{"diffoscope-json-version": 1, "source1": "/srv/reproducible-results/rbuild-debian/r-b-build.9WWIv3VC/b1/seqan3_3.4.0~rc.3+ds-3_arm64.changes", "source2": "/srv/reproducible-results/rbuild-debian/r-b-build.9WWIv3VC/b2/seqan3_3.4.0~rc.3+ds-3_arm64.changes", "unified_diff": null, "details": [{"source1": "Files", "source2": "Files", "unified_diff": "@@ -1,3 +1,3 @@\n \n 89cf1f6481fd2d3bd27ce2dce754fb12 769096 libdevel optional libseqan3-dev_3.4.0~rc.3+ds-3_all.deb\n- 3f7ae999854a956323cadcd4ff4c253d 2795056 doc optional seqan3-doc_3.4.0~rc.3+ds-3_all.deb\n+ 092b374f9ff66132a92334f22727956b 2826056 doc optional seqan3-doc_3.4.0~rc.3+ds-3_all.deb\n"}, {"source1": "seqan3-doc_3.4.0~rc.3+ds-3_all.deb", "source2": "seqan3-doc_3.4.0~rc.3+ds-3_all.deb", "unified_diff": null, "details": [{"source1": "file list", "source2": "file list", "unified_diff": "@@ -1,3 +1,3 @@\n -rw-r--r-- 0 0 0 4 2025-02-12 09:42:19.000000 debian-binary\n--rw-r--r-- 0 0 0 81156 2025-02-12 09:42:19.000000 control.tar.xz\n--rw-r--r-- 0 0 0 2713708 2025-02-12 09:42:19.000000 data.tar.xz\n+-rw-r--r-- 0 0 0 81160 2025-02-12 09:42:19.000000 control.tar.xz\n+-rw-r--r-- 0 0 0 2744704 2025-02-12 09:42:19.000000 data.tar.xz\n"}, {"source1": "control.tar.xz", "source2": "control.tar.xz", "unified_diff": null, "details": [{"source1": "control.tar", "source2": "control.tar", "unified_diff": null, "details": [{"source1": "file list", "source2": "file list", "unified_diff": "@@ -1,3 +1,3 @@\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./\n -rw-r--r-- 0 root (0) root (0) 866 2025-02-12 09:42:19.000000 ./control\n--rw-r--r-- 0 root (0) root (0) 375191 2025-02-12 09:42:19.000000 ./md5sums\n+-rw-r--r-- 0 root (0) root (0) 375371 2025-02-12 09:42:19.000000 ./md5sums\n"}, {"source1": "./control", "source2": "./control", "unified_diff": "@@ -1,13 +1,13 @@\n Package: seqan3-doc\n Source: seqan3\n Version: 3.4.0~rc.3+ds-3\n Architecture: all\n Maintainer: Debian Med Packaging Team \n-Installed-Size: 53041\n+Installed-Size: 55073\n Depends: doxygen-awesome-css\n Suggests: libseqan3-dev\n Section: doc\n Priority: optional\n Multi-Arch: foreign\n Homepage: https://www.seqan.de/\n Description: C++ library for the analysis of biological sequences v3 (documentation)\n"}, {"source1": "./md5sums", "source2": "./md5sums", "unified_diff": null, "details": [{"source1": "./md5sums", "source2": "./md5sums", "comments": ["Files differ"], "unified_diff": null}, {"source1": "line order", "source2": "line order", "unified_diff": "@@ -1134,14 +1134,15 @@\n usr/share/doc/libseqan3-dev/html/dir_000066_000025.html\n usr/share/doc/libseqan3-dev/html/dir_000067_000085.html\n usr/share/doc/libseqan3-dev/html/dir_000068_000015.html\n usr/share/doc/libseqan3-dev/html/dir_000068_000016.html\n usr/share/doc/libseqan3-dev/html/dir_000068_000032.html\n usr/share/doc/libseqan3-dev/html/dir_000068_000035.html\n usr/share/doc/libseqan3-dev/html/dir_000068_000082.html\n+usr/share/doc/libseqan3-dev/html/dir_000068_000086.html\n usr/share/doc/libseqan3-dev/html/dir_000068_000088.html\n usr/share/doc/libseqan3-dev/html/dir_000068_000100.html\n usr/share/doc/libseqan3-dev/html/dir_000069_000100.html\n usr/share/doc/libseqan3-dev/html/dir_000071_000025.html\n usr/share/doc/libseqan3-dev/html/dir_000071_000100.html\n usr/share/doc/libseqan3-dev/html/dir_000072_000014.html\n usr/share/doc/libseqan3-dev/html/dir_000072_000016.html\n@@ -1154,14 +1155,15 @@\n usr/share/doc/libseqan3-dev/html/dir_000073_000100.html\n usr/share/doc/libseqan3-dev/html/dir_000074_000016.html\n usr/share/doc/libseqan3-dev/html/dir_000074_000027.html\n usr/share/doc/libseqan3-dev/html/dir_000074_000035.html\n usr/share/doc/libseqan3-dev/html/dir_000074_000038.html\n usr/share/doc/libseqan3-dev/html/dir_000074_000041.html\n usr/share/doc/libseqan3-dev/html/dir_000074_000072.html\n+usr/share/doc/libseqan3-dev/html/dir_000074_000083.html\n usr/share/doc/libseqan3-dev/html/dir_000074_000100.html\n usr/share/doc/libseqan3-dev/html/dir_000075_000035.html\n usr/share/doc/libseqan3-dev/html/dir_000075_000088.html\n usr/share/doc/libseqan3-dev/html/dir_000075_000100.html\n usr/share/doc/libseqan3-dev/html/dir_000077_000025.html\n usr/share/doc/libseqan3-dev/html/dir_000077_000073.html\n usr/share/doc/libseqan3-dev/html/dir_000079_000035.html\n"}]}]}]}, {"source1": "data.tar.xz", "source2": "data.tar.xz", "unified_diff": null, "details": [{"source1": "data.tar", "source2": "data.tar", "unified_diff": null, "details": [{"source1": "file list", "source2": "file list", "unified_diff": "@@ -1,21 +1,21 @@\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/share/\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/share/doc/\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/\n -rw-r--r-- 0 root (0) root (0) 6390 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa10li_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 39669 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa10li_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 42652 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa10li_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa10murphy_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 39854 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa10murphy_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 42685 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa10murphy_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa20_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 35279 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa20_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 38110 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa20_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa27_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 32396 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa27_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 35227 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aa27_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 16468 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/about_api.html\n -rw-r--r-- 0 root (0) root (0) 162932 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/about_changelog.html\n -rw-r--r-- 0 root (0) root (0) 10696 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/about_citing.html\n -rw-r--r-- 0 root (0) root (0) 9501 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/about_code_of_conduct.html\n -rw-r--r-- 0 root (0) root (0) 13260 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/about_contributing.html\n -rw-r--r-- 0 root (0) root (0) 11360 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/about_copyright.html\n -rw-r--r-- 0 root (0) root (0) 10713 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/about_customisation.html\n@@ -24,60 +24,60 @@\n -rw-r--r-- 0 root (0) root (0) 6603 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/adaptor__for__view__without__args_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13544 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/adaptor__for__view__without__args_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6554 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/adaptor__from__functor_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 14325 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/adaptor__from__functor_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6391 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/add__enum__bitwise__operators_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/add__enum__bitwise__operators_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6620 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/advanceable__alignment__coordinate_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 46806 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/advanceable__alignment__coordinate_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 47455 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/advanceable__alignment__coordinate_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6545 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/affine__cell__proxy_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 51625 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/affine__cell__proxy_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6593 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/algorithm__executor__blocking_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 45759 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/algorithm__executor__blocking_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6522 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/algorithm__result__generator__range_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 60194 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/algorithm__result__generator__range_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 64627 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/algorithm__result__generator__range_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aliases_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 15819 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aliases_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 16001 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aliases_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6454 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__band_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 28913 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__band_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6459 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__debug_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11155 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__debug_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6454 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__edit_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13085 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__edit_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6513 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__gap__cost__affine_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 27533 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__gap__cost__affine_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6464 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__method_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 41813 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__method_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 42766 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__method_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6481 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__min__score_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 17294 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__min__score_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 19311 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__min__score_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6481 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__on__result_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 21773 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__on__result_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 22417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__on__result_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6464 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__output_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 57576 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__output_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6474 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__parallel_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__parallel_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6491 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__result__type_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19662 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__result__type_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6486 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__score__type_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19198 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__score__type_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6506 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__scoring__scheme_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 22827 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__scoring__scheme_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 23238 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__scoring__scheme_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__vectorised_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 17655 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__config__vectorised_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__pairwise_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 34232 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__pairwise_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 34881 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__pairwise_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6469 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__result__selector_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 26026 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align__result__selector_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 85088 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/align_transcript.png\n -rw-r--r-- 0 root (0) root (0) 6446 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__allocator_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 43148 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__allocator_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 44122 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__allocator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6580 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__sequence__builder_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 38823 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__sequence__builder_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 38851 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__sequence__builder_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6492 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__sequence__concept_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 50047 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__sequence__concept_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 51192 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aligned__sequence__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2aligned__sequence_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8787 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2aligned__sequence_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6297 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10799 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2cigar__conversion_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8735 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2cigar__conversion_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2configuration_2all_8hpp.html\n@@ -97,27 +97,27 @@\n -rw-r--r-- 0 root (0) root (0) 6551 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2pairwise_2detail_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 17261 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2pairwise_2detail_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6573 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2pairwise_2detail_2type__traits_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 37856 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2pairwise_2detail_2type__traits_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6414 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2scoring_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10085 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment_2scoring_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6457 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__algorithm_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 98765 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__algorithm_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 99186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__algorithm_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6587 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__algorithm__state_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11867 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__algorithm__state_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6472 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__configurator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 106447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__configurator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6472 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__from__cigar_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 43393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__from__cigar_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 52322 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__from__cigar_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6666 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__matrix__column__major__range__base_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 53154 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__matrix__column__major__range__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6543 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__optimum_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 20926 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__optimum_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6442 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__result_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 64128 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__result_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 69641 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__result_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6629 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__score__matrix__one__column_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 26211 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__score__matrix__one__column_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6666 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__score__matrix__one__column__banded_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 29215 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__score__matrix__one__column__banded_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6656 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__score__matrix__one__column__base_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 14562 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__score__matrix__one__column__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6602 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alignment__score__matrix__proxy_8hpp.html\n@@ -135,807 +135,807 @@\n -rw-r--r-- 0 root (0) root (0) 6420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2adaptation_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8469 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2adaptation_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6294 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 14614 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2aminoacid_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11748 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2aminoacid_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6437 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2aminoacid_2concept_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 23722 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2aminoacid_2concept_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 24143 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2aminoacid_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2cigar_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8071 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2cigar_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6415 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2cigar_2cigar_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 35748 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2cigar_2cigar_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 40473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2cigar_2cigar_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2composite_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9017 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2composite_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2composite_2detail_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 30423 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2composite_2detail_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6314 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2concept_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 99035 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2concept_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 99637 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2container_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8596 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2container_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6428 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2detail_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15630 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2detail_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 13540 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2detail_2convert_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6324 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2exception_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 17424 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2exception_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 18909 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2exception_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6399 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2gap_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8362 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2gap_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2mask_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8444 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2mask_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2nucleotide_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11883 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2nucleotide_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6440 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2nucleotide_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19307 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2nucleotide_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6411 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2quality_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10968 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2quality_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6431 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2quality_2concept_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 33361 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2quality_2concept_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 33625 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2quality_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2range_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8444 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2range_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2structure_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2structure_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6437 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2structure_2concept_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 55408 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2structure_2concept_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 55908 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2structure_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2views_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10940 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet_2views_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6326 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__base_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 37382 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__base_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 42287 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6429 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__proxy_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 61291 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__proxy_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 64532 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__proxy_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6459 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__tuple__base_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 148057 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__tuple__base_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 162159 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__tuple__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6442 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__variant_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 103537 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__variant_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 114736 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/alphabet__variant_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aminoacid__base_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 31491 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aminoacid__base_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 31779 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aminoacid__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6483 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aminoacid__scoring__scheme_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 64954 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aminoacid__scoring__scheme_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 