestQFast.java: Recompile with -Xlint:deprecation for details. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Some input files use unchecked or unsafe operations. [INFO] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/test/java/org/campagnelab/goby/algorithmic/algorithm/dmr/TestDeNovoDMRfinder.java: Recompile with -Xlint:unchecked for details. [INFO] [INFO] --- surefire:2.22.3:test (default-test) @ goby-distribution --- [INFO] [INFO] ------------------------------------------------------- [INFO] T E S T S [INFO] ------------------------------------------------------- [INFO] Running TestSuite field CHROM value: 0 field POS value: 145497099 field ID value: . field REF value: A field ALT value: G field QUAL value: 17.1 field FILTER value: . field INFO[DP] value: 2 field INFO[DP4] value: 0,0,2,0 field INFO[MQ] value: 25 field INFO[FQ] value: -30.8 field INFO[AF1] value: 0.9999 field INFO[CI95] value: 0.5,1 field INFO[PV4] value: field INFO[INDEL] value: INDEL field INFO[PC2] value: 3,3 field INFO[PCHI2] value: 0.752 field INFO[QCHI2] value: 1 field INFO[RP] value: field FORMAT[GT] value: field FORMAT[GQ] value: field FORMAT[GL] value: field FORMAT[DP] value: field FORMAT[SP] value: field FORMAT[PL] value: field results/IPBKRNW/IPBKRNW-replicate.bam[GT] value: 1/1 field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] value: 42 field results/IPBKRNW/IPBKRNW-replicate.bam[GL] value: field results/IPBKRNW/IPBKRNW-replicate.bam[DP] value: field results/IPBKRNW/IPBKRNW-replicate.bam[SP] value: field results/IPBKRNW/IPBKRNW-replicate.bam[PL] value: 25,3,0 field results/IPBKRNW/IPBKRNW-sorted.bam[GT] value: 1/1 field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] value: 42 field results/IPBKRNW/IPBKRNW-sorted.bam[GL] value: field results/IPBKRNW/IPBKRNW-sorted.bam[DP] value: field results/IPBKRNW/IPBKRNW-sorted.bam[SP] value: field results/IPBKRNW/IPBKRNW-sorted.bam[PL] value: 25,3,0 field CHROM gfi:0 value: 0 field POS gfi:1 value: 145497099 field ID gfi:2 value: . field REF gfi:3 value: A field ALT gfi:4 value: G field QUAL gfi:5 value: 17.1 field FILTER gfi:6 value: . field FORMAT[GT] gfi:7 value: field FORMAT[GQ] gfi:8 value: field FORMAT[GL] gfi:9 value: field FORMAT[DP] gfi:10 value: field FORMAT[SP] gfi:11 value: field FORMAT[PL] gfi:12 value: field results/IPBKRNW/IPBKRNW-replicate.bam[GT] gfi:13 value: 1/1 field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] gfi:14 value: 11 field results/IPBKRNW/IPBKRNW-replicate.bam[GL] gfi:15 value: field results/IPBKRNW/IPBKRNW-replicate.bam[DP] gfi:16 value: field results/IPBKRNW/IPBKRNW-replicate.bam[SP] gfi:17 value: field results/IPBKRNW/IPBKRNW-replicate.bam[PL] gfi:18 value: 015,4,0 field results/IPBKRNW/IPBKRNW-sorted.bam[GT] gfi:19 value: 1/1 field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] gfi:20 value: 42 field results/IPBKRNW/IPBKRNW-sorted.bam[GL] gfi:21 value: field results/IPBKRNW/IPBKRNW-sorted.bam[DP] gfi:22 value: field results/IPBKRNW/IPBKRNW-sorted.bam[SP] gfi:23 value: field results/IPBKRNW/IPBKRNW-sorted.bam[PL] gfi:24 value: 25,3,0 SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/share/java/slf4j-simple.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven-repo/ch/qos/logback/logback-classic/debian/logback-classic-debian.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/share/java/logback-classic.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. SLF4J: Actual binding is of type [org.slf4j.impl.SimpleLoggerFactory] 07:21:10.903 WARN MessageChunksWriter - Using chunk-size=10000 Total logical entries written: 1 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 45 07:21:10.972 WARN GobyVersion - Version number UNKNOWN not recognized. Assuming this version is the most recent. 07:21:11.335 INFO RLoggerMainLoopCallback - 07:21:11.335 INFO RLoggerMainLoopCallback - R version 4.5.0 (2025-04-11) -- "How About a Twenty-Six" Copyright (C) 2025 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu 07:21:11.335 INFO RLoggerMainLoopCallback - R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. 07:21:11.335 INFO RLoggerMainLoopCallback - R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. 07:21:11.335 INFO RLoggerMainLoopCallback - Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. 07:21:11.517 WARN MessageChunksWriter - Using chunk-size=9 07:21:11.522 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 660 Average bytes/logical entry: 16.923077 Number of bits/base 3.6590436 07:21:11.525 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 685 Average bytes/logical entry: 17.564102 Number of bits/base 3.797644 07:21:11.530 WARN MessageChunksWriter - Using chunk-size=9 Total logical entries written: 39 Total bytes written: 660 Average bytes/logical entry: 16.923077 Number of bits/base 3.6590436 >1 NNTGAATGAGACCTA qPhred=1 qPhred=2 qPhred=3 qPhred=4 qPhred=5 qPhred=6 qPhred=7 qPhred=8 qPhred=9 qPhred=10 qPhred=11 qPhred=12 qPhred=13 qPhred=14 qPhred=15 qPhred=16 qPhred=17 qPhred=18 qPhred=19 qPhred=20 qPhred=21 qPhred=22 qPhred=23 qPhred=24 qPhred=25 qPhred=26 qPhred=27 qPhred=28 qPhred=29 qPhred=30 qPhred=31 qPhred=32 qPhred=33 qPhred=34 qPhred=35 qPhred=36 qPhred=37 qPhred=38 qPhred=39 qPhred=40 qPhred=41 qPhred=42 qPhred=43 qPhred=44 qPhred=45 qPhred=46 qPhred=47 qPhred=48 qPhred=49 qPhred=50 qPhred=51 qPhred=52 qPhred=53 qPhred=54 qPhred=55 qPhred=56 qPhred=57 qPhred=58 qPhred=59 qPhred=60 qPhred=61 0 AAC 3 ACC 6 ATC 9 AGC 12 AAC 15 ACC 18 ATC 21 AGC 24 AAC 27 ACC 30 ATC 33 AGC 36 AAC 39 ACC 42 ATC 45 AGC 48 AAC 51 ACC 54 ATC 57 AGC 60 AAC 63 ACC 66 ATC 69 AGC 72 AAC 75 ACC 78 ATC 81 AGCloading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=6 count=1 (0,1) loading transition for reader[0] position=1 length=3 count=3 (0,1)(1,4) loading transition for reader[0] position=4 length=2 count=0 (0,1)(1,4)(4,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 (0,0) loading transition for reader[0] position=1 length=1 count=1 (0,0)(1,1) loading transition for reader[0] position=2 length=4 count=0 (0,0)(1,1)(2,0) loading transition for reader[1] position=4 length=10 count=1 (0,0)(1,1)(2,0)(4,1) loading transition for reader[0] position=6 length=2 count=1 (0,0)(1,1)(2,0)(4,1)(6,2) loading transition for reader[0] position=8 length=1 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1) loading transition for reader[0] position=9 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) loading transition for reader[0] position=10 length=2 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) loading transition for reader[0] position=12 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) loading transition for reader[0] position=13 length=3 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) loading transition for reader[0] position=16 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 loading transition for reader[0] position=1 length=1 count=1 loading transition for reader[0] position=2 length=4 count=0 loading transition for reader[1] position=4 length=10 count=1 loading transition for reader[0] position=6 length=2 count=1 loading transition for reader[0] position=8 length=1 count=0 loading transition for reader[0] position=9 length=1 count=1 loading transition for reader[0] position=10 length=2 count=0 loading transition for reader[0] position=12 length=1 count=1 loading transition for reader[0] position=13 length=3 count=0 loading transition for reader[0] position=16 length=1 count=1 peak : start :5 count :13 length :100010 peak : start :100020 count :10 length :1 07:21:15.315 WARN WiggleWindow - Not writing 101 7 07:21:15.315 WARN WiggleWindow - Not writing 111 7 07:21:15.315 WARN WiggleWindow - Not writing 131 8 07:21:15.316 WARN WiggleWindow - Not writing 141 8 07:21:15.316 WARN WiggleWindow - Not writing 151 8 appending (count=0,length=1) appending (count=4,length=3) appending (count=1,length=3) appending (count=0,length=2) appending (count=3,length=1) appending (count=1,length=1) appending (count=0,length=1) appending (count=4,length=3) appending (count=0,length=5) appending (count=3,length=1) appending (count=0,length=2) appending (count=2,length=1) appending (count=0,length=2) appending (count=3,length=1) appending (count=2,length=1) appending (count=0,length=1) appending (count=10,length=4) appending (count=1,length=0) appending (count=2,length=8) Hello appending (count=10,length=4) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=6 count=1 (0,1) loading transition for reader[0] position=1 length=3 count=3 (0,1)(1,4) loading transition for reader[0] position=4 length=2 count=0 (0,1)(1,4)(4,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 (0,0) loading transition for reader[0] position=1 length=1 count=1 (0,0)(1,1) loading transition for reader[0] position=2 length=4 count=0 (0,0)(1,1)(2,0) loading transition for reader[1] position=4 length=10 count=1 (0,0)(1,1)(2,0)(4,1) loading transition for reader[0] position=6 length=2 count=1 (0,0)(1,1)(2,0)(4,1)(6,2) loading transition for reader[0] position=8 length=1 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1) loading transition for reader[0] position=9 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) loading transition for reader[0] position=10 length=2 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) loading transition for reader[0] position=12 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) loading transition for reader[0] position=13 length=3 count=0 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) loading transition for reader[0] position=16 length=1 count=1 (0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) loading transition for reader[0] position=0 length=1 count=0 loading transition for reader[1] position=0 length=4 count=0 loading transition for reader[0] position=1 length=1 count=1 loading transition for reader[0] position=2 length=4 count=0 loading transition for reader[1] position=4 length=10 count=1 loading transition for reader[0] position=6 length=2 count=1 loading transition for reader[0] position=8 length=1 count=0 loading transition for reader[0] position=9 length=1 count=1 loading transition for reader[0] position=10 length=2 count=0 loading transition for reader[0] position=12 length=1 count=1 loading transition for reader[0] position=13 length=3 count=0 loading transition for reader[0] position=16 length=1 count=1 loading transition for reader[0] position=0 length=1 count=0 (0,0) loading transition for reader[0] position=1 length=3 count=1 (0,0)(1,1) Appending count: 497 length: 3 Appending count: 33567 length: 6 Appending count: 47675 length: 3 Appending count: 22804 length: 2 Appending count: 5178 length: 6 Appending count: 32523 length: 4 Appending count: 28381 length: 4 Appending count: 46184 length: 1 Appending count: 32066 length: 10 Appending count: 49035 length: 5 Appending count: 22152 length: 6 Appending count: 40257 length: 8 Appending count: 25232 length: 9 Appending count: 8391 length: 2 Appending count: 6253 length: 8 Appending count: 41658 length: 8 Appending count: 16202 length: 1 Appending count: 8522 length: 1 Appending count: 22010 length: 4 Appending count: 27645 length: 1 Appending count: 24683 length: 2 Appending count: 8015 length: 7 Appending count: 6484 length: 3 Appending count: 38775 length: 6 Appending count: 26685 length: 2 Appending count: 25493 length: 6 Appending count: 35374 length: 6 Appending count: 15320 length: 7 Appending count: 5680 length: 2 Appending count: 11884 length: 4 position= 0 count= 497 position= 1 count= 497 position= 2 count= 497 position= 3 count= 33567 position= 4 count= 33567 position= 5 count= 33567 position= 6 count= 33567 position= 7 count= 33567 position= 8 count= 33567 position= 9 count= 47675 position= 10 count= 47675 position= 11 count= 47675 position= 12 count= 22804 position= 13 count= 22804 position= 14 count= 5178 position= 15 count= 5178 position= 16 count= 5178 position= 17 count= 5178 position= 18 count= 5178 position= 19 count= 5178 position= 20 count= 32523 position= 21 count= 32523 position= 22 count= 32523 position= 23 count= 32523 position= 24 count= 28381 position= 25 count= 28381 position= 26 count= 28381 position= 27 count= 28381 position= 28 count= 46184 position= 29 count= 32066 position= 30 count= 32066 position= 31 count= 32066 position= 32 count= 32066 position= 33 count= 32066 position= 34 count= 32066 position= 35 count= 32066 position= 36 count= 32066 position= 37 count= 32066 position= 38 count= 32066 position= 39 count= 49035 position= 40 count= 49035 position= 41 count= 49035 position= 42 count= 49035 position= 43 count= 49035 position= 44 count= 22152 position= 45 count= 22152 position= 46 count= 22152 position= 47 count= 22152 position= 48 count= 22152 position= 49 count= 22152 position= 50 count= 40257 position= 51 count= 40257 position= 52 count= 40257 position= 53 count= 40257 position= 54 count= 40257 position= 55 count= 40257 position= 56 count= 40257 position= 57 count= 40257 position= 58 count= 25232 position= 59 count= 25232 position= 60 count= 25232 position= 61 count= 25232 position= 62 count= 25232 position= 63 count= 25232 position= 64 count= 25232 position= 65 count= 25232 position= 66 count= 25232 position= 67 count= 8391 position= 68 count= 8391 position= 69 count= 6253 position= 70 count= 6253 position= 71 count= 6253 position= 72 count= 6253 position= 73 count= 6253 position= 74 count= 6253 position= 75 count= 6253 position= 76 count= 6253 position= 77 count= 41658 position= 78 count= 41658 position= 79 count= 41658 position= 80 count= 41658 position= 81 count= 41658 position= 82 count= 41658 position= 83 count= 41658 position= 84 count= 41658 position= 85 count= 16202 position= 86 count= 8522 position= 87 count= 22010 position= 88 count= 22010 position= 89 count= 22010 position= 90 count= 22010 position= 91 count= 27645 position= 92 count= 24683 position= 93 count= 24683 position= 94 count= 8015 position= 95 count= 8015 position= 96 count= 8015 position= 97 count= 8015 position= 98 count= 8015 position= 99 count= 8015 position= 100 count= 8015 position= 101 count= 6484 position= 102 count= 6484 position= 103 count= 6484 position= 104 count= 38775 position= 105 count= 38775 position= 106 count= 38775 position= 107 count= 38775 position= 108 count= 38775 position= 109 count= 38775 position= 110 count= 26685 position= 111 count= 26685 position= 112 count= 25493 position= 113 count= 25493 position= 114 count= 25493 position= 115 count= 25493 position= 116 count= 25493 position= 117 count= 25493 position= 118 count= 35374 position= 119 count= 35374 position= 120 count= 35374 position= 121 count= 35374 position= 122 count= 35374 position= 123 count= 35374 position= 124 count= 15320 position= 125 count= 15320 position= 126 count= 15320 position= 127 count= 15320 position= 128 count= 15320 position= 129 count= 15320 position= 130 count= 15320 position= 131 count= 5680 position= 132 count= 5680 position= 133 count= 11884 position= 134 count= 11884 position= 135 count= 11884 position= 136 count= 11884 Scanning target file.. Target file had 1 entries. Wrote 1 target ids to alignment header. Setting quality threshold to 0.05 Total logical entries written: 2 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 0 Number of queries: 3 Number of targets: 3 Removed by quality filter: 0 Not best score: 1 Number of alignments written: 2 query_index: 0 target_index: 0 position: 14977972 score: 780.0 matching_reverse_strand: false multiplicity: 1 number_of_mismatches: 1 number_of_indels: 0 query_length: 142 query_aligned_length: 134 target_aligned_length: 134 sequence_variations { to: "T" from: "A" position: 6 to_quality: "/" read_index: 14 } fragment_index: 0 query_index_occurrences: 2 ambiguity: 1 Processing test-data/sample-qual-scores/30reads.fa Processed 0 read entries. Min quality score: 2147483647 Max quality score: -2147483648 Avg quality score: 0 Probable quality encoding scheme: fasta Processing test-data/sample-qual-scores/30reads.fq Processed 30 read entries. Min quality score: 69 Max quality score: 98 Avg quality score: 94 Probable quality encoding scheme: Illumina/Solexa Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.371 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.374 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.376 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.377 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.379 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.380 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.382 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.384 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.385 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.387 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.479 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.480 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.481 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.483 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.484 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.486 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.487 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.489 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.490 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.491 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.554 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.555 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.556 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.557 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.558 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.560 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.561 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.562 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.564 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.565 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.619 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.620 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.621 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.623 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.624 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.625 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.626 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.627 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.629 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.630 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.717 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.718 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.719 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.720 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.721 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.722 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.724 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.725 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.726 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.727 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.775 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.776 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.777 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.779 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.780 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.781 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.782 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.783 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.784 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.785 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.830 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.831 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.832 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.833 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.834 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.835 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.836 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.837 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.838 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.840 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.884 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.885 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.886 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.887 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.888 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.889 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.890 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.891 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.892 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.893 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.936 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.937 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.938 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.939 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.940 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.941 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.942 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.943 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.944 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.945 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:16.987 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:16.988 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:16.989 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:16.990 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:16.991 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:16.992 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:16.993 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:16.994 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:16.995 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:16.996 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B Comparing A/B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:17.069 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:17.070 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:17.071 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:17.072 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:17.072 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:17.073 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:17.074 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:17.075 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:17.076 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:17.077 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A Associating basename: basen3 to group: A Associating basename: basen4 to group: A Associating basename: basen5 to group: B Associating basename: basen6 to group: B Associating basename: basen7 to group: B Associating basename: basen8 to group: B Associating basename: basen9 to group: B sample: basen0 group A sample: basen2 group A sample: basen4 group A sample: basen3 group A sample: basen1 group A sample: basen9 group B sample: basen6 group B sample: basen5 group B sample: basen7 group B sample: basen8 group B Using processor NONE Methylation format ignores thresholdDistinctReadIndices. Additionally, the minimum coverage needed for a site to be reported can be changed with --minimum-variation-support. Filtering reads that have these criteria: [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest_mci [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 07:21:17.129 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 07:21:17.130 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 07:21:17.132 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 07:21:17.133 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 07:21:17.134 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 07:21:17.134 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 07:21:17.135 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 07:21:17.136 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 07:21:17.137 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 07:21:17.138 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + ref: A s=0 info: + /T q=40 s=0 info: - /T q=40 s=0 info: + /C q=10 s=0 info: + /C q=20 s=0 info: + /C q=30 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=40 s=0 info: + /C q=10 s=0 info: + /C q=20 s=0 info: + /N q=30 s=0 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + ref: A s=1 info: + /T q=40 s=1 info: + /T q=10 s=1 info: + /T q=20 s=1 info: + /T q=30 s=1 info: + /N q=40 s=1 info: + /N q=40 s=1 list: pos=-1 #bases: 33 #indels: 0 filtered: {+ ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + /C q=10 s=0, + /C q=20 s=0, + /C q=30 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=10 s=0, + /C q=20 s=0, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + /T q=40 s=1, + /T q=10 s=1, + /T q=20 s=1, + /T q=30 s=1, + /N q=40 s=1, + /N q=40 s=1} Loading test-data/fdr-mode/file1.vcf Loading test-data/fdr-mode/file2.vcf Loading test-data/fdr-mode/file3.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file1.vcf Combining test-data/fdr-mode/file2.vcf Combining test-data/fdr-mode/file3.vcf Loading test-data/fdr-mode/file-B-1.vcf Loading test-data/fdr-mode/file-B-2.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file-B-1.vcf Combining test-data/fdr-mode/file-B-2.vcf Loading test-data/fdr-mode/file-B-1.vcf Loading test-data/fdr-mode/file-B-2.vcf adjusting column: PCHI2 Combining test-data/fdr-mode/file-B-1.vcf Combining test-data/fdr-mode/file-B-2.vcf Loading test-data/fdr-mode/file1.vcf Loading test-data/fdr-mode/file2.vcf Loading test-data/fdr-mode/file3.vcf Combining test-data/fdr-mode/file1.vcf Combining test-data/fdr-mode/file2.vcf Combining test-data/fdr-mode/file3.vcf TTC[27]->CGT[27] / qual=1:2:3 A[15]->G[20] / qual=20 A[15]->G[20] / qual=20 Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences 1/1 ..T [ {N:15} {///////////00//0010} {N:15} {00101111001101100101111101111111/0/} |Encoded in 80 bits [ {N:15} {11111111111001100101100011111001011110011011001011111011111111} {0} {1} {1} {1} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->29 {N:15} {00101111001101100101111101111111101110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->74decoding: 0 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 1 decoding: 2 decoding: 3 decoding: 4 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 1 [ {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {0} {1} {0} {0} {1} {1} {1} {0} {0} {0} {1} {0} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {1} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {0} {1} |Encoded in 72 bits [ {00110011001100100011001001110001010010001101010110100101101001} {0} {0}decoding: 0 {1} {0}decoding: 4 {0} {0}decoding: 4 {0} {0}decoding: 4 {0}decoding: 4 {0}decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 decoding: 4 {0}decoding: 4 decoding: 4 {0} {0} {0} {0} {0}decoding: 1 {0} {0} {0} {0}decoding: 2 {0} {0} {0} {0} {0}decoding: 3 decoding: 4 {0} {0} {0} {0}decoding: 3 {0} {0} {0}decoding: 1 {0} {0} {0} {0}decoding: 2 {0} {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0} {0} {0}decoding: 3 {0} {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0}decoding: 1 {0} {0} {0}decoding: 2 {0} {0}decoding: 1 [ {N:2} {0010} {N:5} {011111} {N:5} {/0/00///01} {N:3} {//0/0/} {N:15} {///////////00//0010} |Encoded in 80 bits [ {N:2} {00101111010111111111011010011101111011110101110001111111111111} {1} {1} {1} {0} {0} {1} {1} | ->10 {N:5} {01111111110110100111011110111101011100011111111111111110011001} {0} {1} {1} {0} {0} {0} {0} {0} {0} | ->22 {N:5} {10100111011110111101011100011111111111111110011001011000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->38 {N:3} {11010111000111111111111111100110010110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->50 {N:15} {11111111111001100101100000000000000000000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->79decoding: 0 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 4 decoding: 1 decoding: 2 decoding: 3 decoding: 4 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 3 decoding: 1 decoding: 2 decoding: 1 decoding: 2 decoding: 1 [main] WARN org.campagnelab.goby.algorithmic.algorithm.EquivalentIndelRegionCalculator - Cannot determine sequence at position 600000000 of reference-index 2 Annotations loaded Annotations loaded Annotations loaded Annotations loaded Annotations loaded Total logical entries written: 4 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 1 Max query index: 1 Number of queries: 1 Number of targets: 2 Total logical entries written: 4 Total bytes written: 62 Average bytes/logical entry: 15.5 Min query index: 1 Max query index: 1 Number of queries: 1 Number of targets: 2 count perbase{0=>0, 13=>0, 11=>2, 3=>2, 5=>3} count keys [0, 3, 5, 11, 13] -1 0.0 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 overlapping count 3, 4 0.0 overlapping count 15, 17 0.0 overlapping count 9, 18 2.0 overlapping count 3, 8 2.0 overlapping count 11, 12 0.0 overlapping count 9, 10 1.0 overlapping count 8, 9 0.0 overlapping count 8, 8 0.0 overlapping count 5, 6 0.0 overlapping count 3, 3 0.0 overlapping count 3, 12 5.0 overlapping count -1, 2 0.0 overlapping count 0, 45 6.0 overlapping count 13, 15 0.0 -1 0.0 0 0.0 1 0.0 2 0.0 3 2.0 4 2.0 5 3.0 6 3.0 7 3.0 8 3.0 9 3.0 10 3.0 11 2.0 12 2.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 overlapping count 3, 4 2.0 overlapping count 2, 3 2.0 overlapping count 3, 8 4.0 overlapping count 11, 12 2.0 overlapping count 9, 10 3.0 overlapping count 8, 9 4.0 overlapping count 8, 8 3.0 overlapping count 5, 6 3.0 overlapping count 3, 3 2.0 overlapping count 3, 12 5.0 overlapping count -1, 2 0.0 overlapping count 0, 45 6.0 overlapping count 13, 15 1.0 07:22:05.002 INFO TestPostBarcodeMatcher - Num matches = 200, Num Ambiguous = 0, Num no matches = 0 07:22:05.003 INFO TestPostBarcodeMatcher - Time to parse 8 million reads 0 seconds 07:22:05.042 INFO BullardUpperQuartileNormalization - normalization denominator 51556.6 for sample B-7 07:22:05.042 INFO BullardUpperQuartileNormalization - normalization denominator 50792.3 for sample B-3 07:22:05.042 INFO BullardUpperQuartileNormalization - normalization denominator 105476 for sample A-3 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 102974 for sample A-12 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 53849.5 for sample B-15 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 52112.4 for sample B-14 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 50861.7 for sample B-11 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 105476 for sample A-17 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 50931.2 for sample B-2 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 52807.3 for sample B-10 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 104086 for sample A-16 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 52529.3 for sample B-8 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 51487.1 for sample B-4 07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 104781 for sample A-2 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 104642 for sample A-0 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 53363.1 for sample B-6 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 103669 for sample A-9 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 106796 for sample A-8 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 105962 for sample A-5 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 100403 for sample A-4 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 100820 for sample A-6 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 103600 for sample A-7 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 50583.8 for sample B-5 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 105267 for sample A-10 07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 103669 for sample A-14 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 50792.3 for sample B-9 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 105962 for sample A-1 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 50792.3 for sample B-0 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 51209.2 for sample B-12 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 51278.6 for sample B-13 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 102766 for sample A-19 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 103044 for sample A-18 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 106657 for sample A-15 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 52807.3 for sample B-1 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 104086 for sample A-13 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 104294 for sample A-11 07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 52043.0 for sample B-16 07:22:05.046 INFO BullardUpperQuartileNormalization - normalization denominator 52946.2 for sample B-17 07:22:05.046 INFO BullardUpperQuartileNormalization - normalization denominator 50722.8 for sample B-19 07:22:05.046 INFO BullardUpperQuartileNormalization - normalization denominator 53293.7 for sample B-18 07:22:05.107 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value 07:22:05.139 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. 07:22:05.139 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value 07:22:05.150 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. 07:22:05.150 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value 07:22:05.244 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. 07:22:05.275 INFO FDRAdjustment - ... statistic t-test-P-value-Bonferroni-adjusted was found, FDR adjustment executed. 07:22:05.276 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value 07:22:05.353 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. 07:22:05.360 INFO FDRAdjustment - ... statistic another-p-value-Bonferroni-adjusted was found, FDR adjustment executed. list3:element-id p-value p-value-BH-FDR-q-value [ 0 [2.354054E-7, 1.177027E-5] ] [ 1 [2.10159E-5, 4.294736666666667E-4] ] [ 2 [2.576842E-5, 4.294736666666667E-4] ] [ 3 [9.814783E-5, 9.471342857142858E-4] ] [ 4 [1.05261E-4, 9.471342857142858E-4] ] [ 5 [1.241481E-4, 9.471342857142858E-4] ] [ 6 [1.325988E-4, 9.471342857142858E-4] ] [ 7 [1.568503E-4, 9.803143750000002E-4] ] [ 8 [2.254557E-4, 0.0012525316666666666] ] [ 9 [3.79538E-4, 0.00189769] ] [ 10 [6.114943E-4, 0.0027795195454545455] ] [ 11 [0.001613954, 0.006724808333333334] ] [ 12 [0.00330243, 0.012636935714285714] ] [ 13 [0.003538342, 0.012636935714285714] ] [ 14 [0.005236997, 0.017456656666666667] ] [ 15 [0.006831909, 0.020762429411764708] ] [ 16 [0.007059226, 0.020762429411764708] ] [ 17 [0.008805129, 0.024458691666666667] ] [ 18 [0.00940104, 0.02473957894736842] ] [ 19 [0.01129798, 0.028244949999999998] ] [ 20 [0.02115017, 0.050357547619047614] ] [ 21 [0.04922736, 0.11188036363636364] ] [ 22 [0.06053298, 0.1304633125] ] [ 23 [0.06262239, 0.1304633125] ] [ 24 [0.07395153, 0.14790306] ] [ 25 [0.08281103, 0.15925198076923075] ] [ 26 [0.08633331, 0.1598765] ] [ 27 [0.1190654, 0.21261678571428572] ] [ 28 [0.1890796, 0.32599931034482754] ] [ 29 [0.2058494, 0.3430823333333333] ] [ 30 [0.2209214, 0.3563248387096774] ] [ 31 [0.2856, 0.44625000000000004] ] [ 32 [0.3048895, 0.4619537878787878] ] [ 33 [0.4660682, 0.6835770833333333] ] [ 34 [0.4830809, 0.6835770833333333] ] [ 35 [0.4921755, 0.6835770833333333] ] [ 36 [0.5319453, 0.718845] ] [ 37 [0.575155, 0.7414352564102564] ] [ 38 [0.5783195, 0.7414352564102564] ] [ 39 [0.6185894, 0.7626062790697675] ] [ 40 [0.636362, 0.7626062790697675] ] [ 41 [0.6448587, 0.7626062790697675] ] [ 42 [0.6558414, 0.7626062790697675] ] [ 43 [0.6885884, 0.7824868181818182] ] [ 44 [0.7189864, 0.7988737777777778] ] [ 45 [0.8179539, 0.8802645744680851] ] [ 46 [0.8274487, 0.8802645744680851] ] [ 47 [0.89713, 0.9304775510204082] ] [ 48 [0.911868, 0.9304775510204082] ] [ 49 [0.943789, 0.943789] ] element-id average RPKM group A(AC) average RPKM group B(AC) average log2_RPKM group A(AC) average log2_RPKM group B(AC) average count group A average count group B [ id-1 [0.9980229893624166, 0.49866456701631834, -0.0028550466022277347, -1.003858400017376, 0.0, 0.0] ] truncated fdr=3.53108e-05 original=3.53108e-05 truncated fdr=0.00128842 original=0.00128842 truncated fdr=0.00128842 original=0.00128842 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00284140 original=0.00284140 truncated fdr=0.00294094 original=0.00294094 truncated fdr=0.00375760 original=0.00375760 truncated fdr=0.00569307 original=0.00569307 truncated fdr=0.00833856 original=0.00833856 truncated fdr=0.0201744 original=0.0201744 truncated fdr=0.0379108 original=0.0379108 truncated fdr=0.0379108 original=0.0379108 truncated fdr=0.0523700 original=0.0523700 truncated fdr=0.0622873 original=0.0622873 truncated fdr=0.0622873 original=0.0622873 truncated fdr=0.0733761 original=0.0733761 truncated fdr=0.0742187 original=0.0742187 truncated fdr=0.0847349 original=0.0847349 truncated fdr=0.151073 original=0.151073 truncated fdr=0.335641 original=0.335641 truncated fdr=0.391390 original=0.391390 truncated fdr=0.391390 original=0.391390 truncated fdr=0.443709 original=0.443709 truncated fdr=0.477756 original=0.477756 truncated fdr=0.479630 original=0.479630 truncated fdr=0.637850 original=0.637850 truncated fdr=0.977998 original=0.977998 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 truncated fdr=1.00000 original=1.00000 [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. [main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. ##fileformat=VCFv4.1 ##Goby=UNKNOWN ##FieldGroupAssociations=CHROM=genomic-coordinate,CHROM=cross-sample-field,POS=genomic-coordinate,POS=cross-sample-field,ID=external-identifiers,ID=cross-sample-field,REF=cross-sample-field,ALT=cross-sample-field,QUAL=cross-sample-field,FILTER=cross-sample-field,INFO=cross-sample-field,INFO/p-value1=cross-sample-field,INFO/p-value1=p-value,INFO/p-value2=cross-sample-field,INFO/p-value2=p-value,INFO/#Cm_Group[Group_1]=cross-sample-field,INFO/#Cm_Group[Group_1]=#Cm,FORMAT/Zygosity=zygozity,FORMAT/Zygosity=sample-data,FORMAT/Another=another,FORMAT/Another=sample-data, ##INFO= ##INFO= ##INFO= ##FORMAT= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SampleA SampleB Creating base test directory: test-results/stats-writer allele: A ref: [CC] alt: [T]Creating base test directory: test-results/stats [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest [main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. Setting quality threshold to 0.02 [main] WARN org.campagnelab.goby.alignments.BufferedSortingAlignmentWriter - Local sorting strategy failed to restore sort order. The destination has been marked as unsorted. You must sort the output manually to improve compression. Processing queryIndex=8 with description '8 perfect start of ref' Processing queryIndex=9 with description '9 perfect start of ref reverse strand' Processing queryIndex=18 with description '18 mismatch at end x1, starting at -1' Processing queryIndex=19 with description '19 mismatch at end x2, starting at -1' Processing queryIndex=20 with description '20 mismatch at end x5, starting at -1' Processing queryIndex=21 with description '21 mismatch at end x1, starting at -2' Processing queryIndex=22 with description '22 mismatch at end x2, starting at -2' Processing queryIndex=23 with description '23 mismatch at end x5, starting at -2' Processing queryIndex=12 with description '12 mismatch at beginning x1, starting at 1, with mutation at 20' Processing queryIndex=13 with description '13 mismatch at beginning x2, starting at 1, with mutation at 20' Processing queryIndex=15 with description '15 mismatch at beginning x1, starting at 2' Processing queryIndex=16 with description '16 mismatch at beginning x2, starting at 2' Processing queryIndex=14 with description '14 mismatch at beginning x5, starting at 1 (pos 4 actually does match), with mutation at 20' Processing queryIndex=17 with description '17 mismatch at beginning x5, starting at 2 (pos 4 actually does match)' Processing queryIndex=0 with description '0 perfect match' Processing queryIndex=1 with description '1 perfect match on reverse strand' Processing queryIndex=2 with description '2 mutation' Processing queryIndex=3 with description '3 mutation on reverse strand' Processing queryIndex=4 with description '4 insertion' Processing queryIndex=6 with description '6 deletion' Processing queryIndex=7 with description '7 deletion on reverse strand' Processing queryIndex=27 with description '27 padding left & right, deletion then mutation' Processing queryIndex=24 with description '24 padding left & right, mutation, deletion' Processing queryIndex=5 with description '5 insertion on reverse strand' Processing queryIndex=10 with description '10 perfect end of ref' Processing queryIndex=11 with description '11 perfect end of ref reverse strand' 07:22:20.829 WARN MessageChunksWriter - Using chunk-size=1 07:22:20.834 WARN MessageChunksWriter - Using chunk-size=1 07:22:20.839 WARN MessageChunksWriter - Using chunk-size=1 07:22:20.889 WARN MessageChunksWriter - Using chunk-size=1 read =CTCCAGAACTGTAAGATAATAAGTTGGTGTTGTTTT expected =TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT recons. ref=TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT read =TTTCCCACATTTCCCATCACCACTACTACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =TTTCCCAAATTTCACATCACTACTACACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =TAAAACCTAAAAAAAAAAAAAAACCCC expected =TAAAA--TAAAAAAAAAAAAAAACCCC recons. ref=TAAAA--TAAAAAAAAAAAAAAACCCC read =TTTTGATGAAGTCTCTGTGTCCTGGGGCATCAATGATGGTCACA expected =TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA recons. ref=TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA read =TTTCCCAAATTTCACATCACTACACTACGGATACAGAACGGGG expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG read =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTATCTTTTT expected =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT recons. ref=CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT query_index: 0 target_index: 0 position: 0 query_position: 0 matching_reverse_strand: false query_length: 75 query_aligned_length: 75 target_aligned_length: 75 mapping_quality: 255 pair_flags: 0 fragment_index: 0 ambiguity: 1 query_index: 1 target_index: 0 position: 1 query_position: 0 matching_reverse_strand: false query_length: 75 query_aligned_length: 75 target_aligned_length: 75 mapping_quality: 255 pair_flags: 0 fragment_index: 0 ambiguity: 1 07:22:20.899 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.901 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.907 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.909 WARN MessageChunksWriter - Using chunk-size=1000 0 23 07:22:20.922 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.925 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.926 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.927 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.931 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.933 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.934 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.940 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.940 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.941 WARN MessageChunksWriter - Using chunk-size=1000 entry.position(): 1 entry.position(): 2 entry.position(): 3 entry.position(): 5 entry.position(): 6 entry.position(): 7 entry.position(): 8 entry.position(): 9 entry.position(): 10 entry.position(): 10 entry.position(): 12 entry.position(): 99 07:22:20.947 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.948 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.949 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.956 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.957 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.958 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.960 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-1.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-1 07:22:20.961 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-2.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-2 07:22:20.962 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-3.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-3 07:22:20.964 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.965 WARN MessageChunksWriter - Using chunk-size=1000 07:22:20.966 WARN MessageChunksWriter - Using chunk-size=1000 entry:query_index: 0 target_index: 0 position: 5 score: 5.0 matching_reverse_strand: false query_length: 20 query_aligned_length: 20 target_aligned_length: 20 sequence_variations { to: "CTAG" from: "----" position: 10 read_index: 10 } entry:query_index: 1 target_index: 0 position: 5 matching_reverse_strand: false query_length: 20 query_aligned_length: 20 target_aligned_length: 20 sequence_variations { to: "CTAG" from: "----" position: 10 to_quality: "((((" read_index: 10 } entry: query_index: 0 target_index: 0 position: 0 matching_reverse_strand: false query_length: 10 query_aligned_length: 10 sequence_variations { to: "AAA" from: "---" position: 3 read_index: 3 } processing entry on target 0 at position 0 processing entry on target 0 at position 5 processing entry on target 1 at position 0 processing entry on target 1 at position 5 processing entry on target 4 at position 0 processing entry on target 4 at position 5 entry:query_index: 0 target_index: 0 position: 10 matching_reverse_strand: false query_length: 50 query_aligned_length: 50 sequence_variations { to: "AAA" from: "---" position: 20 read_index: 20 } entry:query_index: 1 target_index: 0 position: 1 matching_reverse_strand: false query_length: 50 query_aligned_length: 50 sequence_variations { to: "T" from: "A" position: 20 read_index: 20 } 07:22:20.986 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 0 Total bytes written: 31 Average bytes/logical entry: Infinity Min query index: 2147483647 Max query index: -2147483648 Number of queries: 2 Number of targets: 0 97 07:22:20.991 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:20.996 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:20.999 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:21.002 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 6 Total bytes written: 162 Average bytes/logical entry: 27.0 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:21.006 WARN MessageChunksWriter - Using chunk-size=1000 Total logical entries written: 20000 Total bytes written: 77210 Average bytes/logical entry: 3.8605 Min query index: 0 Max query index: 1999 Number of queries: 2000 Number of targets: 10 07:22:21.078 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.104 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.105 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.129 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:21.153 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.154 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.160 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.180 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.181 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 07:22:21.181 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 230.33M/20.86G/1.03G/1.26G/21.09G 07:22:21.187 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 07:22:21.217 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.221 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.250 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 280.66M/20.81G/977.63M/1.26G/21.09G 07:22:21.254 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.268 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.295 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.318 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.320 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.343 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:21.366 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.367 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item]; used/avail/free/total/max mem: 373.19M/20.72G/885.11M/1.26G/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 07:22:21.446 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.469 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.470 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.493 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:21.516 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.517 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.519 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.524 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. 07:22:21.524 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 07:22:21.524 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 431.66M/20.66G/826.64M/1.26G/21.09G 07:22:21.526 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. notBestScoreCount=16.6667 % geneAmbiguityCount=33.3333 % found entry: query_index: 0 target_index: 1 position: 2 score: 31.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 0 target_index: 2 position: 3 score: 31.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 4 position: 6 score: 30.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 07:22:21.531 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.554 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.554 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.577 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:21.600 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.601 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.603 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.604 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 456.82M/20.63G/801.47M/1.26G/21.09G 07:22:21.610 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.611 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 07:22:21.615 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.639 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.640 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.663 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:21.685 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.686 WARN MessageChunksWriter - Using chunk-size=1000 Finding max number of reads... Found input file with 2 target(s) 07:22:21.688 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. Found input file with 2 target(s) 07:22:21.689 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. ... max number of reads was 10 First pass: determine which reads should be kept in the merged alignment. Scanning align-105 Scanning align-106 Found 40 logical alignment entries. Prepare merged too many hits information. 07:22:21.691 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. 07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 481.99M/20.61G/776.30M/1.26G/21.09G Second pass: writing the merged alignment. 07:22:21.694 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.696 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. Wrote 20 skipped: 20 50.000000% too many hits 0.000000% notBestScore: 50.000000% Total logical entries written: 20 Total bytes written: 0 Average bytes/logical entry: 0.0 Min query index: 0 Max query index: 9 Number of queries: 10 Number of targets: 4 Percent aligned: 100.0 07:22:21.699 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.722 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.723 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.746 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:21.768 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.769 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.771 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.772 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. 07:22:21.772 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 07:22:21.772 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [1 items, 1,000.00 items/s, 1.00 ms/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 507.15M/20.58G/751.14M/1.26G/21.09G 07:22:21.775 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1 position: 11 score: 40.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1 position: 12 score: 41.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1 position: 13 score: 42.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1 position: 14 score: 43.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1 position: 15 score: 44.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1 position: 16 score: 45.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1 position: 17 score: 46.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1 position: 18 score: 47.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1 position: 19 score: 48.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1 position: 20 score: 49.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 07:22:21.778 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.801 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.802 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.825 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:21.848 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.849 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item]; used/avail/free/total/max mem: 565.87M/20.52G/692.42M/1.26G/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 07:22:21.931 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.954 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.954 WARN MessageChunksWriter - Using chunk-size=1000 07:22:21.978 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 07:22:22.001 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.002 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.005 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:22.007 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass 07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 658.15M/20.43G/600.14M/1.26G/21.09G 07:22:22.036 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. 07:22:22.049 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 1999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 1999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 1999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 1999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 1999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 1999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 1999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 1999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 1999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 0 target_index: 3999 position: 19991 score: 20020.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 1 target_index: 3999 position: 19992 score: 20021.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 2 target_index: 3999 position: 19993 score: 20022.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 3 target_index: 3999 position: 19994 score: 20023.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 4 target_index: 3999 position: 19995 score: 20024.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 5 target_index: 3999 position: 19996 score: 20025.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 6 target_index: 3999 position: 19997 score: 20026.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 7 target_index: 3999 position: 19998 score: 20027.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 8 target_index: 3999 position: 19999 score: 20028.