66720 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/aminoacid__scoring__scheme_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 144325 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/annotated.html\n -rw-r--r-- 0 root (0) root (0) 36589 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/annotated_dup.js\n -rw-r--r-- 0 root (0) root (0) 2460 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/api-stability.js\n -rw-r--r-- 0 root (0) root (0) 6317 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/argument__parser_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9245 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/argument__parser_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6451 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/argument__parser_2detail_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11764 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/argument__parser_2detail_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6343 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/argument__parser_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 118528 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/argument__parser_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 123854 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/argument__parser_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6444 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/async__input__buffer_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 50059 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/async__input__buffer_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6311 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/auxiliary_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 48771 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/auxiliary_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 49344 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/auxiliary_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6386 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/basic_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 25517 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/basic_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 25938 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/basic_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 645 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bc_s.png\n -rw-r--r-- 0 root (0) root (0) 587 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bc_sd.png\n -rw-r--r-- 0 root (0) root (0) 6376 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bgzf_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8803 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bgzf_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 109732 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bgzf__istream_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 71373 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bgzf__ostream_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6440 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bgzf__stream__util_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 59705 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bgzf__stream__util_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bi__fm__index_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 42379 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bi__fm__index_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 44659 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bi__fm__index_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6453 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bi__fm__index__cursor_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 148179 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bi__fm__index__cursor_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 169677 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bi__fm__index__cursor_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6452 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bitpacked__sequence_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 136292 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bitpacked__sequence_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 145351 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bitpacked__sequence_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bits__of_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9627 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bits__of_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6424 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bloom__filter_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 51939 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bloom__filter_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 57534 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bloom__filter_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 971 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bsdl_badge.svg\n -rw-r--r-- 0 root (0) root (0) 6420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/buffer__queue_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 96994 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/buffer__queue_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6379 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/byte_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 12477 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/byte_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 13202 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/byte_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 64384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bz2__istream_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 75294 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/bz2__ostream_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 961 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cc0_badge.svg\n -rw-r--r-- 0 root (0) root (0) 965 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/ccby_badge.svg\n -rw-r--r-- 0 root (0) root (0) 6384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cereal_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 21192 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cereal_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6381 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 20701 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 21806 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6440 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char__strictly__to_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11302 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char__strictly__to_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char__to_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 13798 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char__to_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 13638 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/char__to_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6272 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/charconv.html\n -rw-r--r-- 0 root (0) root (0) 42548 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/charconv_source.html\n -rw-r--r-- 0 root (0) root (0) 6380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/chunk_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 9981 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/chunk_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 10402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/chunk_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6472 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cigar__from__alignment_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 42022 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cigar__from__alignment_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 42443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cigar__from__alignment_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6540 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cigar__operation_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 23703 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cigar__operation_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 26333 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cigar__operation_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 59739 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classes.html\n -rw-r--r-- 0 root (0) root (0) 6214 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classsdsl__index__type__.html\n -rw-r--r-- 0 root (0) root (0) 13710 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li-members.html\n--rw-r--r-- 0 root (0) root (0) 37669 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li.html\n+-rw-r--r-- 0 root (0) root (0) 42551 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li.html\n -rw-r--r-- 0 root (0) root (0) 661 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li.js\n -rw-r--r-- 0 root (0) root (0) 27632 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 23711 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13854 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy-members.html\n--rw-r--r-- 0 root (0) root (0) 37878 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy.html\n+-rw-r--r-- 0 root (0) root (0) 42760 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy.html\n -rw-r--r-- 0 root (0) root (0) 713 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy.js\n -rw-r--r-- 0 root (0) root (0) 27656 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 23731 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13638 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20-members.html\n--rw-r--r-- 0 root (0) root (0) 35613 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20.html\n+-rw-r--r-- 0 root (0) root (0) 40495 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20.html\n -rw-r--r-- 0 root (0) root (0) 635 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20.js\n -rw-r--r-- 0 root (0) root (0) 27619 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 23700 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13638 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27-members.html\n--rw-r--r-- 0 root (0) root (0) 33961 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27.html\n+-rw-r--r-- 0 root (0) root (0) 38843 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27.html\n -rw-r--r-- 0 root (0) root (0) 635 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27.js\n -rw-r--r-- 0 root (0) root (0) 27633 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 23714 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12941 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range-members.html\n--rw-r--r-- 0 root (0) root (0) 27763 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range.html\n+-rw-r--r-- 0 root (0) root (0) 30753 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range.html\n -rw-r--r-- 0 root (0) root (0) 2221 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range.js\n -rw-r--r-- 0 root (0) root (0) 16442 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator-members.html\n--rw-r--r-- 0 root (0) root (0) 26196 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator.html\n+-rw-r--r-- 0 root (0) root (0) 30291 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator.html\n -rw-r--r-- 0 root (0) root (0) 3186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator.js\n -rw-r--r-- 0 root (0) root (0) 2971 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 2912 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2127 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9554 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size-members.html\n--rw-r--r-- 0 root (0) root (0) 24764 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size.html\n+-rw-r--r-- 0 root (0) root (0) 26420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size.html\n -rw-r--r-- 0 root (0) root (0) 1141 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size.js\n -rw-r--r-- 0 root (0) root (0) 2769 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1984 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9475 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type-members.html\n--rw-r--r-- 0 root (0) root (0) 16743 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type.html\n+-rw-r--r-- 0 root (0) root (0) 17848 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type.html\n -rw-r--r-- 0 root (0) root (0) 912 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type.js\n -rw-r--r-- 0 root (0) root (0) 3031 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2246 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9533 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine-members.html\n--rw-r--r-- 0 root (0) root (0) 23923 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine.html\n+-rw-r--r-- 0 root (0) root (0) 25319 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine.html\n -rw-r--r-- 0 root (0) root (0) 1138 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine.js\n -rw-r--r-- 0 root (0) root (0) 2772 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1987 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 10368 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global-members.html\n--rw-r--r-- 0 root (0) root (0) 33166 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global.html\n+-rw-r--r-- 0 root (0) root (0) 37286 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global.html\n -rw-r--r-- 0 root (0) root (0) 1407 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global.js\n -rw-r--r-- 0 root (0) root (0) 2744 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1959 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8314 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local-members.html\n--rw-r--r-- 0 root (0) root (0) 22383 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local.html\n+-rw-r--r-- 0 root (0) root (0) 24160 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local.html\n -rw-r--r-- 0 root (0) root (0) 737 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local.js\n -rw-r--r-- 0 root (0) root (0) 2740 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1955 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9270 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score-members.html\n--rw-r--r-- 0 root (0) root (0) 20521 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score.html\n+-rw-r--r-- 0 root (0) root (0) 22146 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score.html\n -rw-r--r-- 0 root (0) root (0) 918 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score.js\n -rw-r--r-- 0 root (0) root (0) 2785 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2000 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9133 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result-members.html\n--rw-r--r-- 0 root (0) root (0) 20428 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result.html\n+-rw-r--r-- 0 root (0) root (0) 22301 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result.html\n -rw-r--r-- 0 root (0) root (0) 921 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result.js\n -rw-r--r-- 0 root (0) root (0) 2840 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2055 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8434 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment-members.html\n--rw-r--r-- 0 root (0) root (0) 16037 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment.html\n+-rw-r--r-- 0 root (0) root (0) 17303 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment.html\n -rw-r--r-- 0 root (0) root (0) 781 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment.js\n -rw-r--r-- 0 root (0) root (0) 2776 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1991 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position-members.html\n--rw-r--r-- 0 root (0) root (0) 16586 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position.html\n+-rw-r--r-- 0 root (0) root (0) 17852 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position.html\n -rw-r--r-- 0 root (0) root (0) 843 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position.js\n -rw-r--r-- 0 root (0) root (0) 2807 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2022 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8538 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position-members.html\n--rw-r--r-- 0 root (0) root (0) 16508 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position.html\n+-rw-r--r-- 0 root (0) root (0) 17774 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position.html\n -rw-r--r-- 0 root (0) root (0) 821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position.js\n -rw-r--r-- 0 root (0) root (0) 2786 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2001 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8314 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score-members.html\n--rw-r--r-- 0 root (0) root (0) 15882 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score.html\n+-rw-r--r-- 0 root (0) root (0) 17148 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score.html\n -rw-r--r-- 0 root (0) root (0) 737 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score.js\n -rw-r--r-- 0 root (0) root (0) 2760 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1975 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8538 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id-members.html\n--rw-r--r-- 0 root (0) root (0) 16181 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id.html\n+-rw-r--r-- 0 root (0) root (0) 17447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id.html\n -rw-r--r-- 0 root (0) root (0) 821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id.js\n -rw-r--r-- 0 root (0) root (0) 2798 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2013 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8538 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id-members.html\n--rw-r--r-- 0 root (0) root (0) 16186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id.html\n+-rw-r--r-- 0 root (0) root (0) 17452 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id.html\n -rw-r--r-- 0 root (0) root (0) 821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id.js\n -rw-r--r-- 0 root (0) root (0) 2799 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2014 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8718 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type-members.html\n--rw-r--r-- 0 root (0) root (0) 16940 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type.html\n+-rw-r--r-- 0 root (0) root (0) 18347 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type.html\n -rw-r--r-- 0 root (0) root (0) 820 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type.js\n -rw-r--r-- 0 root (0) root (0) 2829 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2044 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9834 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1scoring__scheme-members.html\n--rw-r--r-- 0 root (0) root (0) 26537 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1scoring__scheme.html\n+-rw-r--r-- 0 root (0) root (0) 28877 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1scoring__scheme.html\n -rw-r--r-- 0 root (0) root (0) 1108 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1scoring__scheme.js\n -rw-r--r-- 0 root (0) root (0) 2949 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1scoring__scheme__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2164 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1scoring__scheme__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8240 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1vectorised-members.html\n--rw-r--r-- 0 root (0) root (0) 15158 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1vectorised.html\n+-rw-r--r-- 0 root (0) root (0) 16424 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1vectorised.html\n -rw-r--r-- 0 root (0) root (0) 708 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1vectorised.js\n -rw-r--r-- 0 root (0) root (0) 2789 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1vectorised__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2004 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1vectorised__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12505 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aligned__allocator-members.html\n--rw-r--r-- 0 root (0) root (0) 39110 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aligned__allocator.html\n+-rw-r--r-- 0 root (0) root (0) 43572 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aligned__allocator.html\n -rw-r--r-- 0 root (0) root (0) 1864 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aligned__allocator.js\n -rw-r--r-- 0 root (0) root (0) 12269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alignment__result-members.html\n--rw-r--r-- 0 root (0) root (0) 32937 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alignment__result.html\n+-rw-r--r-- 0 root (0) root (0) 38982 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alignment__result.html\n -rw-r--r-- 0 root (0) root (0) 1689 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alignment__result.js\n -rw-r--r-- 0 root (0) root (0) 13054 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base-members.html\n--rw-r--r-- 0 root (0) root (0) 54083 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base.html\n+-rw-r--r-- 0 root (0) root (0) 65556 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base.html\n -rw-r--r-- 0 root (0) root (0) 1842 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base.js\n -rw-r--r-- 0 root (0) root (0) 119450 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 115523 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 11884 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy-members.html\n--rw-r--r-- 0 root (0) root (0) 23967 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy.html\n+-rw-r--r-- 0 root (0) root (0) 29297 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy.html\n -rw-r--r-- 0 root (0) root (0) 1367 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy.js\n -rw-r--r-- 0 root (0) root (0) 11629 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 7699 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 20186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base-members.html\n--rw-r--r-- 0 root (0) root (0) 108231 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base.html\n+-rw-r--r-- 0 root (0) root (0) 145082 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base.html\n -rw-r--r-- 0 root (0) root (0) 2396 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base.js\n -rw-r--r-- 0 root (0) root (0) 25773 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 21837 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 20750 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant-members.html\n--rw-r--r-- 0 root (0) root (0) 101503 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant.html\n+-rw-r--r-- 0 root (0) root (0) 126409 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant.html\n -rw-r--r-- 0 root (0) root (0) 2174 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant.js\n -rw-r--r-- 0 root (0) root (0) 16203 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 12268 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 11841 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base-members.html\n--rw-r--r-- 0 root (0) root (0) 27435 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base.html\n+-rw-r--r-- 0 root (0) root (0) 32375 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base.html\n -rw-r--r-- 0 root (0) root (0) 145 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base.js\n -rw-r--r-- 0 root (0) root (0) 16233 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 12301 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 17909 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme-members.html\n--rw-r--r-- 0 root (0) root (0) 64005 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme.html\n+-rw-r--r-- 0 root (0) root (0) 75254 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme.html\n -rw-r--r-- 0 root (0) root (0) 1182 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme.js\n -rw-r--r-- 0 root (0) root (0) 4587 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3802 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12972 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser-members.html\n--rw-r--r-- 0 root (0) root (0) 95579 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser.html\n+-rw-r--r-- 0 root (0) root (0) 104890 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser.html\n -rw-r--r-- 0 root (0) root (0) 1912 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser.js\n -rw-r--r-- 0 root (0) root (0) 7305 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error-members.html\n--rw-r--r-- 0 root (0) root (0) 12120 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error.html\n+-rw-r--r-- 0 root (0) root (0) 12250 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error.html\n -rw-r--r-- 0 root (0) root (0) 168 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error.js\n -rw-r--r-- 0 root (0) root (0) 10627 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 9842 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8719 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator-members.html\n--rw-r--r-- 0 root (0) root (0) 29817 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator.html\n+-rw-r--r-- 0 root (0) root (0) 32102 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator.html\n -rw-r--r-- 0 root (0) root (0) 657 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator.js\n -rw-r--r-- 0 root (0) root (0) 2849 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2064 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index-members.html\n--rw-r--r-- 0 root (0) root (0) 48988 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index.html\n+-rw-r--r-- 0 root (0) root (0) 53375 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index.html\n -rw-r--r-- 0 root (0) root (0) 1718 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index.js\n -rw-r--r-- 0 root (0) root (0) 17945 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor-members.html\n--rw-r--r-- 0 root (0) root (0) 97677 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor.html\n+-rw-r--r-- 0 root (0) root (0) 115265 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor.html\n -rw-r--r-- 0 root (0) root (0) 