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 found entry: query_index: 9 target_index: 3999 position: 20000 score: 20029.0 matching_reverse_strand: false multiplicity: 1 query_length: 35 07:22:22.077 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.079 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 Scanned 5 entries 07:22:22.084 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.085 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 Scanned 2 entries 07:22:22.088 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.089 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.093 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.094 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.098 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.099 WARN MessageChunksWriter - Using chunk-size=1000 0 2 07:22:22.103 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.104 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-101 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-101 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-102 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-102 07:22:22.108 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.109 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.114 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.115 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.118 WARN MessageChunksWriter - Using chunk-size=1000 07:22:22.119 WARN MessageChunksWriter - Using chunk-size=1000 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=50.0000 readOriginIndex=3 entry: score=30.0000 readOriginIndex=0 entry: score=30.0000 readOriginIndex=0 Scanned 5 entries 07:22:22.125 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:22.128 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:22.130 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:22.133 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:22.136 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:22.138 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 07:22:22.141 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 Min query index: 0 Max query index: 0 Number of queries: 1 Number of targets: 3 original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGTGT original G----GTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: G original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT mapped: GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT original G--GTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGT [WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46, Time elapsed: 72.607 s - in TestSuite [INFO] [INFO] Results: [INFO] [WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46 [INFO] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.055 s] [INFO] Goby I/O ........................................... SUCCESS [ 5.771 s] [INFO] Goby Full Distribution ............................. SUCCESS [01:47 min] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 01:53 min [INFO] Finished at: 2025-08-07T07:22:52+14:00 [INFO] ------------------------------------------------------------------------ make[1]: Leaving directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install /usr/lib/jvm/default-java/bin/java -noverify -cp /usr/share/maven/boot/plexus-classworlds-2.x.jar -Dmaven.home=/usr/share/maven -Dmaven.multiModuleProjectDirectory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 -Dclassworlds.conf=/etc/maven/m2-debian.conf org.codehaus.plexus.classworlds.launcher.Launcher -s/etc/maven/settings-debian.xml -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo --batch-mode -Ddebian.dir=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian -Ddebian.package=libgoby-io-java -Dmaven.repo.local=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2/debian/maven-repo -Dinstall.to.usj=true org.debian.maven:debian-maven-plugin:2.6:install OpenJDK 64-Bit Server VM warning: Options -Xverify:none and -noverify were deprecated in JDK 13 and will likely be removed in a future release. [INFO] Scanning for projects... [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-distribution:jar:3.3.1 [WARNING] 'dependencies.dependency.systemPath' for org.rosuda.REngine:REngine:jar should use a variable instead of a hard-coded path /usr/lib/R/site-library/rJava/jri/JRI.jar @ line 227, column 16 [WARNING] 'dependencies.dependency.systemPath' for com.github.broadinstitute:picard:jar should use a variable instead of a hard-coded path /usr/share/java/picard.jar @ line 293, column 16 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: it.unimi.dsi:dsiutils:jar -> duplicate declaration of version debian @ line 295, column 15 [WARNING] [WARNING] Some problems were encountered while building the effective model for org.campagnelab.goby:goby-io:jar:3.3.1 [WARNING] 'dependencies.dependency.(groupId:artifactId:type:classifier)' must be unique: com.google.protobuf:protobuf-java:jar -> duplicate declaration of version debian @ line 350, column 15 [WARNING] 'dependencies.dependency.systemPath' for org.itadaki:bzip2:jar should use a variable instead of a hard-coded path /usr/share/java/jbzip2-0.9.1.jar @ line 391, column 16 [WARNING] 'build.plugins.plugin.(groupId:artifactId)' must be unique but found duplicate declaration of plugin org.apache.maven.plugins:maven-antrun-plugin @ line 291, column 12 [WARNING] [WARNING] It is highly recommended to fix these problems because they threaten the stability of your build. [WARNING] [WARNING] For this reason, future Maven versions might no longer support building such malformed projects. [WARNING] [INFO] ------------------------------------------------------------------------ [INFO] Reactor Build Order: [INFO] [INFO] Goby Framework [pom] [INFO] Goby I/O [jar] [INFO] Goby Full Distribution [jar] [INFO] [INFO] ----------------< org.campagnelab.goby:goby-framework >----------------- [INFO] Building Goby Framework 3.3.1 [1/3] [INFO] from pom.xml [INFO] --------------------------------[ pom ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-framework --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/pom.xml.save with options: [INFO] --keep-pom-version --package=libgoby-io-java --has-package-version [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] [INFO] --------------------< org.campagnelab.goby:goby-io >-------------------- [INFO] Building Goby I/O 3.3.1 [2/3] [INFO] from goby-io/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-io --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/pom.xml.save with options: [INFO] --keep-pom-version --package=libgoby-io-java [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] Install jar for goby-io into /usr/share/java [INFO] [INFO] ---------------< org.campagnelab.goby:goby-distribution >--------------- [INFO] Building Goby Full Distribution 3.3.1 [3/3] [INFO] from goby-distribution/pom.xml [INFO] --------------------------------[ jar ]--------------------------------- [INFO] [INFO] --- debian:2.6:install (default-cli) @ goby-distribution --- [INFO] Cleaning pom file: /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/pom.xml.save with options: [INFO] --keep-pom-version --package=goby-java [INFO] --rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.rules [INFO] --ignore-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.ignoreRules [INFO] --published-rules=/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven.publishedRules [INFO] Install jar for goby-distribution into /usr/share/java [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] [INFO] Goby Framework ..................................... SUCCESS [ 0.306 s] [INFO] Goby I/O ........................................... SUCCESS [ 0.045 s] [INFO] Goby Full Distribution ............................. SUCCESS [ 0.032 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ [INFO] Total time: 0.523 s [INFO] Finished at: 2025-08-07T07:22:54+14:00 [INFO] ------------------------------------------------------------------------ mh_resolve_dependencies --non-interactive --offline --build -plibgoby-io-java --base-directory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 --non-explore Analysing pom.xml... Analysing goby-distribution/pom.xml... Checking the parent dependency in the sub project goby-distribution/pom.xml Analysing goby-io/pom.xml... Checking the parent dependency in the sub project goby-io/pom.xml > dpkg --search /usr/share/maven-repo/org/rosuda/REngine/REngine/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/rosuda/REngine/REngine Aug 07, 2025 7:23:00 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/pom.xml: Dependency not found org.rosuda.REngine:REngine:jar:debian > dpkg --search /usr/share/maven-repo/org/itadaki/bzip2/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/itadaki/bzip2 Aug 07, 2025 7:23:05 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/pom.xml: Dependency not found org.itadaki:bzip2:jar:debian ERROR: goby-distribution/pom.xml: dependency is not packaged in the Maven repository for Debian: org.rosuda.REngine:REngine:debian goby-io/pom.xml: dependency is not packaged in the Maven repository for Debian: org.itadaki:bzip2:debian -------- Some problems were found in this project, exiting... mh_unpatchpoms -plibgoby-io-java dh_install jh_installjavadoc dh_installdocs dh_installchangelogs dh_installman dh_lintian dh_perl dh_link jh_installlibs jh_classpath jh_manifest jh_exec jh_depends dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_installdeb dh_gencontrol dpkg-gencontrol: warning: Depends field of package libgoby-io-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${maven:Depends} used, but is not defined dpkg-gencontrol: warning: Recommends field of package goby-java: substitution variable ${maven:OptionalDepends} used, but is not defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${java:Depends} unused, but is defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${maven:CompileDepends} unused, but is defined dpkg-gencontrol: warning: package goby-java: substitution variable ${java:Depends} unused, but is defined dh_md5sums dh_builddeb dpkg-deb: building package 'libgoby-io-java' in '../libgoby-io-java_3.3.1+dfsg2-11_all.deb'. dpkg-deb: building package 'goby-java' in '../goby-java_3.3.1+dfsg2-11_all.deb'. dpkg-genbuildinfo --build=binary -O../libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo dpkg-genchanges --build=binary -O../libgoby-java_3.3.1+dfsg2-11_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: user script /srv/workspace/pbuilder/902668/tmp/hooks/B01_cleanup starting I: user script /srv/workspace/pbuilder/902668/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/902668 and its subdirectories I: Current time: Thu Aug 7 07:23:13 +14 2025 I: pbuilder-time-stamp: 1754500993 + false + set +x Wed Aug 6 17:23:13 UTC 2025 I: Signing ./b2/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo as libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc Wed Aug 6 17:23:14 UTC 2025 I: Signed ./b2/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo as ./b2/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc Wed Aug 6 17:23:14 UTC 2025 - build #2 for libgoby-java/trixie/amd64 on ionos11-amd64 done. Starting cleanup. All cleanup done. Wed Aug 6 17:23:14 UTC 2025 - reproducible_build.sh stopped running as /tmp/jenkins-script-TCFZLsBx, removing. /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC: total 460 drwxr-xr-x 2 jenkins jenkins 4096 Aug 6 17:16 b1 drwxr-xr-x 2 jenkins jenkins 4096 Aug 6 17:23 b2 -rw-r--r-- 1 jenkins jenkins 3008 May 14 2024 libgoby-java_3.3.1+dfsg2-11.dsc -rw------- 1 jenkins jenkins 450569 Aug 6 17:16 rbuildlog.c9JyM1f /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b1: total 3032 -rw-r--r-- 1 jenkins jenkins 446103 Aug 6 17:16 build.log -rw-r--r-- 1 jenkins jenkins 1575696 Aug 6 17:16 goby-java_3.3.1+dfsg2-11_all.deb -rw-r--r-- 1 jenkins jenkins 978952 Aug 6 17:16 libgoby-io-java_3.3.1+dfsg2-11_all.deb -rw-r--r-- 1 jenkins jenkins 29428 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11.debian.tar.xz -rw-r--r-- 1 jenkins jenkins 3008 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11.dsc -rw-r--r-- 1 jenkins jenkins 19140 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo -rw-r--r-- 1 jenkins jenkins 20022 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc -rw-r--r-- 1 jenkins jenkins 1651 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_amd64.changes -rw-r--r-- 1 jenkins jenkins 1494 Aug 6 17:16 libgoby-java_3.3.1+dfsg2-11_source.changes /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b2: total 3024 -rw-r--r-- 1 jenkins jenkins 447299 Aug 6 17:23 build.log -rw-r--r-- 1 jenkins jenkins 1575696 Aug 6 17:23 goby-java_3.3.1+dfsg2-11_all.deb -rw-r--r-- 1 jenkins jenkins 978952 Aug 6 17:23 libgoby-io-java_3.3.1+dfsg2-11_all.deb -rw-r--r-- 1 jenkins jenkins 29428 Aug 6 17:23 libgoby-java_3.3.1+dfsg2-11.debian.tar.xz -rw-r--r-- 1 jenkins jenkins 3008 Aug 6 17:23 libgoby-java_3.3.1+dfsg2-11.dsc -rw-r--r-- 1 jenkins jenkins 19127 Aug 6 17:23 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo -rw-r--r-- 1 jenkins jenkins 20009 Aug 6 17:23 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc -rw-r--r-- 1 jenkins jenkins 1651 Aug 6 17:23 libgoby-java_3.3.1+dfsg2-11_amd64.changes -rw-r--r-- 1 jenkins jenkins 1494 Aug 6 17:23 libgoby-java_3.3.1+dfsg2-11_source.changes Wed Aug 6 17:23:14 UTC 2025 I: Deleting $TMPDIR on ionos11-amd64.debian.net. Wed Aug 6 17:23:14 UTC 2025 I: libgoby-java_3.3.1+dfsg2-11_amd64.changes: Format: 1.8 Date: Tue, 14 May 2024 18:17:12 +0200 Source: libgoby-java Binary: goby-java libgoby-io-java Architecture: all Version: 3.3.1+dfsg2-11 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Pierre Gruet Description: goby-java - next-generation sequencing data and results analysis tool libgoby-io-java - IO API for goby Changes: libgoby-java (3.3.1+dfsg2-11) unstable; urgency=medium . * Raising Standards version to 4.7.0 (no change) * Restricting autopkgtest architecture to amd64 and arm64, where sra-sdk packages are installable * Build-depending on pkgconf instead of obsolete pkg-config Checksums-Sha1: 8d6c264bb79c6a856462e629583538ec8b632b15 1575696 goby-java_3.3.1+dfsg2-11_all.deb ba8a87f95aa155b5cb3e4061e47f8eea597b32ec 978952 libgoby-io-java_3.3.1+dfsg2-11_all.deb 7f427b6ffd182a5f626c9d1dcaf2e36b2fbcf32e 19140 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo Checksums-Sha256: 2fa45b31be92ce16796d6b626341f8d5558b316bb3d3cb1c1c34b8811f71f163 1575696 goby-java_3.3.1+dfsg2-11_all.deb 966fd3a4c6cf5de51d2eb89a40822d339904299f2f2d1212774c6d5ff34371f6 978952 libgoby-io-java_3.3.1+dfsg2-11_all.deb f61fe9f989c6ea2f07d7479f97a62422f58844ab63229f8207ee1010a20056a1 19140 libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo Files: 7e8b2f21003504808ef0aae4d95df2e7 1575696 science optional goby-java_3.3.1+dfsg2-11_all.deb 95bf2d8dab731f27e265e656c7333bf7 978952 science optional libgoby-io-java_3.3.1+dfsg2-11_all.deb ccb5cdc899248341992915eb07f4f063 19140 science optional libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo removed '/var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.rbuild.log' removed '/var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.rbuild.log.gz' removed '/var/lib/jenkins/userContent/reproducible/debian/logs/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.build1.log.gz' removed '/var/lib/jenkins/userContent/reproducible/debian/logs/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.build2.log.gz' removed '/var/lib/jenkins/userContent/reproducible/debian/buildinfo/trixie/amd64/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo' removed '/var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.diff.gz' Diff of the two buildlogs: -- --- b1/build.log 2025-08-06 17:16:42.159495515 +0000 +++ b2/build.log 2025-08-06 17:23:14.412034749 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Tue Sep 8 11:26:14 -12 2026 -I: pbuilder-time-stamp: 1788909974 +I: Current time: Thu Aug 7 07:16:45 +14 2025 +I: pbuilder-time-stamp: 1754500605 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration @@ -40,52 +40,84 @@ dpkg-source: info: applying adding_opens_arg_for_tests.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/148101/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D01_modify_environment starting +debug: Running on ionos11-amd64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Aug 6 17:17 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='amd64' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' - DISTRIBUTION='trixie' - HOME='/root' - HOST_ARCH='amd64' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu") + BASH_VERSION='5.2.37(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=amd64 + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=40 ' + DIRSTACK=() + DISTRIBUTION=trixie + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=x86_64 + HOST_ARCH=amd64 IFS=' ' - INVOCATION_ID='bc99d0441e3e4105aeab9c12f7429242' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='148101' - PS1='# ' - PS2='> ' + INVOCATION_ID=7baf82eafc8c4f0690099c3e8ee829f5 + LANG=C + LANGUAGE=et_EE:et + LC_ALL=C + MACHTYPE=x86_64-pc-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=902668 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/pbuilderrc_6g3v --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b1 --logfile b1/build.log libgoby-java_3.3.1+dfsg2-11.dsc' - SUDO_GID='110' - SUDO_UID='105' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://213.165.73.152:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/pbuilderrc_if16 --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b2 --logfile b2/build.log libgoby-java_3.3.1+dfsg2-11.dsc' + SUDO_GID=111 + SUDO_UID=106 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://46.16.76.132:3128 I: uname -a - Linux ionos5-amd64 6.12.33+deb12-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.12.33-1~bpo12+1 (2025-07-09) x86_64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-37-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.140-1 (2025-05-22) x86_64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 May 12 2025 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/148101/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 May 12 19:25 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -662,7 +694,7 @@ Get: 459 http://deb.debian.org/debian trixie/main amd64 r-base-core amd64 4.5.0-3 [28.6 MB] Get: 460 http://deb.debian.org/debian trixie/main amd64 r-cran-rjava amd64 1.0-11-2 [713 kB] Get: 461 http://deb.debian.org/debian trixie/main amd64 testng all 6.9.12-4 [795 kB] -Fetched 386 MB in 5s (71.2 MB/s) +Fetched 386 MB in 10s (38.8 MB/s) Preconfiguring packages ... Selecting previously unselected package libsystemd-shared:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19851 files and directories currently installed.) @@ -2170,8 +2202,8 @@ Setting up tzdata (2025b-4) ... Current default time zone: 'Etc/UTC' -Local time is now: Tue Sep 8 23:32:20 UTC 2026. -Universal Time is now: Tue Sep 8 23:32:20 UTC 2026. +Local time is now: Wed Aug 6 17:19:45 UTC 2025. +Universal Time is now: Wed Aug 6 17:19:45 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libxcb-present0:amd64 (1.17.0-2+b1) ... @@ -2765,7 +2797,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/libgoby-java-3.3.1+dfsg2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../libgoby-java_3.3.1+dfsg2-11_source.changes +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for trixie +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/libgoby-java-3.3.1+dfsg2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../libgoby-java_3.3.1+dfsg2-11_source.changes dpkg-buildpackage: info: source package libgoby-java dpkg-buildpackage: info: source version 3.3.1+dfsg2-11 dpkg-buildpackage: info: source distribution unstable @@ -2778,7 +2814,7 @@ bash -c "for dir in \$(find . -name target -type d); do if [ -f \$(echo \$dir | sed -e s/target\$/pom.xml/) ]; then rm -Rf \$dir; fi done" mh_unpatchpoms -plibgoby-io-java jh_clean -Duplicate specification "unlink|u" for option "u" +Duplicate specification "u=s" for option "u" debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' dh_clean @@ -2913,79 +2949,163 @@ [INFO] Adding the --ignore-source-errors option [INFO] No previous run data found, generating javadoc. [WARNING] Javadoc Warnings -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:26: error: package org.rosuda.JRI does not exist +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/methylation/MethylSimilarityScan.java:23: error: package org.apache.commons.cli does not exist +[WARNING] import org.apache.commons.cli.*; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:21: error: package javax.xml.bind.annotation does not exist +[WARNING] import javax.xml.bind.annotation.XmlRootElement; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:31: error: cannot find symbol +[WARNING] @XmlRootElement +[WARNING] ^ +[WARNING] symbol: class XmlRootElement +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:27: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.REXP; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:28: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.RVector; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:29: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:68: error: cannot find symbol -[WARNING] Rengine rEngine; +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:208: error: cannot find symbol +[WARNING] private static Result evaluateFisherExpression(final Rengine rengine, [WARNING] ^ [WARNING] symbol: class Rengine -[WARNING] location: class FisherExactRCalculator -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactTestCalculator.java:21: error: package DistLib does not exist -[WARNING] import DistLib.hypergeometric; +[WARNING] location: class FisherExact +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:24: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/EstimatedDistribution.java:22: error: package org.apache.commons.cli does not exist -[WARNING] import org.apache.commons.cli.*; +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:56: error: cannot find symbol +[WARNING] private Rengine rengine; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AnnotationAveragingWriter.java:39: error: package org.rosuda.JRI does not exist +[WARNING] symbol: class Rengine +[WARNING] location: class GobyRengine +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:127: error: cannot find symbol +[WARNING] public Rengine getRengine() { +[WARNING] ^ +[WARNING] symbol: class Rengine +[WARNING] location: class GobyRengine +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:21: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.RMainLoopCallbacks; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:22: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:32: error: package edu.rit.pj does not exist -[WARNING] import edu.rit.pj.ParallelTeam; +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:27: error: cannot find symbol +[WARNING] class RConsoleMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:43: error: package javax.xml.bind does not exist -[WARNING] import javax.xml.bind.JAXBContext; +[WARNING] symbol: class RMainLoopCallbacks +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:35: error: cannot find symbol +[WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:44: error: package javax.xml.bind does not exist -[WARNING] import javax.xml.bind.JAXBException; +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:50: error: cannot find symbol +[WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:45: error: package javax.xml.bind does not exist -[WARNING] import javax.xml.bind.Unmarshaller; +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:70: error: cannot find symbol +[WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:76: error: cannot find symbol -[WARNING] private ParallelTeam team; +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:81: error: cannot find symbol +[WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ -[WARNING] symbol: class ParallelTeam -[WARNING] location: class StatsMode -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:34: error: package javax.xml.bind does not exist -[WARNING] import javax.xml.bind.JAXBContext; +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:92: error: cannot find symbol +[WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:35: error: package javax.xml.bind does not exist -[WARNING] import javax.xml.bind.JAXBException; +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:101: error: cannot find symbol +[WARNING] public void rFlushConsole(final Rengine rengine) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:36: error: package javax.xml.bind does not exist -[WARNING] import javax.xml.bind.Marshaller; +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:111: error: cannot find symbol +[WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:21: error: package javax.xml.bind.annotation does not exist -[WARNING] import javax.xml.bind.annotation.XmlRootElement; +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:120: error: cannot find symbol +[WARNING] public void rLoadHistory(final Rengine re, final String filename) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/xml/MethylStats.java:31: error: cannot find symbol -[WARNING] @XmlRootElement +[WARNING] symbol: class Rengine +[WARNING] location: class RConsoleMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:23: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.RMainLoopCallbacks; [WARNING] ^ -[WARNING] symbol: class XmlRootElement -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:696: error: cannot find symbol -[WARNING] private void writeXml(PrintWriter output, String[] samples, MethylStats[] methylStats) throws JAXBException { +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:24: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ -[WARNING] symbol: class JAXBException -[WARNING] location: class MethylStatsMode -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/SimulateBisulfiteReads.java:23: error: package org.apache.commons.cli does not exist -[WARNING] import org.apache.commons.cli.*; +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:29: error: cannot find symbol +[WARNING] class RLoggerMainLoopCallback implements RMainLoopCallbacks { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:30: error: package org.apache.commons.exec does not exist -[WARNING] import org.apache.commons.exec.CommandLine; +[WARNING] symbol: class RMainLoopCallbacks +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:42: error: cannot find symbol +[WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:31: error: package org.apache.commons.exec does not exist -[WARNING] import org.apache.commons.exec.DefaultExecutor; +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:57: error: cannot find symbol +[WARNING] public void rBusy(final Rengine rengine, final int which) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:32: error: package org.apache.commons.exec does not exist -[WARNING] import org.apache.commons.exec.PumpStreamHandler; +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:77: error: cannot find symbol +[WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/TestRConnectionMode.java:25: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.Rengine; +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:88: error: cannot find symbol +[WARNING] public void rShowMessage(final Rengine rengine, final String message) { [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/PercentMismatchesQualityFilter.java:23: error: package org.apache.commons.cli does not exist +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:99: error: cannot find symbol +[WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { +[WARNING] ^ +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:108: error: cannot find symbol +[WARNING] public void rFlushConsole(final Rengine rengine) { +[WARNING] ^ +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:118: error: cannot find symbol +[WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { +[WARNING] ^ +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:127: error: cannot find symbol +[WARNING] public void rLoadHistory(final Rengine re, final String filename) { +[WARNING] ^ +[WARNING] symbol: class Rengine +[WARNING] location: class RLoggerMainLoopCallback +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/EstimatedDistribution.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:32: error: package edu.rit.pj does not exist +[WARNING] import edu.rit.pj.ParallelTeam; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:43: error: package javax.xml.bind does not exist +[WARNING] import javax.xml.bind.JAXBContext; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:44: error: package javax.xml.bind does not exist +[WARNING] import javax.xml.bind.JAXBException; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:45: error: package javax.xml.bind does not exist +[WARNING] import javax.xml.bind.Unmarshaller; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/StatsMode.java:76: error: cannot find symbol +[WARNING] private ParallelTeam team; +[WARNING] ^ +[WARNING] symbol: class ParallelTeam +[WARNING] location: class StatsMode [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/CompactAlignmentToAnnotationCountsMode.java:39: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; [WARNING] ^ @@ -3057,23 +3177,66 @@ [WARNING] ^ [WARNING] symbol: class ParallelRegion [WARNING] location: class CompactAlignmentToAnnotationCountsMode +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:30: error: package org.apache.commons.exec does not exist +[WARNING] import org.apache.commons.exec.CommandLine; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:31: error: package org.apache.commons.exec does not exist +[WARNING] import org.apache.commons.exec.DefaultExecutor; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/RunParallelMode.java:32: error: package org.apache.commons.exec does not exist +[WARNING] import org.apache.commons.exec.PumpStreamHandler; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/SimulateBisulfiteReads.java:23: error: package org.apache.commons.cli does not exist +[WARNING] import org.apache.commons.cli.*; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:34: error: package javax.xml.bind does not exist +[WARNING] import javax.xml.bind.JAXBContext; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:35: error: package javax.xml.bind does not exist +[WARNING] import javax.xml.bind.JAXBException; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:36: error: package javax.xml.bind does not exist +[WARNING] import javax.xml.bind.Marshaller; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/MethylStatsMode.java:696: error: cannot find symbol +[WARNING] private void writeXml(PrintWriter output, String[] samples, MethylStats[] methylStats) throws JAXBException { +[WARNING] ^ +[WARNING] symbol: class JAXBException +[WARNING] location: class MethylStatsMode +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/PercentMismatchesQualityFilter.java:23: error: package org.apache.commons.cli does not exist +[WARNING] import org.apache.commons.cli.*; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/TestRConnectionMode.java:25: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.Rengine; +[WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/FastaToCompactMode.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.PJProperties; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/BetweenGroupSequenceVariationOutputFormat.java:40: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/MethylationRateVCFOutputFormat.java:45: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.Rengine; +[WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/CompareGroupsVCFOutputFormat.java:42: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/modes/formats/MethylationRateVCFOutputFormat.java:45: error: package org.rosuda.JRI does not exist +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/FisherExactTestAdaptor.java:23: error: package org.rosuda.JRI does not exist [WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/FoldChangeForExonPairs.java:22: error: package org.apache.commons.cli does not exist -[WARNING] import org.apache.commons.cli.*; +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactTestCalculator.java:21: error: package DistLib does not exist +[WARNING] import DistLib.hypergeometric; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/PlantIndels.java:22: error: package org.apache.commons.cli does not exist -[WARNING] import org.apache.commons.cli.*; +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:26: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.Rengine; +[WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/FisherExactRCalculator.java:68: error: cannot find symbol +[WARNING] Rengine rEngine; +[WARNING] ^ +[WARNING] symbol: class Rengine +[WARNING] location: class FisherExactRCalculator +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/stats/AnnotationAveragingWriter.java:39: error: package org.rosuda.JRI does not exist +[WARNING] import org.rosuda.JRI.Rengine; [WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/BasenameParallelRegion.java:23: error: package edu.rit.pj does not exist [WARNING] import edu.rit.pj.IntegerForLoop; @@ -3098,139 +3261,12 @@ [WARNING] ^ [WARNING] symbol: class ParallelTeam [WARNING] location: class DoInParallel -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/algorithm/dmr/FisherExactTestAdaptor.java:23: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.Rengine; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/methylation/MethylSimilarityScan.java:23: error: package org.apache.commons.cli does not exist +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/PlantIndels.java:22: error: package org.apache.commons.cli does not exist [WARNING] import org.apache.commons.cli.*; [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:23: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.RMainLoopCallbacks; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:24: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.Rengine; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:29: error: cannot find symbol -[WARNING] class RLoggerMainLoopCallback implements RMainLoopCallbacks { -[WARNING] ^ -[WARNING] symbol: class RMainLoopCallbacks -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:42: error: cannot find symbol -[WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:57: error: cannot find symbol -[WARNING] public void rBusy(final Rengine rengine, final int which) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:77: error: cannot find symbol -[WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:88: error: cannot find symbol -[WARNING] public void rShowMessage(final Rengine rengine, final String message) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:99: error: cannot find symbol -[WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:108: error: cannot find symbol -[WARNING] public void rFlushConsole(final Rengine rengine) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:118: error: cannot find symbol -[WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RLoggerMainLoopCallback.java:127: error: cannot find symbol -[WARNING] public void rLoadHistory(final Rengine re, final String filename) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RLoggerMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:24: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.Rengine; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:56: error: cannot find symbol -[WARNING] private Rengine rengine; -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class GobyRengine -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/GobyRengine.java:127: error: cannot find symbol -[WARNING] public Rengine getRengine() { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class GobyRengine -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:27: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.REXP; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:28: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.RVector; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:29: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.Rengine; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/FisherExact.java:208: error: cannot find symbol -[WARNING] private static Result evaluateFisherExpression(final Rengine rengine, -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class FisherExact -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:21: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.RMainLoopCallbacks; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:22: error: package org.rosuda.JRI does not exist -[WARNING] import org.rosuda.JRI.Rengine; -[WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:27: error: cannot find symbol -[WARNING] class RConsoleMainLoopCallback implements RMainLoopCallbacks { -[WARNING] ^ -[WARNING] symbol: class RMainLoopCallbacks -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:35: error: cannot find symbol -[WARNING] public void rWriteConsole(final Rengine rengine, final String text, final int type) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:50: error: cannot find symbol -[WARNING] public void rBusy(final Rengine rengine, final int which) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:70: error: cannot find symbol -[WARNING] public String rReadConsole(final Rengine rengine, final String prompt, final int addToHistory) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:81: error: cannot find symbol -[WARNING] public void rShowMessage(final Rengine rengine, final String message) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:92: error: cannot find symbol -[WARNING] public String rChooseFile(final Rengine rengine, final int newFile) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:101: error: cannot find symbol -[WARNING] public void rFlushConsole(final Rengine rengine) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:111: error: cannot find symbol -[WARNING] public void rSaveHistory(final Rengine rengine, final String filename) { -[WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/R/RConsoleMainLoopCallback.java:120: error: cannot find symbol -[WARNING] public void rLoadHistory(final Rengine re, final String filename) { +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/cli/FoldChangeForExonPairs.java:22: error: package org.apache.commons.cli does not exist +[WARNING] import org.apache.commons.cli.*; [WARNING] ^ -[WARNING] symbol: class Rengine -[WARNING] location: class RConsoleMainLoopCallback [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/../goby-distribution/src/main/java/org/campagnelab/goby/algorithmic/data/xml/AnnotationLength.java:29: error: cannot find symbol [WARNING] @XmlAccessorType(XmlAccessType.FIELD) [WARNING] ^ @@ -3588,6 +3624,9 @@ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/readers/vcf/VCFParser.java:179: warning: invalid input: '<' [WARNING] * Set to <= 0 to scan the entire file. This must be set before calling readHeader() for the value to be used. [WARNING] ^ +[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore +[WARNING] * Dequeues a document from the queue, returning an instance of {@link +[WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ @@ -3597,9 +3636,6 @@ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore [WARNING] * Dequeues a document from the queue, returning an instance of {@link [WARNING] ^ -[WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/methylation/HitBoundedPriorityQueue.java:127: warning: reference not found: edu.cornell.med.icb.tissueinfo.similarity.TranscriptScore -[WARNING] * Dequeues a document from the queue, returning an instance of {@link -[WARNING] ^ [WARNING] /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/src/main/java/org/campagnelab/goby/stats/AlignedCountNormalization.java:73: warning: @inheritDoc used but getDenominator(DifferentialExpressionCalculator, String) does not override or implement any method. [WARNING] public double getDenominator(final DifferentialExpressionCalculator differentialExpressionCalculator, [WARNING] ^ @@ -3643,14 +3679,14 @@ [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] -[INFO] Goby Framework ..................................... SUCCESS [ 0.062 s] -[INFO] Goby I/O ........................................... SUCCESS [ 25.186 s] -[INFO] Goby Full Distribution ............................. SUCCESS [ 36.572 s] +[INFO] Goby Framework ..................................... SUCCESS [ 0.052 s] +[INFO] Goby I/O ........................................... SUCCESS [ 18.999 s] +[INFO] Goby Full Distribution ............................. SUCCESS [ 19.551 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ -[INFO] Total time: 01:01 min -[INFO] Finished at: 2026-09-08T11:36:40-12:00 +[INFO] Total time: 38.710 s +[INFO] Finished at: 2025-08-07T07:20:57+14:00 [INFO] ------------------------------------------------------------------------ debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' @@ -3809,215 +3845,546 @@ [INFO] T E S T S [INFO] ------------------------------------------------------- [INFO] Running TestSuite -11:36:59.262 INFO TestPostBarcodeMatcher - Num matches = 200, Num Ambiguous = 0, Num no matches = 0 -11:36:59.267 INFO TestPostBarcodeMatcher - Time to parse 8 million reads 0 seconds +field CHROM value: 0 +field POS value: 145497099 +field ID value: . +field REF value: A +field ALT value: G +field QUAL value: 17.1 +field FILTER value: . +field INFO[DP] value: 2 +field INFO[DP4] value: 0,0,2,0 +field INFO[MQ] value: 25 +field INFO[FQ] value: -30.8 +field INFO[AF1] value: 0.9999 +field INFO[CI95] value: 0.5,1 +field INFO[PV4] value: +field INFO[INDEL] value: INDEL +field INFO[PC2] value: 3,3 +field INFO[PCHI2] value: 0.752 +field INFO[QCHI2] value: 1 +field INFO[RP] value: +field FORMAT[GT] value: +field FORMAT[GQ] value: +field FORMAT[GL] value: +field FORMAT[DP] value: +field FORMAT[SP] value: +field FORMAT[PL] value: +field results/IPBKRNW/IPBKRNW-replicate.bam[GT] value: 1/1 +field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] value: 42 +field results/IPBKRNW/IPBKRNW-replicate.bam[GL] value: +field results/IPBKRNW/IPBKRNW-replicate.bam[DP] value: +field results/IPBKRNW/IPBKRNW-replicate.bam[SP] value: +field results/IPBKRNW/IPBKRNW-replicate.bam[PL] value: 25,3,0 +field results/IPBKRNW/IPBKRNW-sorted.bam[GT] value: 1/1 +field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] value: 42 +field results/IPBKRNW/IPBKRNW-sorted.bam[GL] value: +field results/IPBKRNW/IPBKRNW-sorted.bam[DP] value: +field results/IPBKRNW/IPBKRNW-sorted.bam[SP] value: +field results/IPBKRNW/IPBKRNW-sorted.bam[PL] value: 25,3,0 +field CHROM gfi:0 value: 0 +field POS gfi:1 value: 145497099 +field ID gfi:2 value: . +field REF gfi:3 value: A +field ALT gfi:4 value: G +field QUAL gfi:5 value: 17.1 +field FILTER gfi:6 value: . +field FORMAT[GT] gfi:7 value: +field FORMAT[GQ] gfi:8 value: +field FORMAT[GL] gfi:9 value: +field FORMAT[DP] gfi:10 value: +field FORMAT[SP] gfi:11 value: +field FORMAT[PL] gfi:12 value: +field results/IPBKRNW/IPBKRNW-replicate.bam[GT] gfi:13 value: 1/1 +field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] gfi:14 value: 11 +field results/IPBKRNW/IPBKRNW-replicate.bam[GL] gfi:15 value: +field results/IPBKRNW/IPBKRNW-replicate.bam[DP] gfi:16 value: +field results/IPBKRNW/IPBKRNW-replicate.bam[SP] gfi:17 value: +field results/IPBKRNW/IPBKRNW-replicate.bam[PL] gfi:18 value: 015,4,0 +field results/IPBKRNW/IPBKRNW-sorted.bam[GT] gfi:19 value: 1/1 +field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] gfi:20 value: 42 +field results/IPBKRNW/IPBKRNW-sorted.bam[GL] gfi:21 value: +field results/IPBKRNW/IPBKRNW-sorted.bam[DP] gfi:22 value: +field results/IPBKRNW/IPBKRNW-sorted.bam[SP] gfi:23 value: +field results/IPBKRNW/IPBKRNW-sorted.bam[PL] gfi:24 value: 25,3,0 SLF4J: Class path contains multiple SLF4J bindings. SLF4J: Found binding in [jar:file:/usr/share/java/slf4j-simple.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/build/reproducible-path/libgoby-java-3.3.1+dfsg2/debian/maven-repo/ch/qos/logback/logback-classic/debian/logback-classic-debian.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: Found binding in [jar:file:/usr/share/java/logback-classic.jar!/org/slf4j/impl/StaticLoggerBinder.class] SLF4J: See http://www.slf4j.org/codes.html#multiple_bindings for an explanation. SLF4J: Actual binding is of type [org.slf4j.impl.SimpleLoggerFactory] -Creating base test directory: test-results/stats -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -11:36:59.447 INFO RLoggerMainLoopCallback - +07:21:10.903 WARN MessageChunksWriter - Using chunk-size=10000 +Total logical entries written: 1 +Total bytes written: 0 +Average bytes/logical entry: 0.0 +Min query index: 0 +Max query index: 0 +Number of queries: 1 +Number of targets: 45 +07:21:10.972 WARN GobyVersion - Version number UNKNOWN not recognized. Assuming this version is the most recent. +07:21:11.335 INFO RLoggerMainLoopCallback - -11:36:59.448 INFO RLoggerMainLoopCallback - R version 4.5.0 (2025-04-11) -- "How About a Twenty-Six" +07:21:11.335 INFO RLoggerMainLoopCallback - R version 4.5.0 (2025-04-11) -- "How About a Twenty-Six" Copyright (C) 2025 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu -11:36:59.448 INFO RLoggerMainLoopCallback - R is free software and comes with ABSOLUTELY NO WARRANTY. +07:21:11.335 INFO RLoggerMainLoopCallback - R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. -11:36:59.448 INFO RLoggerMainLoopCallback - R is a collaborative project with many contributors. +07:21:11.335 INFO RLoggerMainLoopCallback - R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. -11:36:59.448 INFO RLoggerMainLoopCallback - Type 'demo()' for some demos, 'help()' for on-line help, or +07:21:11.335 INFO RLoggerMainLoopCallback - Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] -[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest -[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. -##fileformat=VCFv4.1 -##Goby=UNKNOWN -##FieldGroupAssociations=CHROM=genomic-coordinate,CHROM=cross-sample-field,POS=genomic-coordinate,POS=cross-sample-field,ID=external-identifiers,ID=cross-sample-field,REF=cross-sample-field,ALT=cross-sample-field,QUAL=cross-sample-field,FILTER=cross-sample-field,INFO=cross-sample-field,INFO/p-value1=cross-sample-field,INFO/p-value1=p-value,INFO/p-value2=cross-sample-field,INFO/p-value2=p-value,INFO/#Cm_Group[Group_1]=cross-sample-field,INFO/#Cm_Group[Group_1]=#Cm,FORMAT/Zygosity=zygozity,FORMAT/Zygosity=sample-data,FORMAT/Another=another,FORMAT/Another=sample-data, -##INFO= -##INFO= -##INFO= -##FORMAT= -##FORMAT= -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SampleA SampleB - -11:36:59.723 INFO BullardUpperQuartileNormalization - normalization denominator 55731.7 for sample B-7 -11:36:59.723 INFO BullardUpperQuartileNormalization - normalization denominator 55210.1 for sample B-3 -11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 114146 for sample A-3 -11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 110048 for sample A-12 -11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 55508.1 for sample B-15 -11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 56178.7 for sample B-14 -11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 57370.8 for sample B-11 -11:36:59.724 INFO BullardUpperQuartileNormalization - normalization denominator 110495 for sample A-17 -11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 57892.4 for sample B-2 -11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 57668.9 for sample B-10 -11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 110793 for sample A-16 -11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 56402.2 for sample B-8 -11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 54316.0 for sample B-4 -11:36:59.725 INFO BullardUpperQuartileNormalization - normalization denominator 113773 for sample A-2 -11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 108781 for sample A-0 -11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 55359.1 for sample B-6 -11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 111687 for sample A-9 -11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 109899 for sample A-8 -11:36:59.726 INFO BullardUpperQuartileNormalization - normalization denominator 114071 for sample A-5 -11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 110569 for sample A-4 -11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 113177 for sample A-6 -11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 113102 for sample A-7 -11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 56923.8 for sample B-5 -11:36:59.727 INFO BullardUpperQuartileNormalization - normalization denominator 114071 for sample A-10 -11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 109303 for sample A-14 -11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 55061.1 for sample B-9 -11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 112059 for sample A-1 -11:36:59.728 INFO BullardUpperQuartileNormalization - normalization denominator 56029.7 for sample B-0 -11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 56700.3 for sample B-12 -11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 57147.3 for sample B-13 -11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 113401 for sample A-19 -11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 110718 for sample A-18 -11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 112208 for sample A-15 -11:36:59.729 INFO BullardUpperQuartileNormalization - normalization denominator 56029.7 for sample B-1 -11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 112953 for sample A-13 -11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 112581 for sample A-11 -11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 57668.9 for sample B-16 -11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 56774.8 for sample B-17 -11:36:59.730 INFO BullardUpperQuartileNormalization - normalization denominator 55880.7 for sample B-19 -11:36:59.731 INFO BullardUpperQuartileNormalization - normalization denominator 57519.8 for sample B-18 -11:36:59.802 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value -11:36:59.846 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. -11:36:59.846 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value -11:36:59.859 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. -11:36:59.859 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value -11:36:59.996 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. -11:37:00.046 INFO FDRAdjustment - ... statistic t-test-P-value-Bonferroni-adjusted was found, FDR adjustment executed. -11:37:00.047 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value -11:37:00.174 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. -11:37:00.192 INFO FDRAdjustment - ... statistic another-p-value-Bonferroni-adjusted was found, FDR adjustment executed. -list3:element-id p-value p-value-BH-FDR-q-value -[ 0 [2.354054E-7, 1.177027E-5] ] -[ 1 [2.10159E-5, 4.294736666666667E-4] ] -[ 2 [2.576842E-5, 4.294736666666667E-4] ] -[ 3 [9.814783E-5, 9.471342857142858E-4] ] -[ 4 [1.05261E-4, 9.471342857142858E-4] ] -[ 5 [1.241481E-4, 9.471342857142858E-4] ] -[ 6 [1.325988E-4, 9.471342857142858E-4] ] -[ 7 [1.568503E-4, 9.803143750000002E-4] ] -[ 8 [2.254557E-4, 0.0012525316666666666] ] -[ 9 [3.79538E-4, 0.00189769] ] -[ 10 [6.114943E-4, 0.0027795195454545455] ] -[ 11 [0.001613954, 0.006724808333333334] ] -[ 12 [0.00330243, 0.012636935714285714] ] -[ 13 [0.003538342, 0.012636935714285714] ] -[ 14 [0.005236997, 0.017456656666666667] ] -[ 15 [0.006831909, 0.020762429411764708] ] -[ 16 [0.007059226, 0.020762429411764708] ] -[ 17 [0.008805129, 0.024458691666666667] ] -[ 18 [0.00940104, 0.02473957894736842] ] -[ 19 [0.01129798, 0.028244949999999998] ] -[ 20 [0.02115017, 0.050357547619047614] ] -[ 21 [0.04922736, 0.11188036363636364] ] -[ 22 [0.06053298, 0.1304633125] ] -[ 23 [0.06262239, 0.1304633125] ] -[ 24 [0.07395153, 0.14790306] ] -[ 25 [0.08281103, 0.15925198076923075] ] -[ 26 [0.08633331, 0.1598765] ] -[ 27 [0.1190654, 0.21261678571428572] ] -[ 28 [0.1890796, 0.32599931034482754] ] -[ 29 [0.2058494, 0.3430823333333333] ] -[ 30 [0.2209214, 0.3563248387096774] ] -[ 31 [0.2856, 0.44625000000000004] ] -[ 32 [0.3048895, 0.4619537878787878] ] -[ 33 [0.4660682, 0.6835770833333333] ] -[ 34 [0.4830809, 0.6835770833333333] ] -[ 35 [0.4921755, 0.6835770833333333] ] -[ 36 [0.5319453, 0.718845] ] -[ 37 [0.575155, 0.7414352564102564] ] -[ 38 [0.5783195, 0.7414352564102564] ] -[ 39 [0.6185894, 0.7626062790697675] ] -[ 40 [0.636362, 0.7626062790697675] ] -[ 41 [0.6448587, 0.7626062790697675] ] -[ 42 [0.6558414, 0.7626062790697675] ] -[ 43 [0.6885884, 0.7824868181818182] ] -[ 44 [0.7189864, 0.7988737777777778] ] -[ 45 [0.8179539, 0.8802645744680851] ] -[ 46 [0.8274487, 0.8802645744680851] ] -[ 47 [0.89713, 0.9304775510204082] ] -[ 48 [0.911868, 0.9304775510204082] ] -[ 49 [0.943789, 0.943789] ] +07:21:11.517 WARN MessageChunksWriter - Using chunk-size=9 +07:21:11.522 WARN MessageChunksWriter - Using chunk-size=9 +Total logical entries written: 39 +Total bytes written: 660 +Average bytes/logical entry: 16.923077 +Number of bits/base 3.6590436 +07:21:11.525 WARN MessageChunksWriter - Using chunk-size=9 +Total logical entries written: 39 +Total bytes written: 685 +Average bytes/logical entry: 17.564102 +Number of bits/base 3.797644 +07:21:11.530 WARN MessageChunksWriter - Using chunk-size=9 +Total logical entries written: 39 +Total bytes written: 660 +Average bytes/logical entry: 16.923077 +Number of bits/base 3.6590436 +>1 +NNTGAATGAGACCTA -element-id average RPKM group A(AC) average RPKM group B(AC) average log2_RPKM group A(AC) average log2_RPKM group B(AC) average count group A average count group B -[ id-1 [1.0027385888732063, 0.49859021162242134, 0.003945548431445906, -1.0040735349267995, 0.0, 0.0] ] +qPhred=1 +qPhred=2 +qPhred=3 +qPhred=4 +qPhred=5 +qPhred=6 +qPhred=7 +qPhred=8 +qPhred=9 +qPhred=10 +qPhred=11 +qPhred=12 +qPhred=13 +qPhred=14 +qPhred=15 +qPhred=16 +qPhred=17 +qPhred=18 +qPhred=19 +qPhred=20 +qPhred=21 +qPhred=22 +qPhred=23 +qPhred=24 +qPhred=25 +qPhred=26 +qPhred=27 +qPhred=28 +qPhred=29 +qPhred=30 +qPhred=31 +qPhred=32 +qPhred=33 +qPhred=34 +qPhred=35 +qPhred=36 +qPhred=37 +qPhred=38 +qPhred=39 +qPhred=40 +qPhred=41 +qPhred=42 +qPhred=43 +qPhred=44 +qPhred=45 +qPhred=46 +qPhred=47 +qPhred=48 +qPhred=49 +qPhred=50 +qPhred=51 +qPhred=52 +qPhred=53 +qPhred=54 +qPhred=55 +qPhred=56 +qPhred=57 +qPhred=58 +qPhred=59 +qPhred=60 +qPhred=61 + 0 +AAC 3 +ACC 6 +ATC 9 +AGC 12 +AAC 15 +ACC 18 +ATC 21 +AGC 24 +AAC 27 +ACC 30 +ATC 33 +AGC 36 +AAC 39 +ACC 42 +ATC 45 +AGC 48 +AAC 51 +ACC 54 +ATC 57 +AGC 60 +AAC 63 +ACC 66 +ATC 69 +AGC 72 +AAC 75 +ACC 78 +ATC 81 +AGCloading transition for reader[0] position=0 length=1 count=0 +loading transition for reader[1] position=0 length=6 count=1 +(0,1) +loading transition for reader[0] position=1 length=3 count=3 +(0,1)(1,4) +loading transition for reader[0] position=4 length=2 count=0 +(0,1)(1,4)(4,1) +loading transition for reader[0] position=0 length=1 count=0 +loading transition for reader[1] position=0 length=4 count=0 +(0,0) +loading transition for reader[0] position=1 length=1 count=1 +(0,0)(1,1) +loading transition for reader[0] position=2 length=4 count=0 +(0,0)(1,1)(2,0) +loading transition for reader[1] position=4 length=10 count=1 +(0,0)(1,1)(2,0)(4,1) +loading transition for reader[0] position=6 length=2 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2) +loading transition for reader[0] position=8 length=1 count=0 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1) +loading transition for reader[0] position=9 length=1 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) +loading transition for reader[0] position=10 length=2 count=0 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) +loading transition for reader[0] position=12 length=1 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) +loading transition for reader[0] position=13 length=3 count=0 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) +loading transition for reader[0] position=16 length=1 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) +loading transition for reader[0] position=0 length=1 count=0 +loading transition for reader[1] position=0 length=4 count=0 +loading transition for reader[0] position=1 length=1 count=1 +loading transition for reader[0] position=2 length=4 count=0 +loading transition for reader[1] position=4 length=10 count=1 +loading transition for reader[0] position=6 length=2 count=1 +loading transition for reader[0] position=8 length=1 count=0 +loading transition for reader[0] position=9 length=1 count=1 +loading transition for reader[0] position=10 length=2 count=0 +loading transition for reader[0] position=12 length=1 count=1 +loading transition for reader[0] position=13 length=3 count=0 +loading transition for reader[0] position=16 length=1 count=1 + peak : start :5 count :13 length :100010 + peak : start :100020 count :10 length :1 +07:21:15.315 WARN WiggleWindow - Not writing 101 7 +07:21:15.315 WARN WiggleWindow - Not writing 111 7 +07:21:15.315 WARN WiggleWindow - Not writing 131 8 +07:21:15.316 WARN WiggleWindow - Not writing 141 8 +07:21:15.316 WARN WiggleWindow - Not writing 151 8 + appending (count=0,length=1) + appending (count=4,length=3) + appending (count=1,length=3) + appending (count=0,length=2) + appending (count=3,length=1) + appending (count=1,length=1) + appending (count=0,length=1) + appending (count=4,length=3) + appending (count=0,length=5) + appending (count=3,length=1) + appending (count=0,length=2) + appending (count=2,length=1) + appending (count=0,length=2) + appending (count=3,length=1) + appending (count=2,length=1) + appending (count=0,length=1) + appending (count=10,length=4) + appending (count=1,length=0) + appending (count=2,length=8) +Hello + appending (count=10,length=4) +loading transition for reader[0] position=0 length=1 count=0 +loading transition for reader[1] position=0 length=6 count=1 +(0,1) +loading transition for reader[0] position=1 length=3 count=3 +(0,1)(1,4) +loading transition for reader[0] position=4 length=2 count=0 +(0,1)(1,4)(4,1) +loading transition for reader[0] position=0 length=1 count=0 +loading transition for reader[1] position=0 length=4 count=0 +(0,0) +loading transition for reader[0] position=1 length=1 count=1 +(0,0)(1,1) +loading