3514 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor.js\n -rw-r--r-- 0 root (0) root (0) 2675 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1890 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 2874 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2089 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 30419 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence-members.html\n--rw-r--r-- 0 root (0) root (0) 188720 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence.html\n+-rw-r--r-- 0 root (0) root (0) 206752 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence.html\n -rw-r--r-- 0 root (0) root (0) 6766 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence.js\n -rw-r--r-- 0 root (0) root (0) 14545 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 10611 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12955 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter-members.html\n--rw-r--r-- 0 root (0) root (0) 67416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter.html\n+-rw-r--r-- 0 root (0) root (0) 76094 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter.html\n -rw-r--r-- 0 root (0) root (0) 1819 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter.js\n -rw-r--r-- 0 root (0) root (0) 2755 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1970 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 17313 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar-members.html\n--rw-r--r-- 0 root (0) root (0) 83157 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar.html\n+-rw-r--r-- 0 root (0) root (0) 95054 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar.html\n -rw-r--r-- 0 root (0) root (0) 1282 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar.js\n -rw-r--r-- 0 root (0) root (0) 19158 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 15239 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 37434 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences-members.html\n--rw-r--r-- 0 root (0) root (0) 249883 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences.html\n+-rw-r--r-- 0 root (0) root (0) 300257 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences.html\n -rw-r--r-- 0 root (0) root (0) 7734 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences.js\n -rw-r--r-- 0 root (0) root (0) 14720 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 10782 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration-members.html\n--rw-r--r-- 0 root (0) root (0) 48563 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration.html\n+-rw-r--r-- 0 root (0) root (0) 58572 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration.html\n -rw-r--r-- 0 root (0) root (0) 1896 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration.js\n -rw-r--r-- 0 root (0) root (0) 3693 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2908 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 21216 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector-members.html\n--rw-r--r-- 0 root (0) root (0) 58365 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector.html\n+-rw-r--r-- 0 root (0) root (0) 61176 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector.html\n -rw-r--r-- 0 root (0) root (0) 1080 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector.js\n -rw-r--r-- 0 root (0) root (0) 3654 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2869 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14207 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1debug__stream__type-members.html\n--rw-r--r-- 0 root (0) root (0) 46346 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1debug__stream__type.html\n+-rw-r--r-- 0 root (0) root (0) 50989 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1debug__stream__type.html\n -rw-r--r-- 0 root (0) root (0) 2160 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1debug__stream__type.js\n -rw-r--r-- 0 root (0) root (0) 7604 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error-members.html\n--rw-r--r-- 0 root (0) root (0) 12673 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error.html\n+-rw-r--r-- 0 root (0) root (0) 12868 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error.html\n -rw-r--r-- 0 root (0) root (0) 139 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error.js\n -rw-r--r-- 0 root (0) root (0) 3559 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2774 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14349 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15-members.html\n--rw-r--r-- 0 root (0) root (0) 46956 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15.html\n+-rw-r--r-- 0 root (0) root (0) 53639 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15.html\n -rw-r--r-- 0 root (0) root (0) 734 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15.js\n -rw-r--r-- 0 root (0) root (0) 26158 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 22236 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14154 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam-members.html\n--rw-r--r-- 0 root (0) root (0) 36221 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam.html\n+-rw-r--r-- 0 root (0) root (0) 41298 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam.html\n -rw-r--r-- 0 root (0) root (0) 687 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam.js\n -rw-r--r-- 0 root (0) root (0) 25647 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 21722 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14077 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs-members.html\n--rw-r--r-- 0 root (0) root (0) 37817 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs.html\n+-rw-r--r-- 0 root (0) root (0) 42894 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs.html\n -rw-r--r-- 0 root (0) root (0) 661 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs.js\n -rw-r--r-- 0 root (0) root (0) 26216 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 22293 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14253 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4-members.html\n--rw-r--r-- 0 root (0) root (0) 51041 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4.html\n+-rw-r--r-- 0 root (0) root (0) 58679 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4.html\n -rw-r--r-- 0 root (0) root (0) 809 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4.js\n -rw-r--r-- 0 root (0) root (0) 26146 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 22225 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14305 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5-members.html\n--rw-r--r-- 0 root (0) root (0) 46745 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5.html\n+-rw-r--r-- 0 root (0) root (0) 53428 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5.html\n -rw-r--r-- 0 root (0) root (0) 719 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5.js\n -rw-r--r-- 0 root (0) root (0) 26174 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 22253 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14316 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3-members.html\n--rw-r--r-- 0 root (0) root (0) 39062 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3.html\n+-rw-r--r-- 0 root (0) root (0) 44789 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3.html\n -rw-r--r-- 0 root (0) root (0) 1044 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3.js\n -rw-r--r-- 0 root (0) root (0) 22629 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 18699 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12353 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9-members.html\n--rw-r--r-- 0 root (0) root (0) 29098 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9.html\n+-rw-r--r-- 0 root (0) root (0) 33200 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9.html\n -rw-r--r-- 0 root (0) root (0) 555 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9.js\n -rw-r--r-- 0 root (0) root (0) 21192 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 17269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 39717 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dynamic__bitset-members.html\n--rw-r--r-- 0 root (0) root (0) 306411 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dynamic__bitset.html\n+-rw-r--r-- 0 root (0) root (0) 358011 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dynamic__bitset.html\n -rw-r--r-- 0 root (0) root (0) 9339 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dynamic__bitset.js\n -rw-r--r-- 0 root (0) root (0) 16433 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dynamic__bitset__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 12503 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dynamic__bitset__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13323 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1exposition__only_1_1cigar__operation-members.html\n--rw-r--r-- 0 root (0) root (0) 26385 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1exposition__only_1_1cigar__operation.html\n+-rw-r--r-- 0 root (0) root (0) 30285 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1exposition__only_1_1cigar__operation.html\n -rw-r--r-- 0 root (0) root (0) 812 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1exposition__only_1_1cigar__operation.js\n -rw-r--r-- 0 root (0) root (0) 21665 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1exposition__only_1_1cigar__operation__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 17712 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1exposition__only_1_1cigar__operation__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 11807 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1file__validator__base-members.html\n--rw-r--r-- 0 root (0) root (0) 34694 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1file__validator__base.html\n+-rw-r--r-- 0 root (0) root (0) 38139 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1file__validator__base.html\n -rw-r--r-- 0 root (0) root (0) 1768 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1file__validator__base.js\n -rw-r--r-- 0 root (0) root (0) 5798 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1file__validator__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 5013 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1file__validator__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13575 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index-members.html\n--rw-r--r-- 0 root (0) root (0) 43798 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index.html\n+-rw-r--r-- 0 root (0) root (0) 49303 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index.html\n -rw-r--r-- 0 root (0) root (0) 1342 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index.js\n -rw-r--r-- 0 root (0) root (0) 15835 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__cursor-members.html\n--rw-r--r-- 0 root (0) root (0) 83207 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__cursor.html\n+-rw-r--r-- 0 root (0) root (0) 99627 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__cursor.html\n -rw-r--r-- 0 root (0) root (0) 2752 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__cursor.js\n -rw-r--r-- 0 root (0) root (0) 2673 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__cursor__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1888 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__cursor__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13772 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 9847 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1fm__index__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 10000 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__bam-members.html\n--rw-r--r-- 0 root (0) root (0) 56445 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__bam.html\n+-rw-r--r-- 0 root (0) root (0) 65805 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__bam.html\n -rw-r--r-- 0 root (0) root (0) 834 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__bam.js\n -rw-r--r-- 0 root (0) root (0) 3246 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__bam__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2461 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__bam__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 10070 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__embl-members.html\n--rw-r--r-- 0 root (0) root (0) 34446 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__embl.html\n+-rw-r--r-- 0 root (0) root (0) 39581 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__embl.html\n -rw-r--r-- 0 root (0) root (0) 845 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__embl.js\n -rw-r--r-- 0 root (0) root (0) 3620 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__embl__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2835 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__embl__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 10105 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fasta-members.html\n--rw-r--r-- 0 root (0) root (0) 35165 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fasta.html\n+-rw-r--r-- 0 root (0) root (0) 40300 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fasta.html\n -rw-r--r-- 0 root (0) root (0) 858 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fasta.js\n -rw-r--r-- 0 root (0) root (0) 3624 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fasta__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2839 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fasta__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9510 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fastq-members.html\n--rw-r--r-- 0 root (0) root (0) 29471 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fastq.html\n+-rw-r--r-- 0 root (0) root (0) 33956 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fastq.html\n -rw-r--r-- 0 root (0) root (0) 858 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fastq.js\n -rw-r--r-- 0 root (0) root (0) 2374 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fastq__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1589 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__fastq__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 10187 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__genbank-members.html\n--rw-r--r-- 0 root (0) root (0) 34583 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__genbank.html\n+-rw-r--r-- 0 root (0) root (0) 39718 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__genbank.html\n -rw-r--r-- 0 root (0) root (0) 884 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__genbank.js\n -rw-r--r-- 0 root (0) root (0) 3642 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__genbank__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2857 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__genbank__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 11114 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__sam-members.html\n--rw-r--r-- 0 root (0) root (0) 71881 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__sam.html\n+-rw-r--r-- 0 root (0) root (0) 85271 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__sam.html\n -rw-r--r-- 0 root (0) root (0) 1049 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__sam.js\n -rw-r--r-- 0 root (0) root (0) 3248 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__sam__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2463 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__sam__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9862 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__vienna-members.html\n--rw-r--r-- 0 root (0) root (0) 50368 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__vienna.html\n+-rw-r--r-- 0 root (0) root (0) 55633 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__vienna.html\n -rw-r--r-- 0 root (0) root (0) 873 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__vienna.js\n -rw-r--r-- 0 root (0) root (0) 3706 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__vienna__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2921 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1format__vienna__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12334 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap-members.html\n--rw-r--r-- 0 root (0) root (0) 28811 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap.html\n+-rw-r--r-- 0 root (0) root (0) 32219 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap.html\n -rw-r--r-- 0 root (0) root (0) 533 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap.js\n -rw-r--r-- 0 root (0) root (0) 20565 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__decorator-members.html\n--rw-r--r-- 0 root (0) root (0) 95919 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__decorator.html\n+-rw-r--r-- 0 root (0) root (0) 107432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__decorator.html\n -rw-r--r-- 0 root (0) root (0) 3132 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__decorator.js\n -rw-r--r-- 0 root (0) root (0) 6130 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__decorator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 5345 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__decorator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7261 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__erase__failure-members.html\n--rw-r--r-- 0 root (0) root (0) 11076 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__erase__failure.html\n+-rw-r--r-- 0 root (0) root (0) 11206 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__erase__failure.html\n -rw-r--r-- 0 root (0) root (0) 156 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__erase__failure.js\n -rw-r--r-- 0 root (0) root (0) 2523 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__erase__failure__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1738 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__erase__failure__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 21162 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 17244 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1gap__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9865 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1hamming__scoring__scheme-members.html\n--rw-r--r-- 0 root (0) root (0) 19031 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1hamming__scoring__scheme.html\n+-rw-r--r-- 0 root (0) root (0) 22151 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1hamming__scoring__scheme.html\n -rw-r--r-- 0 root (0) root (0) 1191 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1hamming__scoring__scheme.js\n -rw-r--r-- 0 root (0) root (0) 14969 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__directory__validator-members.html\n--rw-r--r-- 0 root (0) root (0) 44167 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__directory__validator.html\n+-rw-r--r-- 0 root (0) root (0) 48391 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__directory__validator.html\n -rw-r--r-- 0 root (0) root (0) 1512 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__directory__validator.js\n -rw-r--r-- 0 root (0) root (0) 3560 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__directory__validator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2775 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__directory__validator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__file__validator-members.html\n--rw-r--r-- 0 root (0) root (0) 54079 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__file__validator.html\n+-rw-r--r-- 0 root (0) root (0) 59373 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__file__validator.html\n -rw-r--r-- 0 root (0) root (0) 1545 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__file__validator.js\n -rw-r--r-- 0 root (0) root (0) 3576 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__file__validator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2791 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1input__file__validator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15937 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter-members.html\n--rw-r--r-- 0 root (0) root (0) 106300 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter.html\n+-rw-r--r-- 0 root (0) root (0) 119492 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter.html\n -rw-r--r-- 0 root (0) root (0) 3091 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter.js\n -rw-r--r-- 0 root (0) root (0) 10661 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1counting__agent__type-members.html\n--rw-r--r-- 0 root (0) root (0) 48010 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1counting__agent__type.html\n+-rw-r--r-- 0 root (0) root (0) 57177 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1counting__agent__type.html\n -rw-r--r-- 0 root (0) root (0) 1347 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1counting__agent__type.js\n -rw-r--r-- 0 root (0) root (0) 10534 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type-members.html\n--rw-r--r-- 0 root (0) root (0) 32688 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type.html\n+-rw-r--r-- 0 root (0) root (0) 34626 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type.html\n -rw-r--r-- 0 root (0) root (0) 1603 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type.js\n -rw-r--r-- 0 root (0) root (0) 16577 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type_1_1binning__bitvector-members.html\n--rw-r--r-- 0 root (0) root (0) 29346 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type_1_1binning__bitvector.html\n+-rw-r--r-- 0 root (0) root (0) 33311 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type_1_1binning__bitvector.html\n -rw-r--r-- 0 root (0) root (0) 2998 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter_1_1membership__agent__type_1_1binning__bitvector.js\n -rw-r--r-- 0 root (0) root (0) 2913 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2128 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1interleaved__bloom__filter__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7403 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1invalid__alignment__configuration-members.html\n--rw-r--r-- 0 root (0) root (0) 11304 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1invalid__alignment__configuration.html\n+-rw-r--r-- 0 root (0) root (0) 11434 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1invalid__alignment__configuration.html\n -rw-r--r-- 0 root (0) root (0) 198 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1invalid__alignment__configuration.js\n -rw-r--r-- 0 root (0) root (0) 2669 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1invalid__alignment__configuration__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1884 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1invalid__alignment__configuration__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12905 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1mask-members.html\n--rw-r--r-- 0 root (0) root (0) 33462 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1mask.html\n+-rw-r--r-- 0 root (0) root (0) 36932 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1mask.html\n -rw-r--r-- 0 root (0) root (0) 544 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1mask.js\n -rw-r--r-- 0 root (0) root (0) 17753 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1mask__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 13834 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1mask__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 17505 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1masked-members.html\n--rw-r--r-- 0 root (0) root (0) 58893 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1masked.html\n+-rw-r--r-- 0 root (0) root (0) 67640 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1masked.html\n -rw-r--r-- 0 root (0) root (0) 1031 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1masked.js\n -rw-r--r-- 0 root (0) root (0) 23472 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1masked__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 19552 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1masked__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12222 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__base-members.html\n--rw-r--r-- 0 root (0) root (0) 31251 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__base.html\n+-rw-r--r-- 0 root (0) root (0) 36581 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__base.html\n -rw-r--r-- 0 root (0) root (0) 250 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__base.js\n -rw-r--r-- 0 root (0) root (0) 23591 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 19657 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 16632 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__scoring__scheme-members.html\n--rw-r--r-- 0 root (0) root (0) 57157 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__scoring__scheme.html\n+-rw-r--r-- 0 root (0) root (0) 67129 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__scoring__scheme.html\n -rw-r--r-- 0 root (0) root (0) 820 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__scoring__scheme.js\n -rw-r--r-- 0 root (0) root (0) 4675 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__scoring__scheme__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3890 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1nucleotide__scoring__scheme__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7756 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1option__declared__multiple__times-members.html\n--rw-r--r-- 0 root (0) root (0) 12806 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1option__declared__multiple__times.html\n+-rw-r--r-- 0 root (0) root (0) 13001 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1option__declared__multiple__times.html\n -rw-r--r-- 0 root (0) root (0) 197 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1option__declared__multiple__times.js\n -rw-r--r-- 0 root (0) root (0) 3705 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1option__declared__multiple__times__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2920 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1option__declared__multiple__times__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15017 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__directory__validator-members.html\n--rw-r--r-- 0 root (0) root (0) 44259 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__directory__validator.html\n+-rw-r--r-- 0 root (0) root (0) 48483 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__directory__validator.html\n -rw-r--r-- 0 root (0) root (0) 1529 