transition for reader[0] position=2 length=4 count=0 +(0,0)(1,1)(2,0) +loading transition for reader[1] position=4 length=10 count=1 +(0,0)(1,1)(2,0)(4,1) +loading transition for reader[0] position=6 length=2 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2) +loading transition for reader[0] position=8 length=1 count=0 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1) +loading transition for reader[0] position=9 length=1 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) +loading transition for reader[0] position=10 length=2 count=0 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) +loading transition for reader[0] position=12 length=1 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) +loading transition for reader[0] position=13 length=3 count=0 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) +loading transition for reader[0] position=16 length=1 count=1 +(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) +loading transition for reader[0] position=0 length=1 count=0 +loading transition for reader[1] position=0 length=4 count=0 +loading transition for reader[0] position=1 length=1 count=1 +loading transition for reader[0] position=2 length=4 count=0 +loading transition for reader[1] position=4 length=10 count=1 +loading transition for reader[0] position=6 length=2 count=1 +loading transition for reader[0] position=8 length=1 count=0 +loading transition for reader[0] position=9 length=1 count=1 +loading transition for reader[0] position=10 length=2 count=0 +loading transition for reader[0] position=12 length=1 count=1 +loading transition for reader[0] position=13 length=3 count=0 +loading transition for reader[0] position=16 length=1 count=1 +loading transition for reader[0] position=0 length=1 count=0 +(0,0) +loading transition for reader[0] position=1 length=3 count=1 +(0,0)(1,1) +Appending count: 497 length: 3 +Appending count: 33567 length: 6 +Appending count: 47675 length: 3 +Appending count: 22804 length: 2 +Appending count: 5178 length: 6 +Appending count: 32523 length: 4 +Appending count: 28381 length: 4 +Appending count: 46184 length: 1 +Appending count: 32066 length: 10 +Appending count: 49035 length: 5 +Appending count: 22152 length: 6 +Appending count: 40257 length: 8 +Appending count: 25232 length: 9 +Appending count: 8391 length: 2 +Appending count: 6253 length: 8 +Appending count: 41658 length: 8 +Appending count: 16202 length: 1 +Appending count: 8522 length: 1 +Appending count: 22010 length: 4 +Appending count: 27645 length: 1 +Appending count: 24683 length: 2 +Appending count: 8015 length: 7 +Appending count: 6484 length: 3 +Appending count: 38775 length: 6 +Appending count: 26685 length: 2 +Appending count: 25493 length: 6 +Appending count: 35374 length: 6 +Appending count: 15320 length: 7 +Appending count: 5680 length: 2 +Appending count: 11884 length: 4 + position= 0 count= 497 + position= 1 count= 497 + position= 2 count= 497 + position= 3 count= 33567 + position= 4 count= 33567 + position= 5 count= 33567 + position= 6 count= 33567 + position= 7 count= 33567 + position= 8 count= 33567 + position= 9 count= 47675 + position= 10 count= 47675 + position= 11 count= 47675 + position= 12 count= 22804 + position= 13 count= 22804 + position= 14 count= 5178 + position= 15 count= 5178 + position= 16 count= 5178 + position= 17 count= 5178 + position= 18 count= 5178 + position= 19 count= 5178 + position= 20 count= 32523 + position= 21 count= 32523 + position= 22 count= 32523 + position= 23 count= 32523 + position= 24 count= 28381 + position= 25 count= 28381 + position= 26 count= 28381 + position= 27 count= 28381 + position= 28 count= 46184 + position= 29 count= 32066 + position= 30 count= 32066 + position= 31 count= 32066 + position= 32 count= 32066 + position= 33 count= 32066 + position= 34 count= 32066 + position= 35 count= 32066 + position= 36 count= 32066 + position= 37 count= 32066 + position= 38 count= 32066 + position= 39 count= 49035 + position= 40 count= 49035 + position= 41 count= 49035 + position= 42 count= 49035 + position= 43 count= 49035 + position= 44 count= 22152 + position= 45 count= 22152 + position= 46 count= 22152 + position= 47 count= 22152 + position= 48 count= 22152 + position= 49 count= 22152 + position= 50 count= 40257 + position= 51 count= 40257 + position= 52 count= 40257 + position= 53 count= 40257 + position= 54 count= 40257 + position= 55 count= 40257 + position= 56 count= 40257 + position= 57 count= 40257 + position= 58 count= 25232 + position= 59 count= 25232 + position= 60 count= 25232 + position= 61 count= 25232 + position= 62 count= 25232 + position= 63 count= 25232 + position= 64 count= 25232 + position= 65 count= 25232 + position= 66 count= 25232 + position= 67 count= 8391 + position= 68 count= 8391 + position= 69 count= 6253 + position= 70 count= 6253 + position= 71 count= 6253 + position= 72 count= 6253 + position= 73 count= 6253 + position= 74 count= 6253 + position= 75 count= 6253 + position= 76 count= 6253 + position= 77 count= 41658 + position= 78 count= 41658 + position= 79 count= 41658 + position= 80 count= 41658 + position= 81 count= 41658 + position= 82 count= 41658 + position= 83 count= 41658 + position= 84 count= 41658 + position= 85 count= 16202 + position= 86 count= 8522 + position= 87 count= 22010 + position= 88 count= 22010 + position= 89 count= 22010 + position= 90 count= 22010 + position= 91 count= 27645 + position= 92 count= 24683 + position= 93 count= 24683 + position= 94 count= 8015 + position= 95 count= 8015 + position= 96 count= 8015 + position= 97 count= 8015 + position= 98 count= 8015 + position= 99 count= 8015 + position= 100 count= 8015 + position= 101 count= 6484 + position= 102 count= 6484 + position= 103 count= 6484 + position= 104 count= 38775 + position= 105 count= 38775 + position= 106 count= 38775 + position= 107 count= 38775 + position= 108 count= 38775 + position= 109 count= 38775 + position= 110 count= 26685 + position= 111 count= 26685 + position= 112 count= 25493 + position= 113 count= 25493 + position= 114 count= 25493 + position= 115 count= 25493 + position= 116 count= 25493 + position= 117 count= 25493 + position= 118 count= 35374 + position= 119 count= 35374 + position= 120 count= 35374 + position= 121 count= 35374 + position= 122 count= 35374 + position= 123 count= 35374 + position= 124 count= 15320 + position= 125 count= 15320 + position= 126 count= 15320 + position= 127 count= 15320 + position= 128 count= 15320 + position= 129 count= 15320 + position= 130 count= 15320 + position= 131 count= 5680 + position= 132 count= 5680 + position= 133 count= 11884 + position= 134 count= 11884 + position= 135 count= 11884 + position= 136 count= 11884 +Scanning target file.. +Target file had 1 entries. +Wrote 1 target ids to alignment header. +Setting quality threshold to 0.05 +Total logical entries written: 2 +Total bytes written: 0 +Average bytes/logical entry: 0.0 +Min query index: 0 +Max query index: 0 +Number of queries: 3 +Number of targets: 3 +Removed by quality filter: 0 +Not best score: 1 +Number of alignments written: 2 +query_index: 0 +target_index: 0 +position: 14977972 +score: 780.0 +matching_reverse_strand: false +multiplicity: 1 +number_of_mismatches: 1 +number_of_indels: 0 +query_length: 142 +query_aligned_length: 134 +target_aligned_length: 134 +sequence_variations { + to: "T" + from: "A" + position: 6 + to_quality: "/" + read_index: 14 +} +fragment_index: 0 +query_index_occurrences: 2 +ambiguity: 1 -truncated fdr=3.53108e-05 original=3.53108e-05 -truncated fdr=0.00128842 original=0.00128842 -truncated fdr=0.00128842 original=0.00128842 -truncated fdr=0.00284140 original=0.00284140 -truncated fdr=0.00284140 original=0.00284140 -truncated fdr=0.00284140 original=0.00284140 -truncated fdr=0.00284140 original=0.00284140 -truncated fdr=0.00294094 original=0.00294094 -truncated fdr=0.00375760 original=0.00375760 -truncated fdr=0.00569307 original=0.00569307 -truncated fdr=0.00833856 original=0.00833856 -truncated fdr=0.0201744 original=0.0201744 -truncated fdr=0.0379108 original=0.0379108 -truncated fdr=0.0379108 original=0.0379108 -truncated fdr=0.0523700 original=0.0523700 -truncated fdr=0.0622873 original=0.0622873 -truncated fdr=0.0622873 original=0.0622873 -truncated fdr=0.0733761 original=0.0733761 -truncated fdr=0.0742187 original=0.0742187 -truncated fdr=0.0847349 original=0.0847349 -truncated fdr=0.151073 original=0.151073 -truncated fdr=0.335641 original=0.335641 -truncated fdr=0.391390 original=0.391390 -truncated fdr=0.391390 original=0.391390 -truncated fdr=0.443709 original=0.443709 -truncated fdr=0.477756 original=0.477756 -truncated fdr=0.479630 original=0.479630 -truncated fdr=0.637850 original=0.637850 -truncated fdr=0.977998 original=0.977998 -truncated fdr=1.00000 original=1.00000 -truncated fdr=1.00000 original=1.00000 -truncated fdr=1.00000 original=1.00000 -truncated fdr=1.00000 original=1.00000 -[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. -[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. -[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. -[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 42 threads. -Creating base test directory: test-results/stats-writer -allele: A ref: [CC] alt: [T]11:37:12.719 WARN MessageChunksWriter - Using chunk-size=10000 +Processing test-data/sample-qual-scores/30reads.fa +Processed 0 read entries. +Min quality score: 2147483647 +Max quality score: -2147483648 +Avg quality score: 0 +Probable quality encoding scheme: fasta +Processing test-data/sample-qual-scores/30reads.fq +Processed 30 read entries. +Min quality score: 69 +Max quality score: 98 +Avg quality score: 94 +Probable quality encoding scheme: Illumina/Solexa Associating basename: basen0 to group: A Associating basename: basen1 to group: A Associating basename: basen2 to group: A @@ -4043,37 +4410,36 @@ Filtering reads that have these criteria: q<30 #count(allele) < (2 *#filtered) -11:37:13.176 WARN GobyVersion - Version number UNKNOWN not recognized. Assuming this version is the most recent. [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.258 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.371 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.261 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.374 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.263 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.376 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.265 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.377 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.267 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.379 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.269 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.380 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.271 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.382 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.273 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.384 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.275 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.385 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.277 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.387 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4103,34 +4469,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.463 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.479 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.465 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.480 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.467 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.481 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.468 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.483 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.470 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.484 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.472 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.486 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.473 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.487 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.475 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.489 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.477 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.490 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.478 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.491 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4160,34 +4526,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.554 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.554 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.555 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.555 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.556 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.556 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.558 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.557 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.560 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.558 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.561 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.560 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.563 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.561 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.564 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.562 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.565 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.564 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.567 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.565 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4217,34 +4583,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.637 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.619 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.638 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.620 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.639 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.621 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.641 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.623 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.642 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.624 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.644 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.625 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.645 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.626 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.647 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.627 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.648 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.629 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.649 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.630 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4274,34 +4640,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.747 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.717 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.748 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.718 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.750 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.719 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.751 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.720 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.752 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.721 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.753 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.722 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.755 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.724 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.757 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.725 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.758 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.726 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.760 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.727 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4331,34 +4697,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.827 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.775 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.828 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.776 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.829 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.777 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.830 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.779 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.831 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.780 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.832 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.781 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.833 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.782 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.834 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.783 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.835 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.784 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.836 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.785 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4388,34 +4754,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.897 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.830 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.899 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.831 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.900 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.832 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.901 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.833 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.903 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.834 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.904 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.835 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.905 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.836 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.907 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.837 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.908 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.838 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.910 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.840 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4445,34 +4811,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:13.966 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.884 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:13.967 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.885 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:13.968 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.886 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:13.969 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.887 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:13.970 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.888 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:13.971 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.889 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:13.973 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.890 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:13.974 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.891 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:13.976 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.892 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:13.977 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.893 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4502,34 +4868,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:14.037 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.936 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:14.038 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.937 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:14.039 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.938 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:14.040 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.939 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:14.041 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.940 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:14.042 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.941 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:14.043 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.942 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:14.044 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.943 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:14.045 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.944 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:14.046 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.945 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4559,34 +4925,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:14.101 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:16.987 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:14.102 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:16.988 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:14.103 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:16.989 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:14.104 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:16.990 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:14.105 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:16.991 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:14.106 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:16.992 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:14.107 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:16.993 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:14.108 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:16.994 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:14.109 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:16.995 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:14.110 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:16.996 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4616,34 +4982,34 @@ #count(allele) < (2 *#filtered) [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:14.167 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:17.069 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:14.168 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:17.070 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:14.169 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:17.071 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:14.170 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:17.072 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:14.171 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:17.072 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:14.172 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:17.073 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:14.173 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:17.074 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:14.174 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:17.075 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:14.174 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:17.076 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:14.175 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:17.077 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 Associating basename: basen0 to group: A @@ -4672,34 +5038,34 @@ [main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest_mci [main] ERROR org.campagnelab.goby.alignments.IterateSortedAlignments - Genome reference no-name0 length (96) differs from alignment reference length (10000) for sequence target1 at index 0 [main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences -11:37:14.236 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. +07:21:17.129 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen0.tmh has no 'too many hits' information (test-results/discover-variants/basen0.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen0 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen0 -11:37:14.237 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. +07:21:17.130 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen1.tmh has no 'too many hits' information (test-results/discover-variants/basen1.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen1 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen1 -11:37:14.238 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. +07:21:17.132 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen2.tmh has no 'too many hits' information (test-results/discover-variants/basen2.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen2 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen2 -11:37:14.239 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. +07:21:17.133 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen3.tmh has no 'too many hits' information (test-results/discover-variants/basen3.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen3 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen3 -11:37:14.240 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. +07:21:17.134 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen4.tmh has no 'too many hits' information (test-results/discover-variants/basen4.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen4 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen4 -11:37:14.241 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. +07:21:17.134 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen5.tmh has no 'too many hits' information (test-results/discover-variants/basen5.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen5 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen5 -11:37:14.242 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. +07:21:17.135 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen6.tmh has no 'too many hits' information (test-results/discover-variants/basen6.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen6 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen6 -11:37:14.243 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. +07:21:17.136 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen7.tmh has no 'too many hits' information (test-results/discover-variants/basen7.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen7 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen7 -11:37:14.244 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. +07:21:17.137 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen8.tmh has no 'too many hits' information (test-results/discover-variants/basen8.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen8 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen8 -11:37:14.245 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. +07:21:17.138 INFO AlignmentTooManyHitsReader - basename test-results/discover-variants/basen9.tmh has no 'too many hits' information (test-results/discover-variants/basen9.