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__directory__validator.js\n -rw-r--r-- 0 root (0) root (0) 3552 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__directory__validator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__directory__validator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15931 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__file__validator-members.html\n--rw-r--r-- 0 root (0) root (0) 62153 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__file__validator.html\n+-rw-r--r-- 0 root (0) root (0) 67901 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__file__validator.html\n -rw-r--r-- 0 root (0) root (0) 1564 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__file__validator.js\n -rw-r--r-- 0 root (0) root (0) 3580 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__file__validator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2795 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1output__file__validator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred42-members.html\n--rw-r--r-- 0 root (0) root (0) 47383 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred42.html\n+-rw-r--r-- 0 root (0) root (0) 54336 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred42.html\n -rw-r--r-- 0 root (0) root (0) 783 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred42.js\n -rw-r--r-- 0 root (0) root (0) 25766 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred42__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 21842 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred42__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred63-members.html\n--rw-r--r-- 0 root (0) root (0) 47558 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred63.html\n+-rw-r--r-- 0 root (0) root (0) 54511 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred63.html\n -rw-r--r-- 0 root (0) root (0) 783 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred63.js\n -rw-r--r-- 0 root (0) root (0) 25766 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred63__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 21842 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred63__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15576 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred68solexa-members.html\n--rw-r--r-- 0 root (0) root (0) 46212 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred68solexa.html\n+-rw-r--r-- 0 root (0) root (0) 53165 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred68solexa.html\n -rw-r--r-- 0 root (0) root (0) 873 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred68solexa.js\n -rw-r--r-- 0 root (0) root (0) 25795 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred68solexa__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 21865 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred68solexa__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 15288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred94-members.html\n--rw-r--r-- 0 root (0) root (0) 46429 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred94.html\n+-rw-r--r-- 0 root (0) root (0) 53382 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred94.html\n -rw-r--r-- 0 root (0) root (0) 783 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred94.js\n -rw-r--r-- 0 root (0) root (0) 25748 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred94__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 21824 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred94__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred__base-members.html\n--rw-r--r-- 0 root (0) root (0) 30731 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred__base.html\n+-rw-r--r-- 0 root (0) root (0) 35541 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred__base.html\n -rw-r--r-- 0 root (0) root (0) 424 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred__base.js\n -rw-r--r-- 0 root (0) root (0) 15337 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 11409 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1phred__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 20137 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1qualified-members.html\n--rw-r--r-- 0 root (0) root (0) 87661 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1qualified.html\n+-rw-r--r-- 0 root (0) root (0) 104007 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1qualified.html\n -rw-r--r-- 0 root (0) root (0) 1944 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1qualified.js\n -rw-r--r-- 0 root (0) root (0) 28685 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1qualified__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 24761 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1qualified__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1regex__validator-members.html\n--rw-r--r-- 0 root (0) root (0) 28192 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1regex__validator.html\n+-rw-r--r-- 0 root (0) root (0) 30412 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1regex__validator.html\n -rw-r--r-- 0 root (0) root (0) 574 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1regex__validator.js\n -rw-r--r-- 0 root (0) root (0) 2537 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1regex__validator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1752 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1regex__validator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7696 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1required__option__missing-members.html\n--rw-r--r-- 0 root (0) root (0) 12670 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1required__option__missing.html\n+-rw-r--r-- 0 root (0) root (0) 12865 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1required__option__missing.html\n -rw-r--r-- 0 root (0) root (0) 174 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1required__option__missing.js\n -rw-r--r-- 0 root (0) root (0) 3664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1required__option__missing__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2879 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1required__option__missing__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14349 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna15-members.html\n--rw-r--r-- 0 root (0) root (0) 47340 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna15.html\n+-rw-r--r-- 0 root (0) root (0) 54023 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna15.html\n -rw-r--r-- 0 root (0) root (0) 734 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna15.js\n -rw-r--r-- 0 root (0) root (0) 26180 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna15__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 22258 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna15__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14305 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna4-members.html\n--rw-r--r-- 0 root (0) root (0) 46643 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna4.html\n+-rw-r--r-- 0 root (0) root (0) 53326 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna4.html\n -rw-r--r-- 0 root (0) root (0) 719 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna4.js\n -rw-r--r-- 0 root (0) root (0) 26134 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna4__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 22213 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna4__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14305 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna5-members.html\n--rw-r--r-- 0 root (0) root (0) 47093 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna5.html\n+-rw-r--r-- 0 root (0) root (0) 53776 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna5.html\n -rw-r--r-- 0 root (0) root (0) 719 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna5.js\n -rw-r--r-- 0 root (0) root (0) 26162 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna5__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 22241 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1rna5__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__header-members.html\n--rw-r--r-- 0 root (0) root (0) 32751 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__header.html\n+-rw-r--r-- 0 root (0) root (0) 33856 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__header.html\n -rw-r--r-- 0 root (0) root (0) 2023 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__header.js\n -rw-r--r-- 0 root (0) root (0) 29520 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input-members.html\n--rw-r--r-- 0 root (0) root (0) 187441 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input.html\n+-rw-r--r-- 0 root (0) root (0) 206702 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input.html\n -rw-r--r-- 0 root (0) root (0) 5542 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input.js\n -rw-r--r-- 0 root (0) root (0) 7510 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input__format-members.html\n--rw-r--r-- 0 root (0) root (0) 27836 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input__format.html\n+-rw-r--r-- 0 root (0) root (0) 29786 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input__format.html\n -rw-r--r-- 0 root (0) root (0) 285 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__input__format.js\n -rw-r--r-- 0 root (0) root (0) 26150 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output-members.html\n--rw-r--r-- 0 root (0) root (0) 173448 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output.html\n+-rw-r--r-- 0 root (0) root (0) 197441 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output.html\n -rw-r--r-- 0 root (0) root (0) 4675 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output.js\n -rw-r--r-- 0 root (0) root (0) 7514 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output__format-members.html\n--rw-r--r-- 0 root (0) root (0) 23214 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output__format.html\n+-rw-r--r-- 0 root (0) root (0) 24709 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output__format.html\n -rw-r--r-- 0 root (0) root (0) 289 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__file__output__format.js\n -rw-r--r-- 0 root (0) root (0) 33093 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__record-members.html\n--rw-r--r-- 0 root (0) root (0) 157117 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__record.html\n+-rw-r--r-- 0 root (0) root (0) 184092 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__record.html\n -rw-r--r-- 0 root (0) root (0) 6630 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__record.js\n -rw-r--r-- 0 root (0) root (0) 11199 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__record__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 7272 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__record__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 20610 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__tag__dictionary-members.html\n--rw-r--r-- 0 root (0) root (0) 51889 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__tag__dictionary.html\n+-rw-r--r-- 0 root (0) root (0) 55375 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__tag__dictionary.html\n -rw-r--r-- 0 root (0) root (0) 647 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__tag__dictionary.js\n -rw-r--r-- 0 root (0) root (0) 3726 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__tag__dictionary__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2941 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sam__tag__dictionary__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1scoring__scheme__base-members.html\n--rw-r--r-- 0 root (0) root (0) 42905 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1scoring__scheme__base.html\n+-rw-r--r-- 0 root (0) root (0) 51745 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1scoring__scheme__base.html\n -rw-r--r-- 0 root (0) root (0) 2156 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1scoring__scheme__base.js\n -rw-r--r-- 0 root (0) root (0) 11675 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1scoring__scheme__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 7736 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1scoring__scheme__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1detail_1_1result__type-members.html\n--rw-r--r-- 0 root (0) root (0) 16509 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1detail_1_1result__type.html\n+-rw-r--r-- 0 root (0) root (0) 17809 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1detail_1_1result__type.html\n -rw-r--r-- 0 root (0) root (0) 920 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1detail_1_1result__type.js\n -rw-r--r-- 0 root (0) root (0) 3021 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1detail_1_1result__type__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2236 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1detail_1_1result__type__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9385 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit-members.html\n--rw-r--r-- 0 root (0) root (0) 25176 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit.html\n+-rw-r--r-- 0 root (0) root (0) 27126 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit.html\n -rw-r--r-- 0 root (0) root (0) 1053 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit.js\n -rw-r--r-- 0 root (0) root (0) 8186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all-members.html\n--rw-r--r-- 0 root (0) root (0) 12608 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all.html\n+-rw-r--r-- 0 root (0) root (0) 13453 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all.html\n -rw-r--r-- 0 root (0) root (0) 689 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all.js\n -rw-r--r-- 0 root (0) root (0) 8350 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__best-members.html\n--rw-r--r-- 0 root (0) root (0) 12810 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__best.html\n+-rw-r--r-- 0 root (0) root (0) 13655 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__best.html\n -rw-r--r-- 0 root (0) root (0) 751 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__best.js\n -rw-r--r-- 0 root (0) root (0) 2810 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__best__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2025 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__best__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 2762 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1977 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__all__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 2664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1879 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8440 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__single__best-members.html\n--rw-r--r-- 0 root (0) root (0) 12903 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__single__best.html\n+-rw-r--r-- 0 root (0) root (0) 13748 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__single__best.html\n -rw-r--r-- 0 root (0) root (0) 784 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__single__best.js\n -rw-r--r-- 0 root (0) root (0) 2824 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__single__best__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2039 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__single__best__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8948 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__strata-members.html\n--rw-r--r-- 0 root (0) root (0) 15543 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__strata.html\n+-rw-r--r-- 0 root (0) root (0) 16388 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__strata.html\n -rw-r--r-- 0 root (0) root (0) 943 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__strata.js\n -rw-r--r-- 0 root (0) root (0) 2804 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__strata__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2019 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1hit__strata__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9731 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__deletion-members.html\n--rw-r--r-- 0 root (0) root (0) 31349 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__deletion.html\n+-rw-r--r-- 0 root (0) root (0) 32626 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__deletion.html\n -rw-r--r-- 0 root (0) root (0) 1191 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__deletion.js\n -rw-r--r-- 0 root (0) root (0) 2803 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__deletion__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2018 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__deletion__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9772 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__insertion-members.html\n--rw-r--r-- 0 root (0) root (0) 31315 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__insertion.html\n+-rw-r--r-- 0 root (0) root (0) 32592 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__insertion.html\n -rw-r--r-- 0 root (0) root (0) 1207 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__insertion.js\n -rw-r--r-- 0 root (0) root (0) 2819 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__insertion__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2034 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__insertion__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9895 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__substitution-members.html\n--rw-r--r-- 0 root (0) root (0) 31438 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__substitution.html\n+-rw-r--r-- 0 root (0) root (0) 32715 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__substitution.html\n -rw-r--r-- 0 root (0) root (0) 1255 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__substitution.js\n -rw-r--r-- 0 root (0) root (0) 2818 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__substitution__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2033 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__substitution__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9608 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__total-members.html\n--rw-r--r-- 0 root (0) root (0) 31018 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__total.html\n+-rw-r--r-- 0 root (0) root (0) 32295 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__total.html\n -rw-r--r-- 0 root (0) root (0) 1143 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__total.js\n -rw-r--r-- 0 root (0) root (0) 2793 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__total__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2008 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1max__error__total__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9161 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1on__result-members.html\n--rw-r--r-- 0 root (0) root (0) 20237 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1on__result.html\n+-rw-r--r-- 0 root (0) root (0) 22110 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1on__result.html\n -rw-r--r-- 0 root (0) root (0) 930 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1on__result.js\n -rw-r--r-- 0 root (0) root (0) 2841 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1on__result__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2056 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1on__result__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8560 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__index__cursor-members.html\n--rw-r--r-- 0 root (0) root (0) 13564 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__index__cursor.html\n+-rw-r--r-- 0 root (0) root (0) 14409 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__index__cursor.html\n -rw-r--r-- 0 root (0) root (0) 828 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__index__cursor.js\n -rw-r--r-- 0 root (0) root (0) 2821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__index__cursor__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2036 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__index__cursor__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8440 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__query__id-members.html\n--rw-r--r-- 0 root (0) root (0) 13456 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__query__id.html\n+-rw-r--r-- 0 root (0) root (0) 14301 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__query__id.html\n -rw-r--r-- 0 root (0) root (0) 784 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__query__id.js\n -rw-r--r-- 0 root (0) root (0) 2807 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__query__id__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2022 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__query__id__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8934 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__begin__position-members.html\n--rw-r--r-- 0 root (0) root (0) 13899 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__begin__position.html\n+-rw-r--r-- 0 root (0) root (0) 14744 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__begin__position.html\n -rw-r--r-- 0 root (0) root (0) 967 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__begin__position.js\n -rw-r--r-- 0 root (0) root (0) 2977 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__begin__position__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2192 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__begin__position__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8560 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__id-members.html\n--rw-r--r-- 0 root (0) root (0) 13564 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__id.html\n+-rw-r--r-- 0 root (0) root (0) 14409 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__id.html\n -rw-r--r-- 0 root (0) root (0) 828 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__id.js\n -rw-r--r-- 0 root (0) root (0) 2821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__id__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2036 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__cfg_1_1output__reference__id__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 11958 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__result-members.html\n--rw-r--r-- 0 root (0) root (0) 24053 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__result.html\n+-rw-r--r-- 0 root (0) root (0) 29123 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__result.html\n -rw-r--r-- 0 root (0) root (0) 1266 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1search__result.js\n -rw-r--r-- 0 root (0) root (0) 14113 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1semialphabet__any-members.html\n--rw-r--r-- 0 root (0) root (0) 46755 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1semialphabet__any.html\n+-rw-r--r-- 0 root (0) root (0) 55074 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1semialphabet__any.html\n -rw-r--r-- 0 root (0) root (0) 906 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1semialphabet__any.js\n -rw-r--r-- 0 root (0) root (0) 12376 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1semialphabet__any__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 8441 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1semialphabet__any__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 21300 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input-members.html\n--rw-r--r-- 0 root (0) root (0) 108760 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input.html\n+-rw-r--r-- 0 root (0) root (0) 120158 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input.html\n -rw-r--r-- 0 root (0) root (0) 4027 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input.js\n -rw-r--r-- 0 root (0) root (0) 7234 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input__format-members.html\n--rw-r--r-- 0 root (0) root (0) 17128 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input__format.html\n+-rw-r--r-- 0 root (0) root (0) 18103 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input__format.html\n -rw-r--r-- 0 root (0) root (0) 299 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input__format.js\n -rw-r--r-- 0 root (0) root (0) 4290 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input__format__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3505 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__input__format__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 20172 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output-members.html\n--rw-r--r-- 0 root (0) root (0) 138214 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output.html\n+-rw-r--r-- 0 root (0) root (0) 157815 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output.html\n -rw-r--r-- 0 root (0) root (0) 3834 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output.js\n -rw-r--r-- 0 root (0) root (0) 7223 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output__format-members.html\n--rw-r--r-- 0 root (0) root (0) 16785 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output__format.html\n+-rw-r--r-- 0 root (0) root (0) 17630 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output__format.html\n -rw-r--r-- 0 root (0) root (0) 303 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output__format.js\n -rw-r--r-- 0 root (0) root (0) 4294 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output__format__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3509 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__file__output__format__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 16241 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__record-members.html\n--rw-r--r-- 0 root (0) root (0) 40361 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__record.html\n+-rw-r--r-- 0 root (0) root (0) 46081 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__record.html\n -rw-r--r-- 0 root (0) root (0) 1872 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__record.js\n -rw-r--r-- 0 root (0) root (0) 11233 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__record__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 7301 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1sequence__record__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 37155 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1shape-members.html\n--rw-r--r-- 0 root (0) root (0) 99640 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1shape.html\n+-rw-r--r-- 0 root (0) root (0) 121025 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1shape.html\n -rw-r--r-- 0 root (0) root (0) 826 