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/discover-variants/basen9 [main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/discover-variants/basen9 info: + ref: A s=0 @@ -4737,12 +5103,6 @@ info: + /N q=40 s=1 list: pos=-1 #bases: 33 #indels: 0 filtered: {+ ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + ref: A s=0, + /C q=10 s=0, + /C q=20 s=0, + /C q=30 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=40 s=0, + /C q=10 s=0, + /C q=20 s=0, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + ref: A s=1, + /T q=40 s=1, + /T q=10 s=1, + /T q=20 s=1, + /T q=30 s=1, + /N q=40 s=1, + /N q=40 s=1} -Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads -Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads -Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads -[main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences - 1/1 ..T - Loading test-data/fdr-mode/file1.vcf Loading test-data/fdr-mode/file2.vcf Loading test-data/fdr-mode/file3.vcf @@ -4766,121 +5126,670 @@ Combining test-data/fdr-mode/file1.vcf Combining test-data/fdr-mode/file2.vcf Combining test-data/fdr-mode/file3.vcf -Scanning target file.. -Target file had 1 entries. -Wrote 1 target ids to alignment header. -Setting quality threshold to 0.05 -Total logical entries written: 2 +TTC[27]->CGT[27] / qual=1:2:3 +A[15]->G[20] / qual=20 +A[15]->G[20] / qual=20 +Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads +Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads +Converting [1/1] test-data/compact-reads/with-meta-data-input.compact-reads to will-not-write-here.compact-reads +[main] INFO org.campagnelab.goby.alignments.IterateSortedAlignments - Alignment contains 1 reference sequences + 1/1 ..T + +[ {N:15} {///////////00//0010} {N:15} {00101111001101100101111101111111/0/} |Encoded in 80 bits +[ {N:15} {11111111111001100101100011111001011110011011001011111011111111} {0} {1} {1} {1} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->29 {N:15} {00101111001101100101111101111111101110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->74decoding: 0 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 1 +decoding: 2 +decoding: 3 +decoding: 4 +decoding: 3 +decoding: 1 +decoding: 2 +decoding: 1 +decoding: 2 +decoding: 3 +decoding: 1 +decoding: 2 +decoding: 1 +decoding: 2 +decoding: 1 +[ {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {0} {1} {0} {0} {1} {1} {1} {0} {0} {0} {1} {0} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {1} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {0} {1} |Encoded in 72 bits +[ {00110011001100100011001001110001010010001101010110100101101001} {0} {0}decoding: 0 + {1} {0}decoding: 4 + {0} {0}decoding: 4 + {0} {0}decoding: 4 + {0}decoding: 4 + {0}decoding: 4 + {0}decoding: 4 +decoding: 4 + {0}decoding: 4 + {0}decoding: 4 +decoding: 4 + {0}decoding: 4 +decoding: 4 + {0}decoding: 4 +decoding: 4 + {0} {0} {0} {0} {0}decoding: 1 + {0} {0} {0} {0}decoding: 2 + {0} {0} {0} {0} {0}decoding: 3 +decoding: 4 + {0} {0} {0} {0}decoding: 3 + {0} {0} {0}decoding: 1 + {0} {0} {0} {0}decoding: 2 + {0} {0} {0}decoding: 1 + {0} {0} {0}decoding: 2 + {0} {0} {0} {0}decoding: 3 + {0} {0} {0}decoding: 1 + {0} {0} {0}decoding: 2 + {0} {0}decoding: 1 + {0} {0} {0}decoding: 2 + {0} {0}decoding: 1 +[ {N:2} {0010} {N:5} {011111} {N:5} {/0/00///01} {N:3} {//0/0/} {N:15} {///////////00//0010} |Encoded in 80 bits +[ {N:2} {00101111010111111111011010011101111011110101110001111111111111} {1} {1} {1} {0} {0} {1} {1} | ->10 {N:5} {01111111110110100111011110111101011100011111111111111110011001} {0} {1} {1} {0} {0} {0} {0} {0} {0} | ->22 {N:5} {10100111011110111101011100011111111111111110011001011000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->38 {N:3} {11010111000111111111111111100110010110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->50 {N:15} {11111111111001100101100000000000000000000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->79decoding: 0 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 4 +decoding: 1 +decoding: 2 +decoding: 3 +decoding: 4 +decoding: 3 +decoding: 1 +decoding: 2 +decoding: 1 +decoding: 2 +decoding: 3 +decoding: 1 +decoding: 2 +decoding: 1 +decoding: 2 +decoding: 1 +[main] WARN org.campagnelab.goby.algorithmic.algorithm.EquivalentIndelRegionCalculator - Cannot determine sequence at position 600000000 of reference-index 2 +Annotations loaded +Annotations loaded +Annotations loaded +Annotations loaded +Annotations loaded +Total logical entries written: 4 Total bytes written: 0 Average bytes/logical entry: 0.0 -Min query index: 0 -Max query index: 0 -Number of queries: 3 -Number of targets: 3 -Removed by quality filter: 0 -Not best score: 1 -Number of alignments written: 2 +Min query index: 1 +Max query index: 1 +Number of queries: 1 +Number of targets: 2 +Total logical entries written: 4 +Total bytes written: 62 +Average bytes/logical entry: 15.5 +Min query index: 1 +Max query index: 1 +Number of queries: 1 +Number of targets: 2 +count perbase{0=>0, 13=>0, 11=>2, 3=>2, 5=>3} +count keys [0, 3, 5, 11, 13] +-1 0.0 +0 0.0 +1 0.0 +2 0.0 +3 0.0 +4 0.0 +5 0.0 +6 0.0 +7 0.0 +8 0.0 +9 0.0 +10 0.0 +11 0.0 +12 0.0 +13 0.0 +14 0.0 +15 0.0 +16 0.0 +17 0.0 +18 0.0 +19 0.0 +20 0.0 +21 0.0 +22 0.0 +23 0.0 +24 0.0 +25 0.0 +26 0.0 +27 0.0 +28 0.0 +29 0.0 +30 0.0 +overlapping count 3, 4 0.0 +overlapping count 15, 17 0.0 +overlapping count 9, 18 2.0 +overlapping count 3, 8 2.0 +overlapping count 11, 12 0.0 +overlapping count 9, 10 1.0 +overlapping count 8, 9 0.0 +overlapping count 8, 8 0.0 +overlapping count 5, 6 0.0 +overlapping count 3, 3 0.0 +overlapping count 3, 12 5.0 +overlapping count -1, 2 0.0 +overlapping count 0, 45 6.0 +overlapping count 13, 15 0.0 +-1 0.0 +0 0.0 +1 0.0 +2 0.0 +3 2.0 +4 2.0 +5 3.0 +6 3.0 +7 3.0 +8 3.0 +9 3.0 +10 3.0 +11 2.0 +12 2.0 +13 0.0 +14 0.0 +15 1.0 +16 1.0 +17 1.0 +18 1.0 +19 0.0 +20 0.0 +21 0.0 +22 0.0 +23 0.0 +24 0.0 +25 0.0 +26 0.0 +27 0.0 +28 0.0 +29 0.0 +30 0.0 +overlapping count 3, 4 2.0 +overlapping count 2, 3 2.0 +overlapping count 3, 8 4.0 +overlapping count 11, 12 2.0 +overlapping count 9, 10 3.0 +overlapping count 8, 9 4.0 +overlapping count 8, 8 3.0 +overlapping count 5, 6 3.0 +overlapping count 3, 3 2.0 +overlapping count 3, 12 5.0 +overlapping count -1, 2 0.0 +overlapping count 0, 45 6.0 +overlapping count 13, 15 1.0 +07:22:05.002 INFO TestPostBarcodeMatcher - Num matches = 200, Num Ambiguous = 0, Num no matches = 0 +07:22:05.003 INFO TestPostBarcodeMatcher - Time to parse 8 million reads 0 seconds +07:22:05.042 INFO BullardUpperQuartileNormalization - normalization denominator 51556.6 for sample B-7 +07:22:05.042 INFO BullardUpperQuartileNormalization - normalization denominator 50792.3 for sample B-3 +07:22:05.042 INFO BullardUpperQuartileNormalization - normalization denominator 105476 for sample A-3 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 102974 for sample A-12 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 53849.5 for sample B-15 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 52112.4 for sample B-14 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 50861.7 for sample B-11 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 105476 for sample A-17 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 50931.2 for sample B-2 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 52807.3 for sample B-10 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 104086 for sample A-16 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 52529.3 for sample B-8 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 51487.1 for sample B-4 +07:22:05.043 INFO BullardUpperQuartileNormalization - normalization denominator 104781 for sample A-2 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 104642 for sample A-0 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 53363.1 for sample B-6 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 103669 for sample A-9 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 106796 for sample A-8 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 105962 for sample A-5 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 100403 for sample A-4 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 100820 for sample A-6 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 103600 for sample A-7 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 50583.8 for sample B-5 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 105267 for sample A-10 +07:22:05.044 INFO BullardUpperQuartileNormalization - normalization denominator 103669 for sample A-14 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 50792.3 for sample B-9 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 105962 for sample A-1 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 50792.3 for sample B-0 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 51209.2 for sample B-12 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 51278.6 for sample B-13 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 102766 for sample A-19 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 103044 for sample A-18 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 106657 for sample A-15 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 52807.3 for sample B-1 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 104086 for sample A-13 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 104294 for sample A-11 +07:22:05.045 INFO BullardUpperQuartileNormalization - normalization denominator 52043.0 for sample B-16 +07:22:05.046 INFO BullardUpperQuartileNormalization - normalization denominator 52946.2 for sample B-17 +07:22:05.046 INFO BullardUpperQuartileNormalization - normalization denominator 50722.8 for sample B-19 +07:22:05.046 INFO BullardUpperQuartileNormalization - normalization denominator 53293.7 for sample B-18 +07:22:05.107 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value +07:22:05.139 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. +07:22:05.139 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value +07:22:05.150 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. +07:22:05.150 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic t-test-P-value +07:22:05.244 INFO FDRAdjustment - ... statistic t-test-P-value was found, FDR adjustment executed. +07:22:05.275 INFO FDRAdjustment - ... statistic t-test-P-value-Bonferroni-adjusted was found, FDR adjustment executed. +07:22:05.276 INFO FDRAdjustment - Trying to perform FDR adjustment for statistic another-p-value +07:22:05.353 INFO FDRAdjustment - ... statistic another-p-value was found, FDR adjustment executed. +07:22:05.360 INFO FDRAdjustment - ... statistic another-p-value-Bonferroni-adjusted was found, FDR adjustment executed. +list3:element-id p-value p-value-BH-FDR-q-value +[ 0 [2.354054E-7, 1.177027E-5] ] +[ 1 [2.10159E-5, 4.294736666666667E-4] ] +[ 2 [2.576842E-5, 4.294736666666667E-4] ] +[ 3 [9.814783E-5, 9.471342857142858E-4] ] +[ 4 [1.05261E-4, 9.471342857142858E-4] ] +[ 5 [1.241481E-4, 9.471342857142858E-4] ] +[ 6 [1.325988E-4, 9.471342857142858E-4] ] +[ 7 [1.568503E-4, 9.803143750000002E-4] ] +[ 8 [2.254557E-4, 0.0012525316666666666] ] +[ 9 [3.79538E-4, 0.00189769] ] +[ 10 [6.114943E-4, 0.0027795195454545455] ] +[ 11 [0.001613954, 0.006724808333333334] ] +[ 12 [0.00330243, 0.012636935714285714] ] +[ 13 [0.003538342, 0.012636935714285714] ] +[ 14 [0.005236997, 0.017456656666666667] ] +[ 15 [0.006831909, 0.020762429411764708] ] +[ 16 [0.007059226, 0.020762429411764708] ] +[ 17 [0.008805129, 0.024458691666666667] ] +[ 18 [0.00940104, 0.02473957894736842] ] +[ 19 [0.01129798, 0.028244949999999998] ] +[ 20 [0.02115017, 0.050357547619047614] ] +[ 21 [0.04922736, 0.11188036363636364] ] +[ 22 [0.06053298, 0.1304633125] ] +[ 23 [0.06262239, 0.1304633125] ] +[ 24 [0.07395153, 0.14790306] ] +[ 25 [0.08281103, 0.15925198076923075] ] +[ 26 [0.08633331, 0.1598765] ] +[ 27 [0.1190654, 0.21261678571428572] ] +[ 28 [0.1890796, 0.32599931034482754] ] +[ 29 [0.2058494, 0.3430823333333333] ] +[ 30 [0.2209214, 0.3563248387096774] ] +[ 31 [0.2856, 0.44625000000000004] ] +[ 32 [0.3048895, 0.4619537878787878] ] +[ 33 [0.4660682, 0.6835770833333333] ] +[ 34 [0.4830809, 0.6835770833333333] ] +[ 35 [0.4921755, 0.6835770833333333] ] +[ 36 [0.5319453, 0.718845] ] +[ 37 [0.575155, 0.7414352564102564] ] +[ 38 [0.5783195, 0.7414352564102564] ] +[ 39 [0.6185894, 0.7626062790697675] ] +[ 40 [0.636362, 0.7626062790697675] ] +[ 41 [0.6448587, 0.7626062790697675] ] +[ 42 [0.6558414, 0.7626062790697675] ] +[ 43 [0.6885884, 0.7824868181818182] ] +[ 44 [0.7189864, 0.7988737777777778] ] +[ 45 [0.8179539, 0.8802645744680851] ] +[ 46 [0.8274487, 0.8802645744680851] ] +[ 47 [0.89713, 0.9304775510204082] ] +[ 48 [0.911868, 0.9304775510204082] ] +[ 49 [0.943789, 0.943789] ] + +element-id average RPKM group A(AC) average RPKM group B(AC) average log2_RPKM group A(AC) average log2_RPKM group B(AC) average count group A average count group B +[ id-1 [0.9980229893624166, 0.49866456701631834, -0.0028550466022277347, -1.003858400017376, 0.0, 0.0] ] + +truncated fdr=3.53108e-05 original=3.53108e-05 +truncated fdr=0.00128842 original=0.00128842 +truncated fdr=0.00128842 original=0.00128842 +truncated fdr=0.00284140 original=0.00284140 +truncated fdr=0.00284140 original=0.00284140 +truncated fdr=0.00284140 original=0.00284140 +truncated fdr=0.00284140 original=0.00284140 +truncated fdr=0.00294094 original=0.00294094 +truncated fdr=0.00375760 original=0.00375760 +truncated fdr=0.00569307 original=0.00569307 +truncated fdr=0.00833856 original=0.00833856 +truncated fdr=0.0201744 original=0.0201744 +truncated fdr=0.0379108 original=0.0379108 +truncated fdr=0.0379108 original=0.0379108 +truncated fdr=0.0523700 original=0.0523700 +truncated fdr=0.0622873 original=0.0622873 +truncated fdr=0.0622873 original=0.0622873 +truncated fdr=0.0733761 original=0.0733761 +truncated fdr=0.0742187 original=0.0742187 +truncated fdr=0.0847349 original=0.0847349 +truncated fdr=0.151073 original=0.151073 +truncated fdr=0.335641 original=0.335641 +truncated fdr=0.391390 original=0.391390 +truncated fdr=0.391390 original=0.391390 +truncated fdr=0.443709 original=0.443709 +truncated fdr=0.477756 original=0.477756 +truncated fdr=0.479630 original=0.479630 +truncated fdr=0.637850 original=0.637850 +truncated fdr=0.977998 original=0.977998 +truncated fdr=1.00000 original=1.00000 +truncated fdr=1.00000 original=1.00000 +truncated fdr=1.00000 original=1.00000 +truncated fdr=1.00000 original=1.00000 +[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. +[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. +[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. +[main] INFO org.campagnelab.goby.cli.DoInParallel - Executing on 40 threads. +##fileformat=VCFv4.1 +##Goby=UNKNOWN +##FieldGroupAssociations=CHROM=genomic-coordinate,CHROM=cross-sample-field,POS=genomic-coordinate,POS=cross-sample-field,ID=external-identifiers,ID=cross-sample-field,REF=cross-sample-field,ALT=cross-sample-field,QUAL=cross-sample-field,FILTER=cross-sample-field,INFO=cross-sample-field,INFO/p-value1=cross-sample-field,INFO/p-value1=p-value,INFO/p-value2=cross-sample-field,INFO/p-value2=p-value,INFO/#Cm_Group[Group_1]=cross-sample-field,INFO/#Cm_Group[Group_1]=#Cm,FORMAT/Zygosity=zygozity,FORMAT/Zygosity=sample-data,FORMAT/Another=another,FORMAT/Another=sample-data, +##INFO= +##INFO= +##INFO= +##FORMAT= +##FORMAT= +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT SampleA SampleB + +Creating base test directory: test-results/stats-writer +allele: A ref: [CC] alt: [T]Creating base test directory: test-results/stats +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - registering user defined contexts: [CpG] +[main] INFO org.campagnelab.goby.stats.EmpiricalPValueEstimator - Setting statistic from dynamic option: ptest +[main] INFO org.campagnelab.goby.stats.AnnotationAveragingWriter - annotations test-data/vcf-averaging/annotations-1.tsv loaded. +Setting quality threshold to 0.02 +[main] WARN org.campagnelab.goby.alignments.BufferedSortingAlignmentWriter - Local sorting strategy failed to restore sort order. The destination has been marked as unsorted. You must sort the output manually to improve compression. +Processing queryIndex=8 with description '8 perfect start of ref' +Processing queryIndex=9 with description '9 perfect start of ref reverse strand' +Processing queryIndex=18 with description '18 mismatch at end x1, starting at -1' +Processing queryIndex=19 with description '19 mismatch at end x2, starting at -1' +Processing queryIndex=20 with description '20 mismatch at end x5, starting at -1' +Processing queryIndex=21 with description '21 mismatch at end x1, starting at -2' +Processing queryIndex=22 with description '22 mismatch at end x2, starting at -2' +Processing queryIndex=23 with description '23 mismatch at end x5, starting at -2' +Processing queryIndex=12 with description '12 mismatch at beginning x1, starting at 1, with mutation at 20' +Processing queryIndex=13 with description '13 mismatch at beginning x2, starting at 1, with mutation at 20' +Processing queryIndex=15 with description '15 mismatch at beginning x1, starting at 2' +Processing queryIndex=16 with description '16 mismatch at beginning x2, starting at 2' +Processing queryIndex=14 with description '14 mismatch at beginning x5, starting at 1 (pos 4 actually does match), with mutation at 20' +Processing queryIndex=17 with description '17 mismatch at beginning x5, starting at 2 (pos 4 actually does match)' +Processing queryIndex=0 with description '0 perfect match' +Processing queryIndex=1 with description '1 perfect match on reverse strand' +Processing queryIndex=2 with description '2 mutation' +Processing queryIndex=3 with description '3 mutation on reverse strand' +Processing queryIndex=4 with description '4 insertion' +Processing queryIndex=6 with description '6 deletion' +Processing queryIndex=7 with description '7 deletion on reverse strand' +Processing queryIndex=27 with description '27 padding left & right, deletion then mutation' +Processing queryIndex=24 with description '24 padding left & right, mutation, deletion' +Processing queryIndex=5 with description '5 insertion on reverse strand' +Processing queryIndex=10 with description '10 perfect end of ref' +Processing queryIndex=11 with description '11 perfect end of ref reverse strand' +07:22:20.829 WARN MessageChunksWriter - Using chunk-size=1 +07:22:20.834 WARN MessageChunksWriter - Using chunk-size=1 +07:22:20.839 WARN MessageChunksWriter - Using chunk-size=1 +07:22:20.889 WARN MessageChunksWriter - Using chunk-size=1 +read =CTCCAGAACTGTAAGATAATAAGTTGGTGTTGTTTT +expected =TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT +recons. ref=TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT +read =TTTCCCACATTTCCCATCACCACTACTACGGATACAGAACGGGG +expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG +recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG +read =TTTCCCAAATTTCACATCACTACTACACGGATACAGAACGGGG +expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG +recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG +read =TAAAACCTAAAAAAAAAAAAAAACCCC +expected =TAAAA--TAAAAAAAAAAAAAAACCCC +recons. ref=TAAAA--TAAAAAAAAAAAAAAACCCC +read =TTTTGATGAAGTCTCTGTGTCCTGGGGCATCAATGATGGTCACA +expected =TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA +recons. ref=TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA +read =TTTCCCAAATTTCACATCACTACACTACGGATACAGAACGGGG +expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG +recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG +read =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTATCTTTTT +expected =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT +recons. ref=CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT query_index: 0 target_index: 0 -position: 14977972 -score: 780.0 +position: 0 +query_position: 0 matching_reverse_strand: false -multiplicity: 1 -number_of_mismatches: 1 -number_of_indels: 0 -query_length: 142 -query_aligned_length: 134 -target_aligned_length: 134 +query_length: 75 +query_aligned_length: 75 +target_aligned_length: 75 +mapping_quality: 255 +pair_flags: 0 +fragment_index: 0 +ambiguity: 1 + +query_index: 1 +target_index: 0 +position: 1 +query_position: 0 +matching_reverse_strand: false +query_length: 75 +query_aligned_length: 75 +target_aligned_length: 75 +mapping_quality: 255 +pair_flags: 0 +fragment_index: 0 +ambiguity: 1 + +07:22:20.899 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.901 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.907 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.909 WARN MessageChunksWriter - Using chunk-size=1000 +0 +23 +07:22:20.922 WARN MessageChunksWriter - Using chunk-size=1000 + +07:22:20.925 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.926 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.927 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.931 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.933 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.934 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.940 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.940 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.941 WARN MessageChunksWriter - Using chunk-size=1000 +entry.position(): 1 +entry.position(): 2 +entry.position(): 3 +entry.position(): 5 +entry.position(): 6 +entry.position(): 7 +entry.position(): 8 +entry.position(): 9 +entry.position(): 10 +entry.position(): 10 +entry.position(): 12 +entry.position(): 99 +07:22:20.947 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.948 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.949 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.956 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.957 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.958 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.960 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-1.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-1.tmh does not exist). Assuming no queries have too many hits. +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-1 +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-1 +07:22:20.961 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-2.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-2.tmh does not exist). Assuming no queries have too many hits. +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-2 +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-2 +07:22:20.962 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-3.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-3.tmh does not exist). Assuming no queries have too many hits. +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-3 +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-3 +07:22:20.964 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.965 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.966 WARN MessageChunksWriter - Using chunk-size=1000 +entry:query_index: 0 +target_index: 0 +position: 5 +score: 5.0 +matching_reverse_strand: false +query_length: 20 +query_aligned_length: 20 +target_aligned_length: 20 +sequence_variations { + to: "CTAG" + from: "----" + position: 10 + read_index: 10 +} + +entry:query_index: 1 +target_index: 0 +position: 5 +matching_reverse_strand: false +query_length: 20 +query_aligned_length: 20 +target_aligned_length: 20 +sequence_variations { + to: "CTAG" + from: "----" + position: 10 + to_quality: "((((" + read_index: 10 +} + +entry: query_index: 0 +target_index: 0 +position: 0 +matching_reverse_strand: false +query_length: 10 +query_aligned_length: 10 +sequence_variations { + to: "AAA" + from: "---" + position: 3 + read_index: 3 +} + +processing entry on target 0 at position 0 +processing entry on target 0 at position 5 +processing entry on target 1 at position 0 +processing entry on target 1 at position 5 +processing entry on target 4 at position 0 +processing entry on target 4 at position 5 +entry:query_index: 0 +target_index: 0 +position: 10 +matching_reverse_strand: false +query_length: 50 +query_aligned_length: 50 +sequence_variations { + to: "AAA" + from: "---" + position: 20 + read_index: 20 +} + +entry:query_index: 1 +target_index: 0 +position: 1 +matching_reverse_strand: false +query_length: 50 +query_aligned_length: 50 sequence_variations { to: "T" from: "A" - position: 6 - to_quality: "/" - read_index: 14 + position: 20 + read_index: 20 } -fragment_index: 0 -query_index_occurrences: 2 -ambiguity: 1 -Processing test-data/sample-qual-scores/30reads.fa -Processed 0 read entries. -Min quality score: 2147483647 -Max quality score: -2147483648 -Avg quality score: 0 -Probable quality encoding scheme: fasta -Processing test-data/sample-qual-scores/30reads.fq -Processed 30 read entries. -Min quality score: 69 -Max quality score: 98 -Avg quality score: 94 -Probable quality encoding scheme: Illumina/Solexa -TTC[27]->CGT[27] / qual=1:2:3 -A[15]->G[20] / qual=20 -A[15]->G[20] / qual=20 -Setting quality threshold to 0.02 -11:37:15.397 WARN MessageChunksWriter - Using chunk-size=1 -11:37:15.402 WARN MessageChunksWriter - Using chunk-size=1 -11:37:15.408 WARN MessageChunksWriter - Using chunk-size=1 -11:37:15.414 WARN MessageChunksWriter - Using chunk-size=1 -[main] WARN org.campagnelab.goby.alignments.BufferedSortingAlignmentWriter - Local sorting strategy failed to restore sort order. The destination has been marked as unsorted. You must sort the output manually to improve compression. -11:37:15.435 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.439 WARN MessageChunksWriter - Using chunk-size=1000 -entry: score=30.0000 readOriginIndex=0 -entry: score=30.0000 readOriginIndex=0 -entry: score=50.0000 readOriginIndex=3 -entry: score=50.0000 readOriginIndex=3 -entry: score=50.0000 readOriginIndex=3 -Scanned 5 entries -11:37:15.445 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.447 WARN MessageChunksWriter - Using chunk-size=1000 -entry: score=30.0000 readOriginIndex=0 -entry: score=30.0000 readOriginIndex=0 -Scanned 2 entries -11:37:15.453 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.456 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.462 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.464 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.469 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.472 WARN MessageChunksWriter - Using chunk-size=1000 -0 -2 -11:37:15.480 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.483 WARN MessageChunksWriter - Using chunk-size=1000 -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-101 -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-101 -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-102 -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-102 -11:37:15.493 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.497 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.506 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.511 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.522 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.540 WARN MessageChunksWriter - Using chunk-size=1000 -entry: score=50.0000 readOriginIndex=3 -entry: score=50.0000 readOriginIndex=3 -entry: score=50.0000 readOriginIndex=3 -entry: score=30.0000 readOriginIndex=0 -entry: score=30.0000 readOriginIndex=0 -Scanned 5 entries -11:37:15.582 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.654 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.655 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.881 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:20.986 WARN MessageChunksWriter - Using chunk-size=2 +Total logical entries written: 0 +Total bytes written: 31 +Average bytes/logical entry: Infinity +Min query index: 2147483647 +Max query index: -2147483648 +Number of queries: 2 +Number of targets: 0 +97 +07:22:20.991 WARN MessageChunksWriter - Using chunk-size=2 +Total logical entries written: 6 +Total bytes written: 162 +Average bytes/logical entry: 27.0 +Min query index: 0 +Max query index: 0 +Number of queries: 1 +Number of targets: 3 +07:22:20.996 WARN MessageChunksWriter - Using chunk-size=2 +Total logical entries written: 6 +Total bytes written: 162 +Average bytes/logical entry: 27.0 +Min query index: 0 +Max query index: 0 +Number of queries: 1 +Number of targets: 3 +07:22:20.999 WARN MessageChunksWriter - Using chunk-size=2 +Total logical entries written: 6 +Total bytes written: 162 +Average bytes/logical entry: 27.0 +Min query index: 0 +Max query index: 0 +Number of queries: 1 +Number of targets: 3 +07:22:21.002 WARN MessageChunksWriter - Using chunk-size=2 +Total logical entries written: 6 +Total bytes written: 162 +Average bytes/logical entry: 27.0 +Min query index: 0 +Max query index: 0 +Number of queries: 1 +Number of targets: 3 +07:22:21.006 WARN MessageChunksWriter - Using chunk-size=1000 +Total logical entries written: 20000 +Total bytes written: 77210 +Average bytes/logical entry: 3.8605 +Min query index: 0 +Max query index: 1999 +Number of queries: 2000 +Number of targets: 10 +07:22:21.078 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.104 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.105 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.129 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:15.912 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.913 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:15.922 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.153 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.154 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.160 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.180 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.181 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass -11:37:15.961 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.181 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 