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1shape.js\n -rw-r--r-- 0 root (0) root (0) 17363 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1shape__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 13443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1shape__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 34126 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__string-members.html\n--rw-r--r-- 0 root (0) root (0) 132382 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__string.html\n+-rw-r--r-- 0 root (0) root (0) 156046 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__string.html\n -rw-r--r-- 0 root (0) root (0) 2109 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__string.js\n -rw-r--r-- 0 root (0) root (0) 17952 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__string__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 14022 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__string__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 30702 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__vector-members.html\n--rw-r--r-- 0 root (0) root (0) 178376 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__vector.html\n+-rw-r--r-- 0 root (0) root (0) 220886 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__vector.html\n -rw-r--r-- 0 root (0) root (0) 6516 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__vector.js\n -rw-r--r-- 0 root (0) root (0) 16640 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__vector__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 12712 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1small__vector__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 21994 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input-members.html\n--rw-r--r-- 0 root (0) root (0) 120014 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input.html\n+-rw-r--r-- 0 root (0) root (0) 133404 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input.html\n -rw-r--r-- 0 root (0) root (0) 4365 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input.js\n -rw-r--r-- 0 root (0) root (0) 7400 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input__format-members.html\n--rw-r--r-- 0 root (0) root (0) 24713 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input__format.html\n+-rw-r--r-- 0 root (0) root (0) 25623 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input__format.html\n -rw-r--r-- 0 root (0) root (0) 303 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input__format.js\n -rw-r--r-- 0 root (0) root (0) 2737 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input__format__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1952 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__input__format__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 19165 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output-members.html\n--rw-r--r-- 0 root (0) root (0) 135455 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output.html\n+-rw-r--r-- 0 root (0) root (0) 151960 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output.html\n -rw-r--r-- 0 root (0) root (0) 3640 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output.js\n -rw-r--r-- 0 root (0) root (0) 7403 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output__format-members.html\n--rw-r--r-- 0 root (0) root (0) 23960 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output__format.html\n+-rw-r--r-- 0 root (0) root (0) 24610 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output__format.html\n -rw-r--r-- 0 root (0) root (0) 307 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output__format.js\n -rw-r--r-- 0 root (0) root (0) 2741 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output__format__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1956 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__file__output__format__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 19315 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__record-members.html\n--rw-r--r-- 0 root (0) root (0) 52406 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__record.html\n+-rw-r--r-- 0 root (0) root (0) 60986 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__record.html\n -rw-r--r-- 0 root (0) root (0) 2791 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__record.js\n -rw-r--r-- 0 root (0) root (0) 11241 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__record__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 7308 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structure__record__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 20036 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__aa-members.html\n--rw-r--r-- 0 root (0) root (0) 76288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__aa.html\n+-rw-r--r-- 0 root (0) root (0) 93250 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__aa.html\n -rw-r--r-- 0 root (0) root (0) 1877 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__aa.js\n -rw-r--r-- 0 root (0) root (0) 23018 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__aa__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 19090 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__aa__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 21473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__rna-members.html\n--rw-r--r-- 0 root (0) root (0) 81401 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__rna.html\n+-rw-r--r-- 0 root (0) root (0) 96605 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__rna.html\n -rw-r--r-- 0 root (0) root (0) 2217 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__rna.js\n -rw-r--r-- 0 root (0) root (0) 29720 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__rna__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 25790 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1structured__rna__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7648 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__few__arguments-members.html\n--rw-r--r-- 0 root (0) root (0) 12590 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__few__arguments.html\n+-rw-r--r-- 0 root (0) root (0) 12785 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__few__arguments.html\n -rw-r--r-- 0 root (0) root (0) 156 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__few__arguments.js\n -rw-r--r-- 0 root (0) root (0) 3538 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__few__arguments__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2753 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__few__arguments__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7656 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__many__arguments-members.html\n--rw-r--r-- 0 root (0) root (0) 12606 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__many__arguments.html\n+-rw-r--r-- 0 root (0) root (0) 12801 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__many__arguments.html\n -rw-r--r-- 0 root (0) root (0) 159 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__many__arguments.js\n -rw-r--r-- 0 root (0) root (0) 3532 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__many__arguments__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2747 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1too__many__arguments__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7620 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1unknown__option-members.html\n--rw-r--r-- 0 root (0) root (0) 12536 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1unknown__option.html\n+-rw-r--r-- 0 root (0) root (0) 12731 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1unknown__option.html\n -rw-r--r-- 0 root (0) root (0) 145 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1unknown__option.js\n -rw-r--r-- 0 root (0) root (0) 3535 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1unknown__option__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2750 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1unknown__option__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7640 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1user__input__error-members.html\n--rw-r--r-- 0 root (0) root (0) 12634 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1user__input__error.html\n+-rw-r--r-- 0 root (0) root (0) 12829 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1user__input__error.html\n -rw-r--r-- 0 root (0) root (0) 153 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1user__input__error.js\n -rw-r--r-- 0 root (0) root (0) 3664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1user__input__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2879 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1user__input__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7636 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1validation__error-members.html\n--rw-r--r-- 0 root (0) root (0) 12616 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1validation__error.html\n+-rw-r--r-- 0 root (0) root (0) 12811 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1validation__error.html\n -rw-r--r-- 0 root (0) root (0) 151 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1validation__error.js\n -rw-r--r-- 0 root (0) root (0) 3658 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1validation__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2873 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1validation__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 12957 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1value__list__validator-members.html\n--rw-r--r-- 0 root (0) root (0) 42973 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1value__list__validator.html\n+-rw-r--r-- 0 root (0) root (0) 47663 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1value__list__validator.html\n -rw-r--r-- 0 root (0) root (0) 1892 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1value__list__validator.js\n -rw-r--r-- 0 root (0) root (0) 2735 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1value__list__validator__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1950 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1value__list__validator__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8665 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1views_1_1deep-members.html\n--rw-r--r-- 0 root (0) root (0) 36179 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1views_1_1deep.html\n+-rw-r--r-- 0 root (0) root (0) 40646 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1views_1_1deep.html\n -rw-r--r-- 0 root (0) root (0) 700 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1views_1_1deep.js\n -rw-r--r-- 0 root (0) root (0) 7596 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1views_1_1deep__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1views_1_1deep__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 14271 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1wuss-members.html\n--rw-r--r-- 0 root (0) root (0) 52880 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1wuss.html\n+-rw-r--r-- 0 root (0) root (0) 61221 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1wuss.html\n -rw-r--r-- 0 root (0) root (0) 1351 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1wuss.js\n -rw-r--r-- 0 root (0) root (0) 21366 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1wuss__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 17444 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/classseqan3_1_1wuss__inherit__graph_org.svg\n--rw-r--r-- 0 root (0) root (0) 11714 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cleanup_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 14259 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cleanup_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 129 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/closed.png\n -rw-r--r-- 0 root (0) root (0) 6619 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/combined__score__and__trace__matrix_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 40678 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/combined__score__and__trace__matrix_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6412 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/common__pair_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10167 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/common__pair_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/common__tuple_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10609 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/common__tuple_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6406 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/complement_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12967 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/complement_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6472 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/concatenated__sequences_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 174513 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/concatenated__sequences_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 191730 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/concatenated__sequences_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 7246 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/concepts.html\n -rw-r--r-- 0 root (0) root (0) 6264 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/conceptseqan3_1_1nonrecursive__range.html\n -rw-r--r-- 0 root (0) root (0) 6244 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/conceptseqan3_1_1printable__with.html\n -rw-r--r-- 0 root (0) root (0) 6425 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 75499 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 81878 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6624 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration__element__debug__mode_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11434 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration__element__debug__mode_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6639 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration__element__parallel__mode_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12437 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration__element__parallel__mode_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6565 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration__utility_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10874 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/configuration__utility_8hpp_source.html\n--rw-r--r-- 0 root (0) root (0) 1635418 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cookbook.html\n+-rw-r--r-- 0 root (0) root (0) 1873222 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/cookbook.html\n -rw-r--r-- 0 root (0) root (0) 6543 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/coordinate__matrix_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 33362 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/coordinate__matrix_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6435 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/copyable__wrapper_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 41099 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/copyable__wrapper_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 990 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/copyfree_badge.svg\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2algorithm_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2algorithm_2all_8hpp_source.html\n@@ -946,64 +946,64 @@\n -rw-r--r-- 0 root (0) root (0) 6399 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2concept_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8990 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2concept_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2configuration_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8594 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2configuration_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6531 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2configuration_2detail_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9930 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2configuration_2detail_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6551 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2configuration_2detail_2concept_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 22323 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2configuration_2detail_2concept_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 23732 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2configuration_2detail_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2debug__stream_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10154 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2debug__stream_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6396 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2detail_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12272 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2detail_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2range_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8096 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2range_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6512 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2range_2detail_2misc_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11276 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2range_2detail_2misc_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6435 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2range_2type__traits_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 24004 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2range_2type__traits_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 24495 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/core_2range_2type__traits_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6450 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/customisation__point_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19137 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/customisation__point_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6518 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__matrix_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 77053 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__matrix_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 79543 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__matrix_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6317 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13256 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6482 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__alignment_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 29352 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__alignment_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 30153 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__alignment_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6466 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__alphabet_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 16575 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__alphabet_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 17604 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__alphabet_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6448 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__type_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 61144 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__type_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 62655 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/debug__stream__type_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6375 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/deep_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 29927 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/deep_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 34078 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/deep_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6469 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/default__configuration_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13786 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/default__configuration_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6436 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/default__printer_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 54300 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/default__printer_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 57126 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/default__printer_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/deferred__crtp__base_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12172 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/deferred__crtp__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 7126 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/deprecated.html\n -rw-r--r-- 0 root (0) root (0) 6550 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/detail_2fm__index__cursor_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15108 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/detail_2fm__index__cursor_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 34095 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/detail_2record_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6982 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000012_000100.html\n -rw-r--r-- 0 root (0) root (0) 6825 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000013_000032.html\n -rw-r--r-- 0 root (0) root (0) 6813 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000013_000100.html\n -rw-r--r-- 0 root (0) root (0) 7359 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000014_000016.html\n -rw-r--r-- 0 root (0) root (0) 6749 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000014_000035.html\n -rw-r--r-- 0 root (0) root (0) 7710 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000014_000100.html\n -rw-r--r-- 0 root (0) root (0) 7704 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000014.html\n--rw-r--r-- 0 root (0) root (0) 13361 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000016.html\n+-rw-r--r-- 0 root (0) root (0) 13356 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000016.html\n -rw-r--r-- 0 root (0) root (0) 15957 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000027.html\n--rw-r--r-- 0 root (0) root (0) 42221 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000035.html\n+-rw-r--r-- 0 root (0) root (0) 43040 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000035.html\n -rw-r--r-- 0 root (0) root (0) 7591 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000038.html\n -rw-r--r-- 0 root (0) root (0) 6820 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000068.html\n -rw-r--r-- 0 root (0) root (0) 17848 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000072.html\n--rw-r--r-- 0 root (0) root (0) 12434 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000074.html\n--rw-r--r-- 0 root (0) root (0) 36968 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000100.html\n+-rw-r--r-- 0 root (0) root (0) 16788 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000074.html\n+-rw-r--r-- 0 root (0) root (0) 38560 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000015_000100.html\n -rw-r--r-- 0 root (0) root (0) 7053 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000016_000012.html\n -rw-r--r-- 0 root (0) root (0) 7369 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000016_000017.html\n -rw-r--r-- 0 root (0) root (0) 6938 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000016_000022.html\n -rw-r--r-- 0 root (0) root (0) 8355 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000016_000025.html\n -rw-r--r-- 0 root (0) root (0) 6553 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000016_000030.html\n -rw-r--r-- 0 root (0) root (0) 13163 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000016_000035.html\n -rw-r--r-- 0 root (0) root (0) 7169 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000016_000068.html\n@@ -1120,33 +1120,34 @@\n -rw-r--r-- 0 root (0) root (0) 6706 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000052_000088.html\n -rw-r--r-- 0 root (0) root (0) 9964 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000053_000035.html\n -rw-r--r-- 0 root (0) root (0) 7045 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000053_000090.html\n -rw-r--r-- 0 root (0) root (0) 8254 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000053_000100.html\n -rw-r--r-- 0 root (0) root (0) 6664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000054_000016.html\n -rw-r--r-- 0 root (0) root (0) 8323 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000054_000029.html\n -rw-r--r-- 0 root (0) root (0) 8085 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000054_000035.html\n--rw-r--r-- 0 root (0) root (0) 7171 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000054_000064.html\n--rw-r--r-- 0 root (0) root (0) 6692 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000054_000100.html\n+-rw-r--r-- 0 root (0) root (0) 7420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000054_000064.html\n+-rw-r--r-- 0 root (0) root (0) 8035 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000054_000100.html\n -rw-r--r-- 0 root (0) root (0) 6810 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000055_000035.html\n -rw-r--r-- 0 root (0) root (0) 7212 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000056_000035.html\n -rw-r--r-- 0 root (0) root (0) 6857 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000057_000097.html\n -rw-r--r-- 0 root (0) root (0) 6724 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000058_000035.html\n -rw-r--r-- 0 root (0) root (0) 6900 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000060_000035.html\n -rw-r--r-- 0 root (0) root (0) 7035 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000062_000035.html\n -rw-r--r-- 0 root (0) root (0) 7993 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000064_000016.html\n -rw-r--r-- 0 root (0) root (0) 8260 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000064_000035.html\n -rw-r--r-- 0 root (0) root (0) 6880 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000064_000055.html\n--rw-r--r-- 0 root (0) root (0) 6985 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000064_000100.html\n+-rw-r--r-- 0 