3ms; used/avail/free/total/max mem: 240.28M/20.85G/548.25M/788.53M/21.09G -11:37:15.969 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 230.33M/20.86G/1.03G/1.26G/21.09G +07:22:21.187 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 @@ -4961,36 +5870,36 @@ multiplicity: 1 query_length: 35 -11:37:16.016 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.021 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.217 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.221 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.250 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass -11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.066 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.251 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item] +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 290.59M/20.80G/497.94M/788.53M/21.09G -11:37:16.071 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.093 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.139 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.167 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.169 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.196 WARN MessageChunksWriter - Using chunk-size=1000 +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 280.66M/20.81G/977.63M/1.26G/21.09G +07:22:21.254 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.268 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.295 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.318 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.320 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.343 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:16.221 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.223 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.366 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.367 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item]; used/avail/free/total/max mem: 381.39M/20.71G/407.14M/788.53M/21.09G +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [2 items, 2,000.00 items/s, 500.00 ?s/item]; used/avail/free/total/max mem: 373.19M/20.72G/885.11M/1.26G/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 @@ -5119,25 +6028,25 @@ multiplicity: 1 query_length: 35 -11:37:16.325 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.355 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.357 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.381 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.446 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.469 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.470 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.493 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:16.406 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.407 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.409 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. -11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.516 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.517 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.519 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.524 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.524 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass -11:37:16.415 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. +07:22:21.524 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 440.74M/20.65G/347.79M/788.53M/21.09G -11:37:16.418 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 431.66M/20.66G/826.64M/1.26G/21.09G +07:22:21.526 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/transcript-101.tmh has no 'too many hits' information (test-results/alignments/merge/transcript-101.tmh does not exist). Assuming no queries have too many hits. notBestScoreCount=16.6667 % geneAmbiguityCount=33.3333 % found entry: query_index: 0 target_index: 1 @@ -5163,64 +6072,64 @@ multiplicity: 1 query_length: 35 -11:37:16.424 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.450 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.451 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.480 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.531 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.554 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.554 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.577 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:16.508 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.509 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.512 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.513 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. -11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. -11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.600 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.601 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.603 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.604 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass -11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.516 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.607 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 467.37M/20.62G/321.16M/788.53M/21.09G -11:37:16.518 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.520 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. -11:37:16.525 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.558 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.559 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.594 WARN MessageChunksWriter - Using chunk-size=1000 +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 456.82M/20.63G/801.47M/1.26G/21.09G +07:22:21.610 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.611 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.615 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.639 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.640 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.663 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:16.629 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.630 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.685 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.686 WARN MessageChunksWriter - Using chunk-size=1000 Finding max number of reads... Found input file with 2 target(s) -11:37:16.633 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.688 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. Found input file with 2 target(s) -11:37:16.634 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.689 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. ... max number of reads was 10 First pass: determine which reads should be kept in the merged alignment. Scanning align-105 Scanning align-106 Found 40 logical alignment entries. Prepare merged too many hits information. -11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. -11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.691 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass -11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.638 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.692 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 492.80M/20.60G/295.73M/788.53M/21.09G +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 481.99M/20.61G/776.30M/1.26G/21.09G Second pass: writing the merged alignment. -11:37:16.642 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.644 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. +07:22:21.694 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.696 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-106.tmh has no 'too many hits' information (test-results/alignments/merge/align-106.tmh does not exist). Assuming no queries have too many hits. Wrote 20 skipped: 20 50.000000% too many hits 0.000000% notBestScore: 50.000000% Total logical entries written: 20 Total bytes written: 0 @@ -5230,25 +6139,25 @@ Number of queries: 10 Number of targets: 4 Percent aligned: 100.0 -11:37:16.648 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.691 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.692 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.716 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.699 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.722 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.723 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.746 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:16.740 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.742 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.744 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. -11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.768 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.769 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.771 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.772 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.772 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass -11:37:16.746 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +07:22:21.772 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [1 items, ? items/s, 0.00 ns/item] +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms [1 items, 1,000.00 items/s, 1.00 ms/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 518.57M/20.57G/269.95M/788.53M/21.09G -11:37:16.749 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 507.15M/20.58G/751.14M/1.26G/21.09G +07:22:21.775 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-105.tmh has no 'too many hits' information (test-results/alignments/merge/align-105.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1 position: 11 @@ -5329,19 +6238,19 @@ multiplicity: 1 query_length: 35 -11:37:16.753 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.838 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.843 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.878 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.778 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.801 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.802 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.825 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:16.922 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:16.935 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.848 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.849 WARN MessageChunksWriter - Using chunk-size=1000 [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 5ms [2 items, 500.00 items/s, 2.00 ms/item]; used/avail/free/total/max mem: 575.80M/20.51G/212.73M/788.53M/21.09G +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item]; used/avail/free/total/max mem: 565.87M/20.52G/692.42M/1.26G/21.09G found entry: query_index: 2 target_index: 1999 position: 19993 @@ -5470,30 +6379,30 @@ multiplicity: 1 query_length: 35 -11:37:17.044 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.071 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.072 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.098 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.931 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.954 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.954 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:21.978 WARN MessageChunksWriter - Using chunk-size=1000 preparing 105 -11:37:17.123 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.135 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.138 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:17.141 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:17.167 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.001 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.002 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.005 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.007 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - TMH third pass -11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:17.168 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.033 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. [main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms [2 items, ? items/s, 0.00 ns/item] [main] INFO org.campagnelab.goby.alignments.Merge - TMH fourth pass Warning: could not find depth/max-length-of-match in too many hits information. [main] INFO org.campagnelab.goby.alignments.Merge - Completed. -[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 1ms; used/avail/free/total/max mem: 217.33M/20.87G/571.20M/788.53M/21.09G -11:37:17.171 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. -11:37:17.186 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +[main] INFO org.campagnelab.goby.alignments.Merge - Elapsed: 2ms; used/avail/free/total/max mem: 658.15M/20.43G/600.14M/1.26G/21.09G +07:22:22.036 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. +07:22:22.049 INFO AlignmentTooManyHitsReader - basename test-results/alignments/merge/align-101.tmh has no 'too many hits' information (test-results/alignments/merge/align-101.tmh does not exist). Assuming no queries have too many hits. found entry: query_index: 0 target_index: 1999 position: 19991 @@ -5654,7 +6563,46 @@ multiplicity: 1 query_length: 35 -11:37:17.219 WARN MessageChunksWriter - Using chunk-size=2 +07:22:22.077 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.079 WARN MessageChunksWriter - Using chunk-size=1000 +entry: score=30.0000 readOriginIndex=0 +entry: score=30.0000 readOriginIndex=0 +entry: score=50.0000 readOriginIndex=3 +entry: score=50.0000 readOriginIndex=3 +entry: score=50.0000 readOriginIndex=3 +Scanned 5 entries +07:22:22.084 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.085 WARN MessageChunksWriter - Using chunk-size=1000 +entry: score=30.0000 readOriginIndex=0 +entry: score=30.0000 readOriginIndex=0 +Scanned 2 entries +07:22:22.088 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.089 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.093 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.094 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.098 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.099 WARN MessageChunksWriter - Using chunk-size=1000 +0 +2 +07:22:22.103 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.104 WARN MessageChunksWriter - Using chunk-size=1000 +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-101 +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-101 +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/alignments/concat/concat-align-102 +[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/alignments/concat/concat-align-102 +07:22:22.108 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.109 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.114 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.115 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.118 WARN MessageChunksWriter - Using chunk-size=1000 +07:22:22.119 WARN MessageChunksWriter - Using chunk-size=1000 +entry: score=50.0000 readOriginIndex=3 +entry: score=50.0000 readOriginIndex=3 +entry: score=50.0000 readOriginIndex=3 +entry: score=30.0000 readOriginIndex=0 +entry: score=30.0000 readOriginIndex=0 +Scanned 5 entries +07:22:22.125 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 @@ -5662,7 +6610,7 @@ Max query index: 0 Number of queries: 1 Number of targets: 3 -11:37:17.222 WARN MessageChunksWriter - Using chunk-size=2 +07:22:22.128 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 @@ -5670,7 +6618,7 @@ Max query index: 0 Number of queries: 1 Number of targets: 3 -11:37:17.225 WARN MessageChunksWriter - Using chunk-size=2 +07:22:22.130 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 @@ -5678,7 +6626,7 @@ Max query index: 0 Number of queries: 1 Number of targets: 3 -11:37:17.228 WARN MessageChunksWriter - Using chunk-size=2 +07:22:22.133 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 @@ -5686,7 +6634,7 @@ Max query index: 0 Number of queries: 1 Number of targets: 3 -11:37:17.231 WARN MessageChunksWriter - Using chunk-size=2 +07:22:22.136 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 @@ -5694,7 +6642,7 @@ Max query index: 0 Number of queries: 1 Number of targets: 3 -11:37:17.233 WARN MessageChunksWriter - Using chunk-size=2 +07:22:22.138 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 @@ -5702,7 +6650,7 @@ Max query index: 0 Number of queries: 1 Number of targets: 3 -11:37:17.236 WARN MessageChunksWriter - Using chunk-size=2 +07:22:22.141 WARN MessageChunksWriter - Using chunk-size=2 Total logical entries written: 7 Total bytes written: 219 Average bytes/logical entry: 31.285715 @@ -5710,947 +6658,11 @@ Max query index: 0 Number of queries: 1 Number of targets: 3 -Processing queryIndex=8 with description '8 perfect start of ref' -Processing queryIndex=9 with description '9 perfect start of ref reverse strand' -Processing queryIndex=18 with description '18 mismatch at end x1, starting at -1' -Processing queryIndex=19 with description '19 mismatch at end x2, starting at -1' -Processing queryIndex=20 with description '20 mismatch at end x5, starting at -1' -Processing queryIndex=21 with description '21 mismatch at end x1, starting at -2' -Processing queryIndex=22 with description '22 mismatch at end x2, starting at -2' -Processing queryIndex=23 with description '23 mismatch at end x5, starting at -2' -Processing queryIndex=12 with description '12 mismatch at beginning x1, starting at 1, with mutation at 20' -Processing queryIndex=13 with description '13 mismatch at beginning x2, starting at 1, with mutation at 20' -Processing queryIndex=15 with description '15 mismatch at beginning x1, starting at 2' -Processing queryIndex=16 with description '16 mismatch at beginning x2, starting at 2' -Processing queryIndex=14 with description '14 mismatch at beginning x5, starting at 1 (pos 4 actually does match), with mutation at 20' -Processing queryIndex=17 with description '17 mismatch at beginning x5, starting at 2 (pos 4 actually does match)' -Processing queryIndex=0 with description '0 perfect match' -Processing queryIndex=1 with description '1 perfect match on reverse strand' -Processing queryIndex=2 with description '2 mutation' -Processing queryIndex=3 with description '3 mutation on reverse strand' -Processing queryIndex=4 with description '4 insertion' -Processing queryIndex=6 with description '6 deletion' -Processing queryIndex=7 with description '7 deletion on reverse strand' -Processing queryIndex=27 with description '27 padding left & right, deletion then mutation' -Processing queryIndex=24 with description '24 padding left & right, mutation, deletion' -Processing queryIndex=5 with description '5 insertion on reverse strand' -Processing queryIndex=10 with description '10 perfect end of ref' -Processing queryIndex=11 with description '11 perfect end of ref reverse strand' -query_index: 0 -target_index: 0 -position: 0 -query_position: 0 -matching_reverse_strand: false -query_length: 75 -query_aligned_length: 75 -target_aligned_length: 75 -mapping_quality: 255 -pair_flags: 0 -fragment_index: 0 -ambiguity: 1 - -query_index: 1 -target_index: 0 -position: 1 -query_position: 0 -matching_reverse_strand: false -query_length: 75 -query_aligned_length: 75 -target_aligned_length: 75 -mapping_quality: 255 -pair_flags: 0 -fragment_index: 0 -ambiguity: 1 - -entry:query_index: 0 -target_index: 0 -position: 5 -score: 5.0 -matching_reverse_strand: false -query_length: 20 -query_aligned_length: 20 -target_aligned_length: 20 -sequence_variations { - to: "CTAG" - from: "----" - position: 10 - read_index: 10 -} - -entry:query_index: 1 -target_index: 0 -position: 5 -matching_reverse_strand: false -query_length: 20 -query_aligned_length: 20 -target_aligned_length: 20 -sequence_variations { - to: "CTAG" - from: "----" - position: 10 - to_quality: "((((" - read_index: 10 -} - -entry: query_index: 0 -target_index: 0 -position: 0 -matching_reverse_strand: false -query_length: 10 -query_aligned_length: 10 -sequence_variations { - to: "AAA" - from: "---" - position: 3 - read_index: 3 -} - -processing entry on target 0 at position 0 -processing entry on target 0 at position 5 -processing entry on target 1 at position 0 -processing entry on target 1 at position 5 -processing entry on target 4 at position 0 -processing entry on target 4 at position 5 -entry:query_index: 0 -target_index: 0 -position: 10 -matching_reverse_strand: false -query_length: 50 -query_aligned_length: 50 -sequence_variations { - to: "AAA" - from: "---" - position: 20 - read_index: 20 -} - -entry:query_index: 1 -target_index: 0 -position: 1 -matching_reverse_strand: false -query_length: 50 -query_aligned_length: 50 -sequence_variations { - to: "T" - from: "A" - position: 20 - read_index: 20 -} - -11:37:17.396 WARN MessageChunksWriter - Using chunk-size=1000 - -11:37:17.400 WARN MessageChunksWriter - Using chunk-size=1000 -Total logical entries written: 20000 -Total bytes written: 77210 -Average bytes/logical entry: 3.8605 -Min query index: 0 -Max query index: 1999 -Number of queries: 2000 -Number of targets: 10 -11:37:17.493 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.495 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.506 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.509 WARN MessageChunksWriter - Using chunk-size=1000 -0 -23 -11:37:17.525 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.527 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.529 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.537 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.538 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.539 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.547 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.549 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.550 WARN MessageChunksWriter - Using chunk-size=1000 -entry.position(): 1 -entry.position(): 2 -entry.position(): 3 -entry.position(): 5 -entry.position(): 6 -entry.position(): 7 -entry.position(): 8 -entry.position(): 9 -entry.position(): 10 -entry.position(): 10 -entry.position(): 12 -entry.position(): 99 -11:37:17.557 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.558 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.559 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.566 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.567 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.569 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.571 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-1.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-1.tmh does not exist). Assuming no queries have too many hits. -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-1 -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-1 -11:37:17.572 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-2.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-2.tmh does not exist). Assuming no queries have too many hits. -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-2 -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-2 -11:37:17.573 INFO AlignmentTooManyHitsReader - basename test-results/sort-concat/sort-concat-3.tmh has no 'too many hits' information (test-results/sort-concat/sort-concat-3.tmh does not exist). Assuming no queries have too many hits. -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - start reading TMH for test-results/sort-concat/sort-concat-3 -[main] INFO org.campagnelab.goby.alignments.NonAmbiguousAlignmentReader - done reading TMH for test-results/sort-concat/sort-concat-3 -11:37:17.577 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.578 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.579 WARN MessageChunksWriter - Using chunk-size=1000 -11:37:17.695 WARN MessageChunksWriter - Using chunk-size=2 -Total logical entries written: 0 -Total bytes written: 31 -Average bytes/logical entry: Infinity -Min query index: 2147483647 -Max query index: -2147483648 -Number of queries: 2 -Number of targets: 0 -97 -11:37:17.703 WARN MessageChunksWriter - Using chunk-size=2 -Total logical entries written: 6 -Total bytes written: 162 -Average bytes/logical entry: 27.0 -Min query index: 0 -Max query index: 0 -Number of queries: 1 -Number of targets: 3 -11:37:17.709 WARN MessageChunksWriter - Using chunk-size=2 -Total logical entries written: 6 -Total bytes written: 162 -Average bytes/logical entry: 27.0 -Min query index: 0 -Max query index: 0 -Number of queries: 1 -Number of targets: 3 -11:37:17.712 WARN MessageChunksWriter - Using chunk-size=2 -Total logical entries written: 6 -Total bytes written: 162 -Average bytes/logical entry: 27.0 -Min query index: 0 -Max query index: 0 -Number of queries: 1 -Number of targets: 3 -11:37:17.715 WARN MessageChunksWriter - Using chunk-size=2 -Total logical entries written: 6 -Total bytes written: 162 -Average bytes/logical entry: 27.0 -Min query index: 0 -Max query index: 0 -Number of queries: 1 -Number of targets: 3 -read =CTCCAGAACTGTAAGATAATAAGTTGGTGTTGTTTT -expected =TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT -recons. ref=TTCCAGAACTGTAAGATAATAAGTTTGTGTTGTTTT -read =TTTCCCACATTTCCCATCACCACTACTACGGATACAGAACGGGG -expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG -recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG -read =TTTCCCAAATTTCACATCACTACTACACGGATACAGAACGGGG -expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG -recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG -read =TAAAACCTAAAAAAAAAAAAAAACCCC -expected =TAAAA--TAAAAAAAAAAAAAAACCCC -recons. ref=TAAAA--TAAAAAAAAAAAAAAACCCC -read =TTTTGATGAAGTCTCTGTGTCCTGGGGCATCAATGATGGTCACA -expected =TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA -recons. ref=TTTTGACGAAGTCTCTATGTCCT-GGGCATCAATGATGGTCACA -read =TTTCCCAAATTTCACATCACTACACTACGGATACAGAACGGGG -expected =TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG -recons. ref=TTTCCCAAATTTCACATCACTACTACTACGGATACAGAACGGGG -read =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTATCTTTTT -expected =CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT -recons. ref=CCATGACCAACATAACTGTGGTGTCATGCATTTGGTAT-TTTTAAT -Total logical entries written: 1 -Total bytes written: 0 -Average bytes/logical entry: 0.0 -Min query index: 0 -Max query index: 0 -Number of queries: 1 -Number of targets: 45 -field CHROM value: 0 -field POS value: 145497099 -field ID value: . -field REF value: A -field ALT value: G -field QUAL value: 17.1 -field FILTER value: . -field INFO[DP] value: 2 -field INFO[DP4] value: 0,0,2,0 -field INFO[MQ] value: 25 -field INFO[FQ] value: -30.8 -field INFO[AF1] value: 0.9999 -field INFO[CI95] value: 0.5,1 -field INFO[PV4] value: -field INFO[INDEL] value: INDEL -field INFO[PC2] value: 3,3 -field INFO[PCHI2] value: 0.752 -field INFO[QCHI2] value: 1 -field INFO[RP] value: -field FORMAT[GT] value: -field FORMAT[GQ] value: -field FORMAT[GL] value: -field FORMAT[DP] value: -field FORMAT[SP] value: -field FORMAT[PL] value: -field results/IPBKRNW/IPBKRNW-replicate.bam[GT] value: 1/1 -field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] value: 42 -field results/IPBKRNW/IPBKRNW-replicate.bam[GL] value: -field results/IPBKRNW/IPBKRNW-replicate.bam[DP] value: -field results/IPBKRNW/IPBKRNW-replicate.bam[SP] value: -field results/IPBKRNW/IPBKRNW-replicate.bam[PL] value: 25,3,0 -field results/IPBKRNW/IPBKRNW-sorted.bam[GT] value: 1/1 -field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] value: 42 -field results/IPBKRNW/IPBKRNW-sorted.bam[GL] value: -field results/IPBKRNW/IPBKRNW-sorted.bam[DP] value: -field results/IPBKRNW/IPBKRNW-sorted.bam[SP] value: -field results/IPBKRNW/IPBKRNW-sorted.bam[PL] value: 25,3,0 -field CHROM gfi:0 value: 0 -field POS gfi:1 value: 145497099 -field ID gfi:2 value: . -field REF gfi:3 value: A -field ALT gfi:4 value: G -field QUAL gfi:5 value: 17.1 -field FILTER gfi:6 value: . -field FORMAT[GT] gfi:7 value: -field FORMAT[GQ] gfi:8 value: -field FORMAT[GL] gfi:9 value: -field FORMAT[DP] gfi:10 value: -field FORMAT[SP] gfi:11 value: -field FORMAT[PL] gfi:12 value: -field results/IPBKRNW/IPBKRNW-replicate.bam[GT] gfi:13 value: 1/1 -field results/IPBKRNW/IPBKRNW-replicate.bam[GQ] gfi:14 value: 11 -field results/IPBKRNW/IPBKRNW-replicate.bam[GL] gfi:15 value: -field results/IPBKRNW/IPBKRNW-replicate.bam[DP] gfi:16 value: -field results/IPBKRNW/IPBKRNW-replicate.bam[SP] gfi:17 value: -field results/IPBKRNW/IPBKRNW-replicate.bam[PL] gfi:18 value: 015,4,0 -field results/IPBKRNW/IPBKRNW-sorted.bam[GT] gfi:19 value: 1/1 -field results/IPBKRNW/IPBKRNW-sorted.bam[GQ] gfi:20 value: 42 -field results/IPBKRNW/IPBKRNW-sorted.bam[GL] gfi:21 value: -field results/IPBKRNW/IPBKRNW-sorted.bam[DP] gfi:22 value: -field results/IPBKRNW/IPBKRNW-sorted.bam[SP] gfi:23 