root (0) root (0) 6699 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000064_000100.html\n -rw-r--r-- 0 root (0) root (0) 6616 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000066_000025.html\n -rw-r--r-- 0 root (0) root (0) 6940 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000067_000085.html\n -rw-r--r-- 0 root (0) root (0) 6815 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000015.html\n -rw-r--r-- 0 root (0) root (0) 34327 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000016.html\n -rw-r--r-- 0 root (0) root (0) 7387 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000032.html\n -rw-r--r-- 0 root (0) root (0) 24852 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000035.html\n -rw-r--r-- 0 root (0) root (0) 9062 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000082.html\n+-rw-r--r-- 0 root (0) root (0) 7173 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000086.html\n -rw-r--r-- 0 root (0) root (0) 7326 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000088.html\n -rw-r--r-- 0 root (0) root (0) 35245 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000068_000100.html\n -rw-r--r-- 0 root (0) root (0) 6708 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000069_000100.html\n -rw-r--r-- 0 root (0) root (0) 6627 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000071_000025.html\n -rw-r--r-- 0 root (0) root (0) 6962 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000071_000100.html\n -rw-r--r-- 0 root (0) root (0) 6793 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000072_000014.html\n -rw-r--r-- 0 root (0) root (0) 7197 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000072_000016.html\n@@ -1155,19 +1156,20 @@\n -rw-r--r-- 0 root (0) root (0) 6749 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000072_000038.html\n -rw-r--r-- 0 root (0) root (0) 7111 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000072_000074.html\n -rw-r--r-- 0 root (0) root (0) 18979 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000072_000100.html\n -rw-r--r-- 0 root (0) root (0) 6669 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000073_000043.html\n -rw-r--r-- 0 root (0) root (0) 7553 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000073_000100.html\n -rw-r--r-- 0 root (0) root (0) 7060 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000016.html\n -rw-r--r-- 0 root (0) root (0) 12423 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000027.html\n--rw-r--r-- 0 root (0) root (0) 16198 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000035.html\n+-rw-r--r-- 0 root (0) root (0) 16841 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000035.html\n -rw-r--r-- 0 root (0) root (0) 6665 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000038.html\n--rw-r--r-- 0 root (0) root (0) 9080 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000041.html\n+-rw-r--r-- 0 root (0) root (0) 11694 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000041.html\n -rw-r--r-- 0 root (0) root (0) 15534 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000072.html\n--rw-r--r-- 0 root (0) root (0) 14689 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000100.html\n+-rw-r--r-- 0 root (0) root (0) 7625 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000083.html\n+-rw-r--r-- 0 root (0) root (0) 15929 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000074_000100.html\n -rw-r--r-- 0 root (0) root (0) 6925 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000075_000035.html\n -rw-r--r-- 0 root (0) root (0) 6584 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000075_000088.html\n -rw-r--r-- 0 root (0) root (0) 6740 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000075_000100.html\n -rw-r--r-- 0 root (0) root (0) 6645 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000077_000025.html\n -rw-r--r-- 0 root (0) root (0) 7712 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000077_000073.html\n -rw-r--r-- 0 root (0) root (0) 6708 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000079_000035.html\n -rw-r--r-- 0 root (0) root (0) 7260 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000080_000048.html\n@@ -1179,24 +1181,24 @@\n -rw-r--r-- 0 root (0) root (0) 7786 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000082_000050.html\n -rw-r--r-- 0 root (0) root (0) 7497 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000082_000051.html\n -rw-r--r-- 0 root (0) root (0) 6910 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000082_000086.html\n -rw-r--r-- 0 root (0) root (0) 6697 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000082_000088.html\n -rw-r--r-- 0 root (0) root (0) 7475 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000082_000090.html\n -rw-r--r-- 0 root (0) root (0) 14664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000082_000100.html\n -rw-r--r-- 0 root (0) root (0) 7983 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000082_000102.html\n--rw-r--r-- 0 root (0) root (0) 7854 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000083_000016.html\n+-rw-r--r-- 0 root (0) root (0) 7849 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000083_000016.html\n -rw-r--r-- 0 root (0) root (0) 7133 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000083_000027.html\n -rw-r--r-- 0 root (0) root (0) 8020 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000083_000035.html\n -rw-r--r-- 0 root (0) root (0) 7056 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000083_000100.html\n -rw-r--r-- 0 root (0) root (0) 9765 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000016.html\n -rw-r--r-- 0 root (0) root (0) 9785 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000029.html\n -rw-r--r-- 0 root (0) root (0) 21591 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000035.html\n -rw-r--r-- 0 root (0) root (0) 6996 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000054.html\n--rw-r--r-- 0 root (0) root (0) 8776 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000064.html\n--rw-r--r-- 0 root (0) root (0) 10300 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000100.html\n+-rw-r--r-- 0 root (0) root (0) 9111 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000064.html\n+-rw-r--r-- 0 root (0) root (0) 11613 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000084_000100.html\n -rw-r--r-- 0 root (0) root (0) 15410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000086_000016.html\n -rw-r--r-- 0 root (0) root (0) 9695 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000086_000035.html\n -rw-r--r-- 0 root (0) root (0) 9063 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000086_000050.html\n -rw-r--r-- 0 root (0) root (0) 6873 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000086_000082.html\n -rw-r--r-- 0 root (0) root (0) 6608 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000086_000088.html\n -rw-r--r-- 0 root (0) root (0) 7834 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000086_000090.html\n -rw-r--r-- 0 root (0) root (0) 12418 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_000086_000100.html\n@@ -1433,31 +1435,31 @@\n -rw-r--r-- 0 root (0) root (0) 8101 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_85ef47a9c2d752010843b8a859b47fe8.html\n -rw-r--r-- 0 root (0) root (0) 2162 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_85ef47a9c2d752010843b8a859b47fe8_dep.svg\n -rw-r--r-- 0 root (0) root (0) 1377 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_85ef47a9c2d752010843b8a859b47fe8_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 10219 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8ba85d2ecec3b95319d4763ad9fe6140.html\n -rw-r--r-- 0 root (0) root (0) 3355 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8ba85d2ecec3b95319d4763ad9fe6140_dep.svg\n -rw-r--r-- 0 root (0) root (0) 2570 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8ba85d2ecec3b95319d4763ad9fe6140_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 12713 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8f1ff721a3f2929a328ecb69c02200c2.html\n--rw-r--r-- 0 root (0) root (0) 14608 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8f1ff721a3f2929a328ecb69c02200c2_dep.svg\n--rw-r--r-- 0 root (0) root (0) 13823 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8f1ff721a3f2929a328ecb69c02200c2_dep_org.svg\n+-rw-r--r-- 0 root (0) root (0) 15894 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8f1ff721a3f2929a328ecb69c02200c2_dep.svg\n+-rw-r--r-- 0 root (0) root (0) 15109 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_8f1ff721a3f2929a328ecb69c02200c2_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 7777 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_908c05791ca7c0c3bbd17c62559fb6c7.html\n -rw-r--r-- 0 root (0) root (0) 2186 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_908c05791ca7c0c3bbd17c62559fb6c7_dep.svg\n -rw-r--r-- 0 root (0) root (0) 1401 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_908c05791ca7c0c3bbd17c62559fb6c7_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 11484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_930dae7ccd987a6f6383f2a2c8bca6d5.html\n -rw-r--r-- 0 root (0) root (0) 7000 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_930dae7ccd987a6f6383f2a2c8bca6d5_dep.svg\n -rw-r--r-- 0 root (0) root (0) 6215 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_930dae7ccd987a6f6383f2a2c8bca6d5_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 9325 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9585d42bab981d64af802c453a134f2e.html\n -rw-r--r-- 0 root (0) root (0) 8231 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9585d42bab981d64af802c453a134f2e_dep.svg\n -rw-r--r-- 0 root (0) root (0) 7446 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9585d42bab981d64af802c453a134f2e_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 8476 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_984e12e0c193cfcdd0edbfec1a0664ea.html\n -rw-r--r-- 0 root (0) root (0) 3378 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_984e12e0c193cfcdd0edbfec1a0664ea_dep.svg\n -rw-r--r-- 0 root (0) root (0) 2593 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_984e12e0c193cfcdd0edbfec1a0664ea_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 10893 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9bec6aa2c9631e9f07831be5361a9e6c.html\n--rw-r--r-- 0 root (0) root (0) 37520 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9bec6aa2c9631e9f07831be5361a9e6c_dep.svg\n--rw-r--r-- 0 root (0) root (0) 33593 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9bec6aa2c9631e9f07831be5361a9e6c_dep_org.svg\n+-rw-r--r-- 0 root (0) root (0) 38138 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9bec6aa2c9631e9f07831be5361a9e6c_dep.svg\n+-rw-r--r-- 0 root (0) root (0) 34211 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9bec6aa2c9631e9f07831be5361a9e6c_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 9385 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9e13226bfe09bbd43405119bd1c03415.html\n -rw-r--r-- 0 root (0) root (0) 5784 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9e13226bfe09bbd43405119bd1c03415_dep.svg\n -rw-r--r-- 0 root (0) root (0) 4999 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9e13226bfe09bbd43405119bd1c03415_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 7003 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9e169de4c1a1c7886d47a25a9640e26f.html\n -rw-r--r-- 0 root (0) root (0) 2233 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9e169de4c1a1c7886d47a25a9640e26f_dep.svg\n -rw-r--r-- 0 root (0) root (0) 1448 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9e169de4c1a1c7886d47a25a9640e26f_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 6990 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_9f527d592eed2e75625e3eafb5c5ea31.html\n@@ -1529,16 +1531,16 @@\n -rw-r--r-- 0 root (0) root (0) 8165 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_d70a966551a1322aaede7bcdceeab9b1.html\n -rw-r--r-- 0 root (0) root (0) 3380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_d70a966551a1322aaede7bcdceeab9b1_dep.svg\n -rw-r--r-- 0 root (0) root (0) 2595 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_d70a966551a1322aaede7bcdceeab9b1_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 9527 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_db8cd5170711c47b8946db705cccb675.html\n -rw-r--r-- 0 root (0) root (0) 6673 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_db8cd5170711c47b8946db705cccb675_dep.svg\n -rw-r--r-- 0 root (0) root (0) 5888 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_db8cd5170711c47b8946db705cccb675_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 10922 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_de29d56fbd3cb58f46340e352da0f7fa.html\n--rw-r--r-- 0 root (0) root (0) 41538 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_de29d56fbd3cb58f46340e352da0f7fa_dep.svg\n--rw-r--r-- 0 root (0) root (0) 37611 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_de29d56fbd3cb58f46340e352da0f7fa_dep_org.svg\n+-rw-r--r-- 0 root (0) root (0) 42114 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_de29d56fbd3cb58f46340e352da0f7fa_dep.svg\n+-rw-r--r-- 0 root (0) root (0) 38187 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_de29d56fbd3cb58f46340e352da0f7fa_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 7339 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_e0cea952db3b2bc19533a68935157212.html\n -rw-r--r-- 0 root (0) root (0) 4072 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_e0cea952db3b2bc19533a68935157212_dep.svg\n -rw-r--r-- 0 root (0) root (0) 3287 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_e0cea952db3b2bc19533a68935157212_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 6870 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_e23501bed30e920e2ed8bb2f3e3c3bda.html\n -rw-r--r-- 0 root (0) root (0) 2178 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_e23501bed30e920e2ed8bb2f3e3c3bda_dep.svg\n -rw-r--r-- 0 root (0) root (0) 1393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_e23501bed30e920e2ed8bb2f3e3c3bda_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 25093 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_e5ad27fc9ec399dc40ebf197420e3040.html\n@@ -1577,52 +1579,52 @@\n -rw-r--r-- 0 root (0) root (0) 8820 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_fdbe9eb7b55ea41f230dbb1c4e1bf559.html\n -rw-r--r-- 0 root (0) root (0) 3352 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_fdbe9eb7b55ea41f230dbb1c4e1bf559_dep.svg\n -rw-r--r-- 0 root (0) root (0) 2567 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_fdbe9eb7b55ea41f230dbb1c4e1bf559_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 8705 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_fed2193bc0b51c24d0dadcf5adc2b0d3.html\n -rw-r--r-- 0 root (0) root (0) 5766 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_fed2193bc0b51c24d0dadcf5adc2b0d3_dep.svg\n -rw-r--r-- 0 root (0) root (0) 4981 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dir_fed2193bc0b51c24d0dadcf5adc2b0d3_dep_org.svg\n -rw-r--r-- 0 root (0) root (0) 6386 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna15_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 39489 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna15_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 42623 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna15_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6401 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna16sam_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 35972 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna16sam_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 38802 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna16sam_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6391 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna3bs_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 40317 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna3bs_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 43147 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna3bs_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6381 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna4_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 43949 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna4_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 47235 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna4_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6381 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna5_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 37375 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna5_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 40509 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dna5_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 1503 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doc.svg\n -rw-r--r-- 0 root (0) root (0) 1503 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/docd.svg\n -rw-r--r-- 0 root (0) root (0) 6422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dot__bracket3_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 36711 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dot__bracket3_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 39265 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dot__bracket3_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 8469 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen-awesome-darkmode-toggle.js\n -rw-r--r-- 0 root (0) root (0) 4042 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen-awesome-fragment-copy-button.js\n -rw-r--r-- 0 root (0) root (0) 3471 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen-awesome-interactive-toc.js\n -rw-r--r-- 0 root (0) root (0) 2447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen-awesome-paragraph-link.js\n -rw-r--r-- 0 root (0) root (0) 3797 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen-awesome-tabs.js\n -rw-r--r-- 0 root (0) root (0) 67485 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen-awesome.css\n -rw-r--r-- 0 root (0) root (0) 45148 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen.css\n -rw-r--r-- 0 root (0) root (0) 15461 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/doxygen.svg\n -rw-r--r-- 0 root (0) root (0) 6385 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dssp9_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 27877 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dssp9_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 29975 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dssp9_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6431 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dynamic__bitset_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 220886 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dynamic__bitset_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 241950 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dynamic__bitset_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 7704 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/dynsections.js\n -rw-r--r-- 0 root (0) root (0) 6479 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__algorithm_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 20384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__algorithm_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6449 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__fwd_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 26114 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__fwd_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6619 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__score__matrix__full_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 33803 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__score__matrix__full_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6619 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__trace__matrix__full_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 49361 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__trace__matrix__full_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6474 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__unbanded_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 155687 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/edit__distance__unbanded_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6395 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/elements_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 14248 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/elements_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 14760 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/elements_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/empty__type_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8897 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/empty__type_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6464 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/enforce__random__access_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 43963 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/enforce__random__access_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 270 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/example.sam\n -rw-r--r-- 0 root (0) root (0) 6316 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/exceptions_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 32146 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/exceptions_8hpp_source.html\n@@ -1632,190 +1634,190 @@\n -rw-r--r-- 0 root (0) root (0) 13822 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/execution__handler__sequential_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6573 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fast__istreambuf__iterator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 45632 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fast__istreambuf__iterator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6573 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fast__ostreambuf__iterator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 33810 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fast__ostreambuf__iterator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 220725 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/files.html\n -rw-r--r-- 0 root (0) root (0) 6399 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fm__index_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 91017 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fm__index_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 100105 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fm__index_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6436 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fm__index__cursor_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 101238 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fm__index__cursor_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 116878 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/fm__index__cursor_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 1996 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/folderclosed.svg\n -rw-r--r-- 0 root (0) root (0) 1996 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/folderclosedd.svg\n -rw-r--r-- 0 root (0) root (0) 3269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/folderopen.svg\n -rw-r--r-- 0 root (0) root (0) 3214 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/folderopend.svg\n -rw-r--r-- 0 root (0) root (0) 1067 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_0.png\n -rw-r--r-- 0 root (0) root (0) 1118 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_0_dark.png\n -rw-r--r-- 0 root (0) root (0) 1983 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_1.png\n--rw-r--r-- 0 root (0) root (0) 4314 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_10.png\n--rw-r--r-- 0 root (0) root (0) 4534 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_10_dark.png\n--rw-r--r-- 0 root (0) root (0) 3936 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_11.png\n--rw-r--r-- 0 root (0) root (0) 4087 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_11_dark.png\n--rw-r--r-- 0 root (0) root (0) 1726 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_12.png\n--rw-r--r-- 0 root (0) root (0) 1767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_12_dark.png\n--rw-r--r-- 0 root (0) root (0) 1762 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_13.png\n--rw-r--r-- 0 root (0) root (0) 1767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_13_dark.png\n--rw-r--r-- 0 root (0) root (0) 1390 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_14.png\n--rw-r--r-- 0 root (0) root (0) 1449 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_14_dark.png\n--rw-r--r-- 0 root (0) root (0) 1288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_15.png\n--rw-r--r-- 0 root (0) root (0) 1370 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_15_dark.png\n--rw-r--r-- 0 root (0) root (0) 1401 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_16.png\n--rw-r--r-- 0 root (0) root (0) 1488 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_16_dark.png\n--rw-r--r-- 0 root (0) root (0) 4459 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_17.png\n--rw-r--r-- 0 root (0) root (0) 4670 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_17_dark.png\n--rw-r--r-- 0 root (0) root (0) 4426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_18.png\n--rw-r--r-- 0 root (0) root (0) 4610 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_18_dark.png\n--rw-r--r-- 0 root (0) root (0) 2234 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_19.png\n--rw-r--r-- 0 root (0) root (0) 2317 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_19_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1331 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_10.png\n+-rw-r--r-- 0 root (0) root (0) 1390 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_10_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1850 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_11.png\n+-rw-r--r-- 0 root (0) root (0) 1865 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_11_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_12.png\n+-rw-r--r-- 0 root (0) root (0) 1370 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_12_dark.png\n+-rw-r--r-- 0 root (0) root (0) 539 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_13.png\n+-rw-r--r-- 0 root (0) root (0) 583 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_13_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1726 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_14.png\n+-rw-r--r-- 0 root (0) root (0) 1767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_14_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1762 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_15.png\n+-rw-r--r-- 0 root (0) root (0) 1767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_15_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1390 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_16.png\n+-rw-r--r-- 0 root (0) root (0) 1449 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_16_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1606 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_17.png\n+-rw-r--r-- 0 root (0) root (0) 1689 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_17_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1401 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_18.png\n+-rw-r--r-- 0 root (0) root (0) 1488 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_18_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1358 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_19.png\n+-rw-r--r-- 0 root (0) root (0) 1402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_19_dark.png\n -rw-r--r-- 0 root (0) root (0) 2055 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_1_dark.png\n -rw-r--r-- 0 root (0) root (0) 1288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_2.png\n--rw-r--r-- 0 root (0) root (0) 1550 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_20.png\n--rw-r--r-- 0 root (0) root (0) 1598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_20_dark.png\n--rw-r--r-- 0 root (0) root (0) 3100 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_21.png\n--rw-r--r-- 0 root (0) root (0) 3209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_21_dark.png\n--rw-r--r-- 0 root (0) root (0) 2327 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_22.png\n--rw-r--r-- 0 root (0) root (0) 2365 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_22_dark.png\n--rw-r--r-- 0 root (0) root (0) 1205 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_23.png\n--rw-r--r-- 0 root (0) root (0) 1256 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_23_dark.png\n--rw-r--r-- 0 root (0) root (0) 1582 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_24.png\n--rw-r--r-- 0 root (0) root (0) 1651 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_24_dark.png\n--rw-r--r-- 0 root (0) root (0) 3044 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_25.png\n--rw-r--r-- 0 root (0) root (0) 3162 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_25_dark.png\n--rw-r--r-- 0 root (0) root (0) 2296 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_26.png\n--rw-r--r-- 0 root (0) root (0) 2432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_26_dark.png\n--rw-r--r-- 0 root (0) root (0) 1295 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_27.png\n--rw-r--r-- 0 root (0) root (0) 1350 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_27_dark.png\n--rw-r--r-- 0 root (0) root (0) 614 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_28.png\n--rw-r--r-- 0 root (0) root (0) 658 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_28_dark.png\n--rw-r--r-- 0 root (0) root (0) 2037 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_29.png\n--rw-r--r-- 0 root (0) root (0) 2058 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_29_dark.png\n+-rw-r--r-- 0 root (0) root (0) 509 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_20.png\n+-rw-r--r-- 0 root (0) root (0) 563 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_20_dark.png\n+-rw-r--r-- 0 root (0) root (0) 4314 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_21.png\n+-rw-r--r-- 0 root (0) root (0) 4534 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_21_dark.png\n+-rw-r--r-- 0 root (0) root (0) 4459 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_22.png\n+-rw-r--r-- 0 root (0) root (0) 4670 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_22_dark.png\n+-rw-r--r-- 0 root (0) root (0) 4426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_23.png\n+-rw-r--r-- 0 root (0) root (0) 4610 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_23_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2234 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_24.png\n+-rw-r--r-- 0 root (0) root (0) 2317 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_24_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1550 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_25.png\n+-rw-r--r-- 0 root (0) root (0) 1598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_25_dark.png\n+-rw-r--r-- 0 root (0) root (0) 3100 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_26.png\n+-rw-r--r-- 0 root (0) root (0) 3209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_26_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2327 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_27.png\n+-rw-r--r-- 0 root (0) root (0) 2365 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_27_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1205 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_28.png\n+-rw-r--r-- 0 root (0) root (0) 1256 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_28_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1582 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_29.png\n+-rw-r--r-- 0 root (0) root (0) 1651 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_29_dark.png\n -rw-r--r-- 0 root (0) root (0) 1370 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_2_dark.png\n -rw-r--r-- 0 root (0) root (0) 1245 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_3.png\n--rw-r--r-- 0 root (0) root (0) 1311 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_30.png\n--rw-r--r-- 0 root (0) root (0) 1370 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_30_dark.png\n--rw-r--r-- 0 root (0) root (0) 529 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_31.png\n--rw-r--r-- 0 root (0) root (0) 574 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_31_dark.png\n--rw-r--r-- 0 root (0) root (0) 1553 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_32.png\n--rw-r--r-- 0 root (0) root (0) 1590 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_32_dark.png\n--rw-r--r-- 0 root (0) root (0) 1331 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_33.png\n--rw-r--r-- 0 root (0) root (0) 1390 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_33_dark.png\n--rw-r--r-- 0 root (0) root (0) 1850 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_34.png\n--rw-r--r-- 0 root (0) root (0) 1865 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_34_dark.png\n--rw-r--r-- 0 root (0) root (0) 539 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_35.png\n--rw-r--r-- 0 root (0) root (0) 583 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_35_dark.png\n--rw-r--r-- 0 root (0) root (0) 2885 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_36.png\n--rw-r--r-- 0 root (0) root (0) 2893 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_36_dark.png\n--rw-r--r-- 0 root (0) root (0) 1942 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_37.png\n--rw-r--r-- 0 root (0) root (0) 1976 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_37_dark.png\n+-rw-r--r-- 0 root (0) root (0) 3044 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_30.png\n+-rw-r--r-- 0 root (0) root (0) 3162 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_30_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2296 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_31.png\n+-rw-r--r-- 0 root (0) root (0) 2432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_31_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1295 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_32.png\n+-rw-r--r-- 0 root (0) root (0) 1350 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_32_dark.png\n+-rw-r--r-- 0 root (0) root (0) 3936 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_33.png\n+-rw-r--r-- 0 root (0) root (0) 4087 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_33_dark.png\n+-rw-r--r-- 0 root (0) root (0) 539 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_34.png\n+-rw-r--r-- 0 root (0) root (0) 583 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_34_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2332 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_35.png\n+-rw-r--r-- 0 root (0) root (0) 2338 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_35_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1942 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_36.png\n+-rw-r--r-- 0 root (0) root (0) 1976 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_36_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2885 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_37.png\n+-rw-r--r-- 0 root (0) root (0) 2893 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_37_dark.png\n -rw-r--r-- 0 root (0) root (0) 536 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_38.png\n -rw-r--r-- 0 root (0) root (0) 606 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_38_dark.png\n -rw-r--r-- 0 root (0) root (0) 2722 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_39.png\n -rw-r--r-- 0 root (0) root (0) 2797 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_39_dark.png\n -rw-r--r-- 0 root (0) root (0) 1300 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_3_dark.png\n -rw-r--r-- 0 root (0) root (0) 1819 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_4.png\n -rw-r--r-- 0 root (0) root (0) 3143 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_40.png\n -rw-r--r-- 0 root (0) root (0) 3208 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_40_dark.png\n--rw-r--r-- 0 root (0) root (0) 1065 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_41.png\n--rw-r--r-- 0 root (0) root (0) 1164 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_41_dark.png\n--rw-r--r-- 0 root (0) root (0) 754 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_42.png\n--rw-r--r-- 0 root (0) root (0) 857 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_42_dark.png\n--rw-r--r-- 0 root (0) root (0) 2296 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_43.png\n--rw-r--r-- 0 root (0) root (0) 2376 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_43_dark.png\n--rw-r--r-- 0 root (0) root (0) 430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_44.png\n--rw-r--r-- 0 root (0) root (0) 479 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_44_dark.png\n--rw-r--r-- 0 root (0) root (0) 4283 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_45.png\n--rw-r--r-- 0 root (0) root (0) 4252 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_45_dark.png\n--rw-r--r-- 0 root (0) root (0) 3540 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_46.png\n--rw-r--r-- 0 root (0) root (0) 3598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_46_dark.png\n--rw-r--r-- 0 root (0) root (0) 4563 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_47.png\n--rw-r--r-- 0 root (0) root (0) 4567 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_47_dark.png\n--rw-r--r-- 0 root (0) root (0) 8808 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_48.png\n--rw-r--r-- 0 root (0) root (0) 8671 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_48_dark.png\n--rw-r--r-- 0 root (0) root (0) 7501 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_49.png\n--rw-r--r-- 0 root (0) root (0) 7490 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_49_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2296 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_41.png\n+-rw-r--r-- 0 root (0) root (0) 2376 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_41_dark.png\n+-rw-r--r-- 0 root (0) root (0) 430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_42.png\n+-rw-r--r-- 0 root (0) root (0) 479 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_42_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1065 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_43.png\n+-rw-r--r-- 0 root (0) root (0) 1164 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_43_dark.png\n+-rw-r--r-- 0 root (0) root (0) 754 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_44.png\n+-rw-r--r-- 0 root (0) root (0) 857 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_44_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1853 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_45.png\n+-rw-r--r-- 0 root (0) root (0) 1851 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_45_dark.png\n+-rw-r--r-- 0 root (0) root (0) 427 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_46.png\n+-rw-r--r-- 0 root (0) root (0) 473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_46_dark.png\n+-rw-r--r-- 0 root (0) root (0) 426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_47.png\n+-rw-r--r-- 0 root (0) root (0) 461 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_47_dark.png\n+-rw-r--r-- 0 root (0) root (0) 4283 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_48.png\n+-rw-r--r-- 0 root (0) root (0) 4252 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_48_dark.png\n+-rw-r--r-- 0 root (0) root (0) 3540 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_49.png\n+-rw-r--r-- 0 root (0) root (0) 3598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_49_dark.png\n -rw-r--r-- 0 root (0) root (0) 1923 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_4_dark.png\n--rw-r--r-- 0 root (0) root (0) 539 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_5.png\n--rw-r--r-- 0 root (0) root (0) 3620 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_50.png\n--rw-r--r-- 0 root (0) root (0) 3769 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_50_dark.png\n--rw-r--r-- 0 root (0) root (0) 480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_51.png\n--rw-r--r-- 0 root (0) root (0) 518 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_51_dark.png\n--rw-r--r-- 0 root (0) root (0) 4517 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_52.png\n--rw-r--r-- 0 root (0) root (0) 4619 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_52_dark.png\n--rw-r--r-- 0 root (0) root (0) 1853 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_53.png\n--rw-r--r-- 0 root (0) root (0) 1851 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_53_dark.png\n--rw-r--r-- 0 root (0) root (0) 427 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_54.png\n--rw-r--r-- 0 root (0) root (0) 473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_54_dark.png\n--rw-r--r-- 0 root (0) root (0) 426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_55.png\n--rw-r--r-- 0 root (0) root (0) 461 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_55_dark.png\n+-rw-r--r-- 0 root (0) root (0) 614 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_5.png\n+-rw-r--r-- 0 root (0) root (0) 4563 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_50.png\n+-rw-r--r-- 0 root (0) root (0) 4567 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_50_dark.png\n+-rw-r--r-- 0 root (0) root (0) 8808 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_51.png\n+-rw-r--r-- 0 root (0) root (0) 8671 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_51_dark.png\n+-rw-r--r-- 0 root (0) root (0) 7501 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_52.png\n+-rw-r--r-- 0 root (0) root (0) 7490 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_52_dark.png\n+-rw-r--r-- 0 root (0) root (0) 3620 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_53.png\n+-rw-r--r-- 0 root (0) root (0) 3769 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_53_dark.png\n+-rw-r--r-- 0 root (0) root (0) 480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_54.png\n+-rw-r--r-- 0 root (0) root (0) 518 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_54_dark.png\n+-rw-r--r-- 0 root (0) root (0) 4517 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_55.png\n+-rw-r--r-- 0 root (0) root (0) 4619 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_55_dark.png\n -rw-r--r-- 0 root (0) root (0) 1919 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_56.png\n -rw-r--r-- 0 root (0) root (0) 1901 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_56_dark.png\n -rw-r--r-- 0 root (0) root (0) 1842 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_57.png\n -rw-r--r-- 0 root (0) root (0) 1972 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_57_dark.png\n -rw-r--r-- 0 root (0) root (0) 1855 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_58.png\n -rw-r--r-- 0 root (0) root (0) 1891 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_58_dark.png\n -rw-r--r-- 0 root (0) root (0) 1515 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_59.png\n -rw-r--r-- 0 root (0) root (0) 1642 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_59_dark.png\n--rw-r--r-- 0 root (0) root (0) 583 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_5_dark.png\n--rw-r--r-- 0 root (0) root (0) 2332 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_6.png\n--rw-r--r-- 0 root (0) root (0) 2668 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_60.png\n--rw-r--r-- 0 root (0) root (0) 2742 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_60_dark.png\n--rw-r--r-- 0 root (0) root (0) 1067 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_61.png\n--rw-r--r-- 0 root (0) root (0) 1118 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_61_dark.png\n+-rw-r--r-- 0 root (0) root (0) 658 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_5_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2037 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_6.png\n+-rw-r--r-- 0 root (0) root (0) 1067 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_60.png\n+-rw-r--r-- 0 root (0) root (0) 1118 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_60_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1065 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_61.png\n+-rw-r--r-- 0 root (0) root (0) 1164 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_61_dark.png\n -rw-r--r-- 0 root (0) root (0) 693 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_62.png\n -rw-r--r-- 0 root (0) root (0) 768 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_62_dark.png\n -rw-r--r-- 0 root (0) root (0) 693 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_63.png\n -rw-r--r-- 0 root (0) root (0) 738 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_63_dark.png\n -rw-r--r-- 0 root (0) root (0) 740 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_64.png\n -rw-r--r-- 0 root (0) root (0) 844 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_64_dark.png\n -rw-r--r-- 0 root (0) root (0) 729 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_65.png\n -rw-r--r-- 0 root (0) root (0) 821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_65_dark.png\n -rw-r--r-- 0 root (0) root (0) 415 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_66.png\n -rw-r--r-- 0 root (0) root (0) 454 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_66_dark.png\n -rw-r--r-- 0 root (0) root (0) 3010 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_67.png\n -rw-r--r-- 0 root (0) root (0) 3183 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_67_dark.png\n--rw-r--r-- 0 root (0) root (0) 1065 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_68.png\n--rw-r--r-- 0 root (0) root (0) 1164 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_68_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2668 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_68.png\n+-rw-r--r-- 0 root (0) root (0) 2742 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_68_dark.png\n -rw-r--r-- 0 root (0) root (0) 1664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_69.png\n -rw-r--r-- 0 root (0) root (0) 1601 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_69_dark.png\n--rw-r--r-- 0 root (0) root (0) 2338 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_6_dark.png\n--rw-r--r-- 0 root (0) root (0) 1606 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_7.png\n--rw-r--r-- 0 root (0) root (0) 1689 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_7_dark.png\n--rw-r--r-- 0 root (0) root (0) 1358 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_8.png\n--rw-r--r-- 0 root (0) root (0) 1402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_8_dark.png\n--rw-r--r-- 0 root (0) root (0) 509 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_9.png\n--rw-r--r-- 0 root (0) root (0) 563 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_9_dark.png\n+-rw-r--r-- 0 root (0) root (0) 2058 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_6_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1311 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_7.png\n+-rw-r--r-- 0 root (0) root (0) 1370 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_7_dark.png\n+-rw-r--r-- 0 root (0) root (0) 529 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_8.png\n+-rw-r--r-- 0 root (0) root (0) 574 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_8_dark.png\n+-rw-r--r-- 0 root (0) root (0) 1553 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_9.png\n+-rw-r--r-- 0 root (0) root (0) 1590 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/form_9_dark.png\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__bam_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 249021 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__bam_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 267076 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__bam_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6421 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__base_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 90074 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6415 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__embl_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 71506 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__embl_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 79934 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__embl_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__fasta_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 88319 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__fasta_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 89899 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__fasta_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__fastq_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 92660 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__fastq_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 102946 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__fastq_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__genbank_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 69115 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__genbank_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 75138 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__genbank_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6421 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__help_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 81924 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__help_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6421 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__html_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 43945 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__html_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__man_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 30017 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__man_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__parse_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 109716 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__parse_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 110137 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__parse_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__sam_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 212669 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__sam_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 228113 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__sam_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6530 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__sam__base_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 125411 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__sam__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__vienna_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 94865 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__vienna_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 102462 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/format__vienna_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 2488 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/formula.repository\n -rw-r--r-- 0 root (0) root (0) 6438 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/function__traits_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 16236 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/function__traits_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 16658 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/function__traits_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 19291 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions.html\n -rw-r--r-- 0 root (0) root (0) 15579 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_b.html\n -rw-r--r-- 0 root (0) root (0) 23630 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_c.html\n -rw-r--r-- 0 root (0) root (0) 12242 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_d.html\n -rw-r--r-- 0 root (0) root (0) 879 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_dup.js\n -rw-r--r-- 0 root (0) root (0) 14677 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_e.html\n -rw-r--r-- 0 root (0) root (0) 16993 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_f.html\n@@ -1876,60 +1878,60 @@\n -rw-r--r-- 0 root (0) root (0) 6214 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_type_w.html\n -rw-r--r-- 0 root (0) root (0) 7904 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_u.html\n -rw-r--r-- 0 root (0) root (0) 11443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_v.html\n -rw-r--r-- 0 root (0) root (0) 28259 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_vars.html\n -rw-r--r-- 0 root (0) root (0) 7854 