value: -field results/IPBKRNW/IPBKRNW-sorted.bam[PL] gfi:24 value: 25,3,0 -[ {N:15} {///////////00//0010} {N:15} {00101111001101100101111101111111/0/} |Encoded in 80 bits -[ {N:15} {11111111111001100101100011111001011110011011001011111011111111} {0} {1} {1} {1} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->29 {N:15} {00101111001101100101111101111111101110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->74decoding: 0 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 1 -decoding: 2 -decoding: 3 -decoding: 4 -decoding: 3 -decoding: 1 -decoding: 2 -decoding: 1 -decoding: 2 -decoding: 3 -decoding: 1 -decoding: 2 -decoding: 1 -decoding: 2 -decoding: 1 -[ {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {0} {1} {0} {0} {1} {1} {1} {0} {0} {0} {1} {0} {1} {0} {0} {1} {0} {0} {0} {1} {1} {0} {1} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {1} {1} {0} {1} {0} {0} {1} {0} {0} {1} |Encoded in 72 bits -[ {00110011001100100011001001110001010010001101010110100101101001} {0} {0}decoding: 0 - {1} {0}decoding: 4 - {0} {0}decoding: 4 - {0} {0}decoding: 4 - {0}decoding: 4 - {0}decoding: 4 - {0}decoding: 4 -decoding: 4 - {0}decoding: 4 - {0}decoding: 4 -decoding: 4 - {0}decoding: 4 -decoding: 4 - {0}decoding: 4 -decoding: 4 - {0} {0} {0} {0} {0}decoding: 1 - {0} {0} {0} {0}decoding: 2 - {0} {0} {0} {0} {0}decoding: 3 -decoding: 4 - {0} {0} {0} {0}decoding: 3 - {0} {0} {0}decoding: 1 - {0} {0} {0} {0}decoding: 2 - {0} {0} {0}decoding: 1 - {0} {0} {0}decoding: 2 - {0} {0} {0} {0}decoding: 3 - {0} {0} {0}decoding: 1 - {0} {0} {0}decoding: 2 - {0} {0}decoding: 1 - {0} {0} {0}decoding: 2 - {0} {0}decoding: 1 -[ {N:2} {0010} {N:5} {011111} {N:5} {/0/00///01} {N:3} {//0/0/} {N:15} {///////////00//0010} |Encoded in 80 bits -[ {N:2} {00101111010111111111011010011101111011110101110001111111111111} {1} {1} {1} {0} {0} {1} {1} | ->10 {N:5} {01111111110110100111011110111101011100011111111111111110011001} {0} {1} {1} {0} {0} {0} {0} {0} {0} | ->22 {N:5} {10100111011110111101011100011111111111111110011001011000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->38 {N:3} {11010111000111111111111111100110010110000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->50 {N:15} {11111111111001100101100000000000000000000000000000000000000000} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} {0} | ->79decoding: 0 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 4 -decoding: 1 -decoding: 2 -decoding: 3 -decoding: 4 -decoding: 3 -decoding: 1 -decoding: 2 -decoding: 1 -decoding: 2 -decoding: 3 -decoding: 1 -decoding: 2 -decoding: 1 -decoding: 2 -decoding: 1 -Total logical entries written: 4 -Total bytes written: 0 -Average bytes/logical entry: 0.0 -Min query index: 1 -Max query index: 1 -Number of queries: 1 -Number of targets: 2 -Total logical entries written: 4 -Total bytes written: 62 -Average bytes/logical entry: 15.5 -Min query index: 1 -Max query index: 1 -Number of queries: 1 -Number of targets: 2 -Annotations loaded -Annotations loaded -Annotations loaded -Annotations loaded -Annotations loaded -count perbase{0=>0, 13=>0, 11=>2, 3=>2, 5=>3} -count keys [0, 3, 5, 11, 13] --1 0.0 -0 0.0 -1 0.0 -2 0.0 -3 0.0 -4 0.0 -5 0.0 -6 0.0 -7 0.0 -8 0.0 -9 0.0 -10 0.0 -11 0.0 -12 0.0 -13 0.0 -14 0.0 -15 0.0 -16 0.0 -17 0.0 -18 0.0 -19 0.0 -20 0.0 -21 0.0 -22 0.0 -23 0.0 -24 0.0 -25 0.0 -26 0.0 -27 0.0 -28 0.0 -29 0.0 -30 0.0 -overlapping count 3, 4 0.0 -overlapping count 15, 17 0.0 -overlapping count 9, 18 2.0 -overlapping count 3, 8 2.0 -overlapping count 11, 12 0.0 -overlapping count 9, 10 1.0 -overlapping count 8, 9 0.0 -overlapping count 8, 8 0.0 -overlapping count 5, 6 0.0 -overlapping count 3, 3 0.0 -overlapping count 3, 12 5.0 -overlapping count -1, 2 0.0 -overlapping count 0, 45 6.0 -overlapping count 13, 15 0.0 --1 0.0 -0 0.0 -1 0.0 -2 0.0 -3 2.0 -4 2.0 -5 3.0 -6 3.0 -7 3.0 -8 3.0 -9 3.0 -10 3.0 -11 2.0 -12 2.0 -13 0.0 -14 0.0 -15 1.0 -16 1.0 -17 1.0 -18 1.0 -19 0.0 -20 0.0 -21 0.0 -22 0.0 -23 0.0 -24 0.0 -25 0.0 -26 0.0 -27 0.0 -28 0.0 -29 0.0 -30 0.0 -overlapping count 3, 4 2.0 -overlapping count 2, 3 2.0 -overlapping count 3, 8 4.0 -overlapping count 11, 12 2.0 -overlapping count 9, 10 3.0 -overlapping count 8, 9 4.0 -overlapping count 8, 8 3.0 -overlapping count 5, 6 3.0 -overlapping count 3, 3 2.0 -overlapping count 3, 12 5.0 -overlapping count -1, 2 0.0 -overlapping count 0, 45 6.0 -overlapping count 13, 15 1.0 -[main] WARN org.campagnelab.goby.algorithmic.algorithm.EquivalentIndelRegionCalculator - Cannot determine sequence at position 600000000 of reference-index 2 - appending (count=0,length=1) - appending (count=4,length=3) - appending (count=1,length=3) - appending (count=0,length=2) - appending (count=3,length=1) - appending (count=1,length=1) - appending (count=0,length=1) - appending (count=4,length=3) - appending (count=0,length=5) - appending (count=3,length=1) - appending (count=0,length=2) - appending (count=2,length=1) - appending (count=0,length=2) - appending (count=3,length=1) - appending (count=2,length=1) - appending (count=0,length=1) -loading transition for reader[0] position=0 length=1 count=0 -loading transition for reader[1] position=0 length=6 count=1 -(0,1) -loading transition for reader[0] position=1 length=3 count=3 -(0,1)(1,4) -loading transition for reader[0] position=4 length=2 count=0 -(0,1)(1,4)(4,1) -loading transition for reader[0] position=0 length=1 count=0 -loading transition for reader[1] position=0 length=4 count=0 -(0,0) -loading transition for reader[0] position=1 length=1 count=1 -(0,0)(1,1) -loading transition for reader[0] position=2 length=4 count=0 -(0,0)(1,1)(2,0) -loading transition for reader[1] position=4 length=10 count=1 -(0,0)(1,1)(2,0)(4,1) -loading transition for reader[0] position=6 length=2 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2) -loading transition for reader[0] position=8 length=1 count=0 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1) -loading transition for reader[0] position=9 length=1 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) -loading transition for reader[0] position=10 length=2 count=0 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) -loading transition for reader[0] position=12 length=1 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) -loading transition for reader[0] position=13 length=3 count=0 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) -loading transition for reader[0] position=16 length=1 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) -loading transition for reader[0] position=0 length=1 count=0 -loading transition for reader[1] position=0 length=4 count=0 -loading transition for reader[0] position=1 length=1 count=1 -loading transition for reader[0] position=2 length=4 count=0 -loading transition for reader[1] position=4 length=10 count=1 -loading transition for reader[0] position=6 length=2 count=1 -loading transition for reader[0] position=8 length=1 count=0 -loading transition for reader[0] position=9 length=1 count=1 -loading transition for reader[0] position=10 length=2 count=0 -loading transition for reader[0] position=12 length=1 count=1 -loading transition for reader[0] position=13 length=3 count=0 -loading transition for reader[0] position=16 length=1 count=1 -loading transition for reader[0] position=0 length=1 count=0 -loading transition for reader[1] position=0 length=6 count=1 -(0,1) -loading transition for reader[0] position=1 length=3 count=3 -(0,1)(1,4) -loading transition for reader[0] position=4 length=2 count=0 -(0,1)(1,4)(4,1) -loading transition for reader[0] position=0 length=1 count=0 -loading transition for reader[1] position=0 length=4 count=0 -(0,0) -loading transition for reader[0] position=1 length=1 count=1 -(0,0)(1,1) -loading transition for reader[0] position=2 length=4 count=0 -(0,0)(1,1)(2,0) -loading transition for reader[1] position=4 length=10 count=1 -(0,0)(1,1)(2,0)(4,1) -loading transition for reader[0] position=6 length=2 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2) -loading transition for reader[0] position=8 length=1 count=0 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1) -loading transition for reader[0] position=9 length=1 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2) -loading transition for reader[0] position=10 length=2 count=0 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1) -loading transition for reader[0] position=12 length=1 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2) -loading transition for reader[0] position=13 length=3 count=0 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1) -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0) -loading transition for reader[0] position=16 length=1 count=1 -(0,0)(1,1)(2,0)(4,1)(6,2)(8,1)(9,2)(10,1)(12,2)(13,1)(14,0)(16,1) -loading transition for reader[0] position=0 length=1 count=0 -loading transition for reader[1] position=0 length=4 count=0 -loading transition for reader[0] position=1 length=1 count=1 -loading transition for reader[0] position=2 length=4 count=0 -loading transition for reader[1] position=4 length=10 count=1 -loading transition for reader[0] position=6 length=2 count=1 -loading transition for reader[0] position=8 length=1 count=0 -loading transition for reader[0] position=9 length=1 count=1 -loading transition for reader[0] position=10 length=2 count=0 -loading transition for reader[0] position=12 length=1 count=1 -loading transition for reader[0] position=13 length=3 count=0 -loading transition for reader[0] position=16 length=1 count=1 -loading transition for reader[0] position=0 length=1 count=0 -(0,0) -loading transition for reader[0] position=1 length=3 count=1 -(0,0)(1,1) -Appending count: 39901 length: 10 -Appending count: 17289 length: 6 -Appending count: 37817 length: 1 -Appending count: 33709 length: 6 -Appending count: 44089 length: 2 -Appending count: 28866 length: 3 -Appending count: 31179 length: 1 -Appending count: 5042 length: 9 -Appending count: 38546 length: 7 -Appending count: 40217 length: 4 -Appending count: 27078 length: 6 -Appending count: 26550 length: 1 -Appending count: 36152 length: 1 -Appending count: 17051 length: 7 -Appending count: 34867 length: 10 -Appending count: 47667 length: 10 -Appending count: 43469 length: 9 -Appending count: 5683 length: 3 -Appending count: 41404 length: 4 -Appending count: 14249 length: 9 -Appending count: 32710 length: 8 -Appending count: 2641 length: 6 -Appending count: 1505 length: 1 -Appending count: 343 length: 8 -Appending count: 40906 length: 6 -Appending count: 42278 length: 6 -Appending count: 30993 length: 2 -Appending count: 31983 length: 6 -Appending count: 17856 length: 6 -Appending count: 40661 length: 3 - position= 0 count= 39901 - position= 1 count= 39901 - position= 2 count= 39901 - position= 3 count= 39901 - position= 4 count= 39901 - position= 5 count= 39901 - position= 6 count= 39901 - position= 7 count= 39901 - position= 8 count= 39901 - position= 9 count= 39901 - position= 10 count= 17289 - position= 11 count= 17289 - position= 12 count= 17289 - position= 13 count= 17289 - position= 14 count= 17289 - position= 15 count= 17289 - position= 16 count= 37817 - position= 17 count= 33709 - position= 18 count= 33709 - position= 19 count= 33709 - position= 20 count= 33709 - position= 21 count= 33709 - position= 22 count= 33709 - position= 23 count= 44089 - position= 24 count= 44089 - position= 25 count= 28866 - position= 26 count= 28866 - position= 27 count= 28866 - position= 28 count= 31179 - position= 29 count= 5042 - position= 30 count= 5042 - position= 31 count= 5042 - position= 32 count= 5042 - position= 33 count= 5042 - position= 34 count= 5042 - position= 35 count= 5042 - position= 36 count= 5042 - position= 37 count= 5042 - position= 38 count= 38546 - position= 39 count= 38546 - position= 40 count= 38546 - position= 41 count= 38546 - position= 42 count= 38546 - position= 43 count= 38546 - position= 44 count= 38546 - position= 45 count= 40217 - position= 46 count= 40217 - position= 47 count= 40217 - position= 48 count= 40217 - position= 49 count= 27078 - position= 50 count= 27078 - position= 51 count= 27078 - position= 52 count= 27078 - position= 53 count= 27078 - position= 54 count= 27078 - position= 55 count= 26550 - position= 56 count= 36152 - position= 57 count= 17051 - position= 58 count= 17051 - position= 59 count= 17051 - position= 60 count= 17051 - position= 61 count= 17051 - position= 62 count= 17051 - position= 63 count= 17051 - position= 64 count= 34867 - position= 65 count= 34867 - position= 66 count= 34867 - position= 67 count= 34867 - position= 68 count= 34867 - position= 69 count= 34867 - position= 70 count= 34867 - position= 71 count= 34867 - position= 72 count= 34867 - position= 73 count= 34867 - position= 74 count= 47667 - position= 75 count= 47667 - position= 76 count= 47667 - position= 77 count= 47667 - position= 78 count= 47667 - position= 79 count= 47667 - position= 80 count= 47667 - position= 81 count= 47667 - position= 82 count= 47667 - position= 83 count= 47667 - position= 84 count= 43469 - position= 85 count= 43469 - position= 86 count= 43469 - position= 87 count= 43469 - position= 88 count= 43469 - position= 89 count= 43469 - position= 90 count= 43469 - position= 91 count= 43469 - position= 92 count= 43469 - position= 93 count= 5683 - position= 94 count= 5683 - position= 95 count= 5683 - position= 96 count= 41404 - position= 97 count= 41404 - position= 98 count= 41404 - position= 99 count= 41404 - position= 100 count= 14249 - position= 101 count= 14249 - position= 102 count= 14249 - position= 103 count= 14249 - position= 104 count= 14249 - position= 105 count= 14249 - position= 106 count= 14249 - position= 107 count= 14249 - position= 108 count= 14249 - position= 109 count= 32710 - position= 110 count= 32710 - position= 111 count= 32710 - position= 112 count= 32710 - position= 113 count= 32710 - position= 114 count= 32710 - position= 115 count= 32710 - position= 116 count= 32710 - position= 117 count= 2641 - position= 118 count= 2641 - position= 119 count= 2641 - position= 120 count= 2641 - position= 121 count= 2641 - position= 122 count= 2641 - position= 123 count= 1505 - position= 124 count= 343 - position= 125 count= 343 - position= 126 count= 343 - position= 127 count= 343 - position= 128 count= 343 - position= 129 count= 343 - position= 130 count= 343 - position= 131 count= 343 - position= 132 count= 40906 - position= 133 count= 40906 - position= 134 count= 40906 - position= 135 count= 40906 - position= 136 count= 40906 - position= 137 count= 40906 - position= 138 count= 42278 - position= 139 count= 42278 - position= 140 count= 42278 - position= 141 count= 42278 - position= 142 count= 42278 - position= 143 count= 42278 - position= 144 count= 30993 - position= 145 count= 30993 - position= 146 count= 31983 - position= 147 count= 31983 - position= 148 count= 31983 - position= 149 count= 31983 - position= 150 count= 31983 - position= 151 count= 31983 - position= 152 count= 17856 - position= 153 count= 17856 - position= 154 count= 17856 - position= 155 count= 17856 - position= 156 count= 17856 - position= 157 count= 17856 - position= 158 count= 40661 - position= 159 count= 40661 - position= 160 count= 40661 - appending (count=10,length=4) - appending (count=1,length=0) - appending (count=2,length=8) -Hello - appending (count=10,length=4) -11:38:08.185 WARN WiggleWindow - Not writing 101 7 -11:38:08.186 WARN WiggleWindow - Not writing 111 7 -11:38:08.186 WARN WiggleWindow - Not writing 131 8 -11:38:08.186 WARN WiggleWindow - Not writing 141 8 -11:38:08.186 WARN WiggleWindow - Not writing 151 8 - peak : start :5 count :13 length :100010 - peak : start :100020 count :10 length :1 original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGTGT original G----GTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: G original GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT mapped: GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCGT original G--GTGTGTGTGTGTGTGTGTGTGTGTGTGCGTTG mapped: GGT -qPhred=1 -qPhred=2 -qPhred=3 -qPhred=4 -qPhred=5 -qPhred=6 -qPhred=7 -qPhred=8 -qPhred=9 -qPhred=10 -qPhred=11 -qPhred=12 -qPhred=13 -qPhred=14 -qPhred=15 -qPhred=16 -qPhred=17 -qPhred=18 -qPhred=19 -qPhred=20 -qPhred=21 -qPhred=22 -qPhred=23 -qPhred=24 -qPhred=25 -qPhred=26 -qPhred=27 -qPhred=28 -qPhred=29 -qPhred=30 -qPhred=31 -qPhred=32 -qPhred=33 -qPhred=34 -qPhred=35 -qPhred=36 -qPhred=37 -qPhred=38 -qPhred=39 -qPhred=40 -qPhred=41 -qPhred=42 -qPhred=43 -qPhred=44 -qPhred=45 -qPhred=46 -qPhred=47 -qPhred=48 -qPhred=49 -qPhred=50 -qPhred=51 -qPhred=52 -qPhred=53 -qPhred=54 -qPhred=55 -qPhred=56 -qPhred=57 -qPhred=58 -qPhred=59 -qPhred=60 -qPhred=61 - 0 -AAC 3 -ACC 6 -ATC 9 -AGC 12 -AAC 15 -ACC 18 -ATC 21 -AGC 24 -AAC 27 -ACC 30 -ATC 33 -AGC 36 -AAC 39 -ACC 42 -ATC 45 -AGC 48 -AAC 51 -ACC 54 -ATC 57 -AGC 60 -AAC 63 -ACC 66 -ATC 69 -AGC 72 -AAC 75 -ACC 78 -ATC 81 -AGC11:38:16.444 WARN MessageChunksWriter - Using chunk-size=9 -11:38:16.448 WARN MessageChunksWriter - Using chunk-size=9 -Total logical entries written: 39 -Total bytes written: 660 -Average bytes/logical entry: 16.923077 -Number of bits/base 3.6590436 -11:38:16.450 WARN MessageChunksWriter - Using chunk-size=9 -Total logical entries written: 39 -Total bytes written: 685 -Average bytes/logical entry: 17.564102 -Number of bits/base 3.797644 -11:38:16.453 WARN MessageChunksWriter - Using chunk-size=9 -Total logical entries written: 39 -Total bytes written: 660 -Average bytes/logical entry: 16.923077 -Number of bits/base 3.6590436 ->1 -NNTGAATGAGACCTA - -[WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46, Time elapsed: 79.464 s - in TestSuite +[WARNING] Tests run: 512, Failures: 0, Errors: 0, Skipped: 46, Time elapsed: 72.607 s - in TestSuite [INFO] [INFO] Results: [INFO] @@ -6659,14 +6671,14 @@ [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] -[INFO] Goby Framework ..................................... SUCCESS [ 0.064 s] -[INFO] Goby I/O ........................................... SUCCESS [398 d 06:23 h] -[INFO] Goby Full Distribution ............................. SUCCESS [01:57 min] +[INFO] Goby Framework ..................................... SUCCESS [ 0.055 s] +[INFO] Goby I/O ........................................... SUCCESS [ 5.771 s] +[INFO] Goby Full Distribution ............................. SUCCESS [01:47 min] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ -[INFO] Total time: 02:06 min -[INFO] Finished at: 2026-09-08T11:38:48-12:00 +[INFO] Total time: 01:53 min +[INFO] Finished at: 2025-08-07T07:22:52+14:00 [INFO] ------------------------------------------------------------------------ make[1]: Leaving directory '/build/reproducible-path/libgoby-java-3.3.1+dfsg2' create-stamp debian/debhelper-build-stamp @@ -6737,14 +6749,14 @@ [INFO] ------------------------------------------------------------------------ [INFO] Reactor Summary for Goby Framework 3.3.1: [INFO] -[INFO] Goby Framework ..................................... SUCCESS [ 0.866 s] -[INFO] Goby I/O ........................................... SUCCESS [ 0.134 s] -[INFO] Goby Full Distribution ............................. SUCCESS [ 0.149 s] +[INFO] Goby Framework ..................................... SUCCESS [ 0.306 s] +[INFO] Goby I/O ........................................... SUCCESS [ 0.045 s] +[INFO] Goby Full Distribution ............................. SUCCESS [ 0.032 s] [INFO] ------------------------------------------------------------------------ [INFO] BUILD SUCCESS [INFO] ------------------------------------------------------------------------ -[INFO] Total time: 1.596 s -[INFO] Finished at: 2026-09-08T11:38:53-12:00 +[INFO] Total time: 0.523 s +[INFO] Finished at: 2025-08-07T07:22:54+14:00 [INFO] ------------------------------------------------------------------------ mh_resolve_dependencies --non-interactive --offline --build -plibgoby-io-java --base-directory=/build/reproducible-path/libgoby-java-3.3.1\+dfsg2 --non-explore Analysing pom.xml... @@ -6755,12 +6767,12 @@ > dpkg --search /usr/share/maven-repo/org/rosuda/REngine/REngine/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/rosuda/REngine/REngine -Sep 08, 2026 11:39:05 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve +Aug 07, 2025 7:23:00 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-distribution/pom.xml: Dependency not found org.rosuda.REngine:REngine:jar:debian > dpkg --search /usr/share/maven-repo/org/itadaki/bzip2/*/* dpkg failed to execute successfully Offline mode. Give up looking for package containing /usr/share/maven-repo/org/itadaki/bzip2 -Sep 08, 2026 11:39:10 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve +Aug 07, 2025 7:23:05 AM org.debian.maven.packager.DependenciesSolver$ToResolve resolve SEVERE: Cannot resolve dependencies in /build/reproducible-path/libgoby-java-3.3.1+dfsg2/goby-io/pom.xml: Dependency not found org.itadaki:bzip2:jar:debian ERROR: goby-distribution/pom.xml: dependency is not packaged in the Maven repository for Debian: org.rosuda.REngine:REngine:debian @@ -6787,13 +6799,13 @@ dh_missing dh_installdeb dh_gencontrol +dpkg-gencontrol: warning: Depends field of package libgoby-io-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: Depends field of package goby-java: substitution variable ${maven:Depends} used, but is not defined dpkg-gencontrol: warning: Recommends field of package goby-java: substitution variable ${maven:OptionalDepends} used, but is not defined -dpkg-gencontrol: warning: package goby-java: substitution variable ${java:Depends} unused, but is defined -dpkg-gencontrol: warning: Depends field of package libgoby-io-java: substitution variable ${shlibs:Depends} used, but is not defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${java:Depends} unused, but is defined dpkg-gencontrol: warning: package libgoby-io-java: substitution variable ${maven:CompileDepends} unused, but is defined +dpkg-gencontrol: warning: package goby-java: substitution variable ${java:Depends} unused, but is defined dh_md5sums dh_builddeb dpkg-deb: building package 'libgoby-io-java' in '../libgoby-io-java_3.3.1+dfsg2-11_all.deb'. @@ -6805,12 +6817,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/902668/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/148101 and its subdirectories -I: Current time: Tue Sep 8 11:39:41 -12 2026 -I: pbuilder-time-stamp: 1788910781 +I: removing directory /srv/workspace/pbuilder/902668 and its subdirectories +I: Current time: Thu Aug 7 07:23:13 +14 2025 +I: pbuilder-time-stamp: 1754500993 Compressing the 2nd log... /var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.diff: 90.7% -- replaced with /var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.diff.gz b2/build.log: 86.9% -- replaced with stdout Compressing the 1st log... b1/build.log: 87.1% -- replaced with stdout Wed Aug 6 17:23:15 UTC 2025 I: diffoscope 303 will be used to compare the two builds: ++ date -u +%s + DIFFOSCOPE_STAMP=/var/log/reproducible-builds/diffoscope_stamp_libgoby-java_trixie_amd64_1754500995 + touch /var/log/reproducible-builds/diffoscope_stamp_libgoby-java_trixie_amd64_1754500995 + RESULT=0 + systemd-run '--description=diffoscope on libgoby-java/3.3.1+dfsg2-11 in trixie/amd64' --slice=rb-build-diffoscope.slice -u rb-diffoscope-amd64_6-53142 '--property=SuccessExitStatus=1 124' --user --send-sighup --pipe --wait -E TMPDIR timeout 155m nice schroot --directory /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC --run-session -c jenkins-reproducible-trixie-diffoscope-5d720626-e82f-4d03-818f-2323ed930364 -- sh -c 'export TMPDIR=/srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/dbd-tmp-5eY3mUf ; timeout 150m diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/libgoby-java_3.3.1+dfsg2-11.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/libgoby-java_3.3.1+dfsg2-11.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/libgoby-java_3.3.1+dfsg2-11.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b1/libgoby-java_3.3.1+dfsg2-11_amd64.changes /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b2/libgoby-java_3.3.1+dfsg2-11_amd64.changes' + false + set +x Running as unit: rb-diffoscope-amd64_6-53142.service # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/libgoby-java_3.3.1+dfsg2-11.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/libgoby-java_3.3.1+dfsg2-11.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/libgoby-java_3.3.1+dfsg2-11.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b1/libgoby-java_3.3.1+dfsg2-11_amd64.changes /srv/reproducible-results/rbuild-debian/r-b-build.TJyfIDoC/b2/libgoby-java_3.3.1+dfsg2-11_amd64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call diffoscope.comparators.binary.FilesystemFile ## main (total time: 0.003s) 0.003s 2 calls outputs 0.000s 1 call cleanup Finished with result: success Main processes terminated with: code=exited/status=0 Service runtime: 164ms CPU time consumed: 166ms _ _ _ _ _ | (_) |__ __ _ ___ | |__ _ _ (_) __ ___ ____ _ | | | '_ \ / _` |/ _ \| '_ \| | | |_____| |/ _` \ \ / / _` | | | | |_) | (_| | (_) | |_) | |_| |_____| | (_| |\ V / (_| | |_|_|_.__/ \__, |\___/|_.__/ \__, | _/ |\__,_| \_/ \__,_| |___/ |___/ |__/ Wed Aug 6 17:23:16 UTC 2025 I: diffoscope 303 found no differences in the changes files, and a .buildinfo file also exists. Wed Aug 6 17:23:16 UTC 2025 I: libgoby-java from trixie built successfully and reproducibly on amd64. INSERT 0 1 INSERT 0 1 DELETE 1 [2025-08-06 17:23:16] INFO: Starting at 2025-08-06 17:23:16.453109 [2025-08-06 17:23:16] INFO: Generating the pages of 1 package(s) [2025-08-06 17:23:16] ERROR: Either /var/lib/jenkins/userContent/reproducible/debian/logs/unstable/armhf/libgoby-java_3.3.1+dfsg2-11.build2.log.gz or /var/lib/jenkins/userContent/reproducible/debian/logdiffs/unstable/armhf/libgoby-java_3.3.1+dfsg2-11.diff.gz is missing [2025-08-06 17:23:16] CRITICAL: https://tests.reproducible-builds.org/debian/trixie/amd64/libgoby-java didn't produce a buildlog, even though it has been built. [2025-08-06 17:23:16] ERROR: Either /var/lib/jenkins/userContent/reproducible/debian/logs/trixie/armhf/libgoby-java_3.3.1+dfsg2-11.build2.log.gz or /var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/armhf/libgoby-java_3.3.1+dfsg2-11.diff.gz is missing [2025-08-06 17:23:16] ERROR: Either /var/lib/jenkins/userContent/reproducible/debian/logs/bookworm/armhf/libgoby-java_3.3.1+dfsg2-9.build2.log.gz or /var/lib/jenkins/userContent/reproducible/debian/logdiffs/bookworm/armhf/libgoby-java_3.3.1+dfsg2-9.diff.gz is missing [2025-08-06 17:23:16] INFO: Finished at 2025-08-06 17:23:16.647773, took: 0:00:00.194667 Wed Aug 6 17:23:16 UTC 2025 - successfully updated the database and updated https://tests.reproducible-builds.org/debian/rb-pkg/trixie/amd64/libgoby-java.html Wed Aug 6 17:23:16 UTC 2025 I: Removing signed libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc files: removed './b1/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc' removed './b2/libgoby-java_3.3.1+dfsg2-11_amd64.buildinfo.asc' 1754500996 amd64 trixie libgoby-java Starting cleanup. /var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.rbuild.log: 86.6% -- replaced with /var/lib/jenkins/userContent/reproducible/debian/rbuild/trixie/amd64/libgoby-java_3.3.1+dfsg2-11.rbuild.log.gz [2025-08-06 17:23:16] INFO: Starting at 2025-08-06 17:23:16.922292 [2025-08-06 17:23:16] INFO: Generating the pages of 1 package(s) [2025-08-06 17:23:17] ERROR: Either /var/lib/jenkins/userContent/reproducible/debian/logs/unstable/armhf/libgoby-java_3.3.1+dfsg2-11.build2.log.gz or /var/lib/jenkins/userContent/reproducible/debian/logdiffs/unstable/armhf/libgoby-java_3.3.1+dfsg2-11.diff.gz is missing [2025-08-06 17:23:17] ERROR: Either /var/lib/jenkins/userContent/reproducible/debian/logs/trixie/armhf/libgoby-java_3.3.1+dfsg2-11.build2.log.gz or /var/lib/jenkins/userContent/reproducible/debian/logdiffs/trixie/armhf/libgoby-java_3.3.1+dfsg2-11.diff.gz is missing [2025-08-06 17:23:17] ERROR: Either /var/lib/jenkins/userContent/reproducible/debian/logs/bookworm/armhf/libgoby-java_3.3.1+dfsg2-9.build2.log.gz or /var/lib/jenkins/userContent/reproducible/debian/logdiffs/bookworm/armhf/libgoby-java_3.3.1+dfsg2-9.diff.gz is missing [2025-08-06 17:23:17] INFO: Finished at 2025-08-06 17:23:17.106990, took: 0:00:00.184701 All cleanup done. Wed Aug 6 17:23:17 UTC 2025 - total duration: 0h 20m 10s. Wed Aug 6 17:23:17 UTC 2025 - reproducible_build.sh stopped running as /tmp/jenkins-script-Ia6YoScM, removing. Finished with result: success Main processes terminated with: code=exited/status=0 Service runtime: 20min 11.065s CPU time consumed: 5.007s