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_w.html\n -rw-r--r-- 0 root (0) root (0) 26317 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/functions_~.html\n -rw-r--r-- 0 root (0) root (0) 6369 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gap_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 18656 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gap_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 19082 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gap_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6428 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gap__decorator_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 122686 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gap__decorator_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 136065 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gap__decorator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gapped_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 12982 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gapped_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 12997 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gapped_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 9815 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/globals.html\n -rw-r--r-- 0 root (0) root (0) 9650 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/globals_defs.html\n -rw-r--r-- 0 root (0) root (0) 6151 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/globals_vars.html\n -rw-r--r-- 0 root (0) root (0) 10380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/graph_legend.html\n -rw-r--r-- 0 root (0) root (0) 6563 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/graph_legend.svg\n--rw-r--r-- 0 root (0) root (0) 20699 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment.html\n+-rw-r--r-- 0 root (0) root (0) 21802 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment.html\n -rw-r--r-- 0 root (0) root (0) 671 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment.js\n -rw-r--r-- 0 root (0) root (0) 7318 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment.svg\n -rw-r--r-- 0 root (0) root (0) 44806 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__aligned__sequence.html\n -rw-r--r-- 0 root (0) root (0) 3025 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__aligned__sequence.js\n -rw-r--r-- 0 root (0) root (0) 2465 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__aligned__sequence.svg\n -rw-r--r-- 0 root (0) root (0) 1680 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__aligned__sequence_org.svg\n--rw-r--r-- 0 root (0) root (0) 46376 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__configuration.html\n+-rw-r--r-- 0 root (0) root (0) 47469 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__configuration.html\n -rw-r--r-- 0 root (0) root (0) 18175 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__configuration.js\n -rw-r--r-- 0 root (0) root (0) 2454 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__configuration.svg\n -rw-r--r-- 0 root (0) root (0) 1669 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__configuration_org.svg\n -rw-r--r-- 0 root (0) root (0) 8287 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__decorator.html\n -rw-r--r-- 0 root (0) root (0) 3285 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__decorator.js\n -rw-r--r-- 0 root (0) root (0) 2429 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__decorator.svg\n -rw-r--r-- 0 root (0) root (0) 1644 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__decorator_org.svg\n -rw-r--r-- 0 root (0) root (0) 9610 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__matrix.html\n -rw-r--r-- 0 root (0) root (0) 1412 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__matrix.js\n -rw-r--r-- 0 root (0) root (0) 2451 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__matrix.svg\n -rw-r--r-- 0 root (0) root (0) 1666 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__matrix_org.svg\n--rw-r--r-- 0 root (0) root (0) 101876 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__pairwise.html\n+-rw-r--r-- 0 root (0) root (0) 109145 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__pairwise.html\n -rw-r--r-- 0 root (0) root (0) 2298 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__pairwise.js\n -rw-r--r-- 0 root (0) root (0) 2478 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__pairwise.svg\n -rw-r--r-- 0 root (0) root (0) 1693 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__pairwise_org.svg\n--rw-r--r-- 0 root (0) root (0) 35809 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__scoring.html\n+-rw-r--r-- 0 root (0) root (0) 35939 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__scoring.html\n -rw-r--r-- 0 root (0) root (0) 7229 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__scoring.js\n -rw-r--r-- 0 root (0) root (0) 2435 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__scoring.svg\n -rw-r--r-- 0 root (0) root (0) 1650 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment__scoring_org.svg\n -rw-r--r-- 0 root (0) root (0) 6533 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alignment_org.svg\n--rw-r--r-- 0 root (0) root (0) 103100 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet.html\n+-rw-r--r-- 0 root (0) root (0) 109549 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet.html\n -rw-r--r-- 0 root (0) root (0) 6614 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet.js\n -rw-r--r-- 0 root (0) root (0) 10902 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet.svg\n -rw-r--r-- 0 root (0) root (0) 8488 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__adaptation.html\n -rw-r--r-- 0 root (0) root (0) 273 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__adaptation.js\n -rw-r--r-- 0 root (0) root (0) 2308 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__adaptation.svg\n -rw-r--r-- 0 root (0) root (0) 1523 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__adaptation_org.svg\n--rw-r--r-- 0 root (0) root (0) 37721 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__aminoacid.html\n+-rw-r--r-- 0 root (0) root (0) 40506 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__aminoacid.html\n -rw-r--r-- 0 root (0) root (0) 3479 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__aminoacid.js\n -rw-r--r-- 0 root (0) root (0) 2324 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__aminoacid.svg\n -rw-r--r-- 0 root (0) root (0) 1539 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__aminoacid_org.svg\n -rw-r--r-- 0 root (0) root (0) 12498 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__cigar.html\n -rw-r--r-- 0 root (0) root (0) 1596 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__cigar.js\n -rw-r--r-- 0 root (0) root (0) 2303 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__cigar.svg\n -rw-r--r-- 0 root (0) root (0) 1518 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__cigar_org.svg\n@@ -1937,117 +1939,117 @@\n -rw-r--r-- 0 root (0) root (0) 6133 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__composite.js\n -rw-r--r-- 0 root (0) root (0) 2318 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__composite.svg\n -rw-r--r-- 0 root (0) root (0) 1533 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__composite_org.svg\n -rw-r--r-- 0 root (0) root (0) 8515 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__container.html\n -rw-r--r-- 0 root (0) root (0) 14970 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__container.js\n -rw-r--r-- 0 root (0) root (0) 2266 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__container.svg\n -rw-r--r-- 0 root (0) root (0) 1481 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__container_org.svg\n--rw-r--r-- 0 root (0) root (0) 17265 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__gap.html\n+-rw-r--r-- 0 root (0) root (0) 17102 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__gap.html\n -rw-r--r-- 0 root (0) root (0) 701 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__gap.js\n -rw-r--r-- 0 root (0) root (0) 2303 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__gap.svg\n -rw-r--r-- 0 root (0) root (0) 1518 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__gap_org.svg\n--rw-r--r-- 0 root (0) root (0) 15869 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__mask.html\n+-rw-r--r-- 0 root (0) root (0) 15949 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__mask.html\n -rw-r--r-- 0 root (0) root (0) 1951 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__mask.js\n -rw-r--r-- 0 root (0) root (0) 2303 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__mask.svg\n -rw-r--r-- 0 root (0) root (0) 1518 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__mask_org.svg\n--rw-r--r-- 0 root (0) root (0) 43055 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__nucleotide.html\n+-rw-r--r-- 0 root (0) root (0) 43964 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__nucleotide.html\n -rw-r--r-- 0 root (0) root (0) 6711 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__nucleotide.js\n -rw-r--r-- 0 root (0) root (0) 2295 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__nucleotide.svg\n -rw-r--r-- 0 root (0) root (0) 1510 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__nucleotide_org.svg\n--rw-r--r-- 0 root (0) root (0) 50487 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__quality.html\n+-rw-r--r-- 0 root (0) root (0) 52632 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__quality.html\n -rw-r--r-- 0 root (0) root (0) 7110 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__quality.js\n -rw-r--r-- 0 root (0) root (0) 2275 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__quality.svg\n -rw-r--r-- 0 root (0) root (0) 1490 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__quality_org.svg\n -rw-r--r-- 0 root (0) root (0) 8209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__range.html\n -rw-r--r-- 0 root (0) root (0) 283 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__range.js\n -rw-r--r-- 0 root (0) root (0) 2254 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__range.svg\n -rw-r--r-- 0 root (0) root (0) 1469 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__range_org.svg\n--rw-r--r-- 0 root (0) root (0) 47691 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__structure.html\n+-rw-r--r-- 0 root (0) root (0) 51930 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__structure.html\n -rw-r--r-- 0 root (0) root (0) 8142 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__structure.js\n -rw-r--r-- 0 root (0) root (0) 2316 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__structure.svg\n -rw-r--r-- 0 root (0) root (0) 1531 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__structure_org.svg\n--rw-r--r-- 0 root (0) root (0) 170307 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__views.html\n+-rw-r--r-- 0 root (0) root (0) 187765 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__views.html\n -rw-r--r-- 0 root (0) root (0) 1356 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__views.js\n -rw-r--r-- 0 root (0) root (0) 2250 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__views.svg\n -rw-r--r-- 0 root (0) root (0) 1465 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet__views_org.svg\n -rw-r--r-- 0 root (0) root (0) 10117 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__alphabet_org.svg\n--rw-r--r-- 0 root (0) root (0) 78429 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__argument__parser.html\n+-rw-r--r-- 0 root (0) root (0) 82092 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__argument__parser.html\n -rw-r--r-- 0 root (0) root (0) 19034 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__argument__parser.js\n--rw-r--r-- 0 root (0) root (0) 60836 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__cigar__conversion.html\n+-rw-r--r-- 0 root (0) root (0) 69989 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__cigar__conversion.html\n -rw-r--r-- 0 root (0) root (0) 907 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__cigar__conversion.js\n -rw-r--r-- 0 root (0) root (0) 2496 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__cigar__conversion.svg\n -rw-r--r-- 0 root (0) root (0) 1711 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__cigar__conversion_org.svg\n -rw-r--r-- 0 root (0) root (0) 12201 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core.html\n -rw-r--r-- 0 root (0) root (0) 602 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core.js\n -rw-r--r-- 0 root (0) root (0) 5326 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core.svg\n -rw-r--r-- 0 root (0) root (0) 7948 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__algorithm.html\n -rw-r--r-- 0 root (0) root (0) 5473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__algorithm.js\n -rw-r--r-- 0 root (0) root (0) 2336 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__algorithm.svg\n -rw-r--r-- 0 root (0) root (0) 1551 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__algorithm_org.svg\n -rw-r--r-- 0 root (0) root (0) 9908 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__concept.html\n -rw-r--r-- 0 root (0) root (0) 439 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__concept.js\n -rw-r--r-- 0 root (0) root (0) 2299 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__concept.svg\n -rw-r--r-- 0 root (0) root (0) 1514 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__concept_org.svg\n--rw-r--r-- 0 root (0) root (0) 45354 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__configuration.html\n+-rw-r--r-- 0 root (0) root (0) 47856 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__configuration.html\n -rw-r--r-- 0 root (0) root (0) 2363 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__configuration.js\n -rw-r--r-- 0 root (0) root (0) 2358 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__configuration.svg\n -rw-r--r-- 0 root (0) root (0) 1573 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__configuration_org.svg\n--rw-r--r-- 0 root (0) root (0) 23698 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__debug__stream.html\n+-rw-r--r-- 0 root (0) root (0) 23828 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__debug__stream.html\n -rw-r--r-- 0 root (0) root (0) 6876 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__debug__stream.js\n -rw-r--r-- 0 root (0) root (0) 2357 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__debug__stream.svg\n -rw-r--r-- 0 root (0) root (0) 1572 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__debug__stream_org.svg\n--rw-r--r-- 0 root (0) root (0) 13088 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__range.html\n+-rw-r--r-- 0 root (0) root (0) 13803 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__range.html\n -rw-r--r-- 0 root (0) root (0) 452 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__range.js\n -rw-r--r-- 0 root (0) root (0) 2326 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__range.svg\n -rw-r--r-- 0 root (0) root (0) 1541 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core__range_org.svg\n -rw-r--r-- 0 root (0) root (0) 4541 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__core_org.svg\n--rw-r--r-- 0 root (0) root (0) 49285 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io.html\n+-rw-r--r-- 0 root (0) root (0) 49415 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io.html\n -rw-r--r-- 0 root (0) root (0) 6881 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io.js\n -rw-r--r-- 0 root (0) root (0) 5355 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io.svg\n--rw-r--r-- 0 root (0) root (0) 136157 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sam__file.html\n+-rw-r--r-- 0 root (0) root (0) 142183 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sam__file.html\n -rw-r--r-- 0 root (0) root (0) 29479 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sam__file.js\n -rw-r--r-- 0 root (0) root (0) 2337 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sam__file.svg\n -rw-r--r-- 0 root (0) root (0) 1552 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sam__file_org.svg\n--rw-r--r-- 0 root (0) root (0) 99325 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sequence__file.html\n+-rw-r--r-- 0 root (0) root (0) 108606 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sequence__file.html\n -rw-r--r-- 0 root (0) root (0) 18532 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sequence__file.js\n -rw-r--r-- 0 root (0) root (0) 2348 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sequence__file.svg\n -rw-r--r-- 0 root (0) root (0) 1563 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__sequence__file_org.svg\n -rw-r--r-- 0 root (0) root (0) 8216 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__stream.html\n -rw-r--r-- 0 root (0) root (0) 1523 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__stream.js\n -rw-r--r-- 0 root (0) root (0) 2368 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__stream.svg\n -rw-r--r-- 0 root (0) root (0) 1583 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__stream_org.svg\n--rw-r--r-- 0 root (0) root (0) 104125 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__structure__file.html\n+-rw-r--r-- 0 root (0) root (0) 112197 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__structure__file.html\n -rw-r--r-- 0 root (0) root (0) 19394 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__structure__file.js\n -rw-r--r-- 0 root (0) root (0) 2354 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__structure__file.svg\n -rw-r--r-- 0 root (0) root (0) 1569 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__structure__file_org.svg\n--rw-r--r-- 0 root (0) root (0) 32379 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__views.html\n+-rw-r--r-- 0 root (0) root (0) 38684 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__views.html\n -rw-r--r-- 0 root (0) root (0) 137 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__views.js\n -rw-r--r-- 0 root (0) root (0) 2286 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__views.svg\n -rw-r--r-- 0 root (0) root (0) 1501 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io__views_org.svg\n -rw-r--r-- 0 root (0) root (0) 4570 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__io_org.svg\n--rw-r--r-- 0 root (0) root (0) 38599 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search.html\n+-rw-r--r-- 0 root (0) root (0) 42860 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search.html\n -rw-r--r-- 0 root (0) root (0) 2281 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search.js\n -rw-r--r-- 0 root (0) root (0) 5442 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search.svg\n--rw-r--r-- 0 root (0) root (0) 86142 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__configuration.html\n+-rw-r--r-- 0 root (0) root (0) 87724 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__configuration.html\n -rw-r--r-- 0 root (0) root (0) 15833 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__configuration.js\n -rw-r--r-- 0 root (0) root (0) 2410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__configuration.svg\n -rw-r--r-- 0 root (0) root (0) 1625 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__configuration_org.svg\n--rw-r--r-- 0 root (0) root (0) 14821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__dream__index.html\n+-rw-r--r-- 0 root (0) root (0) 14951 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__dream__index.html\n -rw-r--r-- 0 root (0) root (0) 10774 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__dream__index.js\n -rw-r--r-- 0 root (0) root (0) 2377 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__dream__index.svg\n -rw-r--r-- 0 root (0) root (0) 1592 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__dream__index_org.svg\n--rw-r--r-- 0 root (0) root (0) 20218 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__fm__index.html\n+-rw-r--r-- 0 root (0) root (0) 20738 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__fm__index.html\n -rw-r--r-- 0 root (0) root (0) 10985 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__fm__index.js\n -rw-r--r-- 0 root (0) root (0) 2404 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__fm__index.svg\n -rw-r--r-- 0 root (0) root (0) 1619 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__fm__index_org.svg\n -rw-r--r-- 0 root (0) root (0) 9620 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__kmer__index.html\n -rw-r--r-- 0 root (0) root (0) 1245 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__kmer__index.js\n -rw-r--r-- 0 root (0) root (0) 2392 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__kmer__index.svg\n -rw-r--r-- 0 root (0) root (0) 1607 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__kmer__index_org.svg\n--rw-r--r-- 0 root (0) root (0) 53132 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__views.html\n+-rw-r--r-- 0 root (0) root (0) 57297 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__views.html\n -rw-r--r-- 0 root (0) root (0) 488 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__views.js\n -rw-r--r-- 0 root (0) root (0) 2336 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__views.svg\n -rw-r--r-- 0 root (0) root (0) 1551 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search__views_org.svg\n -rw-r--r-- 0 root (0) root (0) 4657 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__search_org.svg\n -rw-r--r-- 0 root (0) root (0) 9103 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std.html\n -rw-r--r-- 0 root (0) root (0) 133 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std.js\n -rw-r--r-- 0 root (0) root (0) 3106 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std.svg\n@@ -2055,76 +2057,76 @@\n -rw-r--r-- 0 root (0) root (0) 2368 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std__charconv.svg\n -rw-r--r-- 0 root (0) root (0) 1583 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std__charconv_org.svg\n -rw-r--r-- 0 root (0) root (0) 11089 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std__new.html\n -rw-r--r-- 0 root (0) root (0) 266 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std__new.js\n -rw-r--r-- 0 root (0) root (0) 2345 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std__new.svg\n -rw-r--r-- 0 root (0) root (0) 1560 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std__new_org.svg\n -rw-r--r-- 0 root (0) root (0) 2321 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__std_org.svg\n--rw-r--r-- 0 root (0) root (0) 23224 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility.html\n+-rw-r--r-- 0 root (0) root (0) 23905 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility.html\n -rw-r--r-- 0 root (0) root (0) 965 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility.js\n -rw-r--r-- 0 root (0) root (0) 9560 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility.svg\n -rw-r--r-- 0 root (0) root (0) 7860 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__bloom__filter.html\n -rw-r--r-- 0 root (0) root (0) 1954 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__bloom__filter.js\n -rw-r--r-- 0 root (0) root (0) 2342 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__bloom__filter.svg\n -rw-r--r-- 0 root (0) root (0) 1557 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__bloom__filter_org.svg\n--rw-r--r-- 0 root (0) root (0) 92874 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__char__operations.html\n+-rw-r--r-- 0 root (0) root (0) 100097 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__char__operations.html\n -rw-r--r-- 0 root (0) root (0) 1696 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__char__operations.js\n -rw-r--r-- 0 root (0) root (0) 2407 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__char__operations.svg\n -rw-r--r-- 0 root (0) root (0) 1622 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__char__operations_org.svg\n -rw-r--r-- 0 root (0) root (0) 13127 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__concept.html\n -rw-r--r-- 0 root (0) root (0) 779 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__concept.js\n -rw-r--r-- 0 root (0) root (0) 2342 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__concept.svg\n -rw-r--r-- 0 root (0) root (0) 1557 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__concept_org.svg\n -rw-r--r-- 0 root (0) root (0) 13886 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__container.html\n -rw-r--r-- 0 root (0) root (0) 21523 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__container.js\n -rw-r--r-- 0 root (0) root (0) 2362 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__container.svg\n -rw-r--r-- 0 root (0) root (0) 1577 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__container_org.svg\n--rw-r--r-- 0 root (0) root (0) 15607 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__range.html\n+-rw-r--r-- 0 root (0) root (0) 15802 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__range.html\n -rw-r--r-- 0 root (0) root (0) 428 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__range.js\n -rw-r--r-- 0 root (0) root (0) 2353 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__range.svg\n -rw-r--r-- 0 root (0) root (0) 1568 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__range_org.svg\n--rw-r--r-- 0 root (0) root (0) 28767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__tuple.html\n+-rw-r--r-- 0 root (0) root (0) 31518 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__tuple.html\n -rw-r--r-- 0 root (0) root (0) 2673 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__tuple.js\n -rw-r--r-- 0 root (0) root (0) 2408 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__tuple.svg\n -rw-r--r-- 0 root (0) root (0) 1623 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__tuple_org.svg\n--rw-r--r-- 0 root (0) root (0) 114063 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__list.html\n+-rw-r--r-- 0 root (0) root (0) 130690 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__list.html\n -rw-r--r-- 0 root (0) root (0) 3658 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__list.js\n -rw-r--r-- 0 root (0) root (0) 2391 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__list.svg\n -rw-r--r-- 0 root (0) root (0) 1606 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__list_org.svg\n--rw-r--r-- 0 root (0) root (0) 87818 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__pack.html\n+-rw-r--r-- 0 root (0) root (0) 99636 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__pack.html\n -rw-r--r-- 0 root (0) root (0) 2753 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__pack.js\n -rw-r--r-- 0 root (0) root (0) 2383 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__pack.svg\n -rw-r--r-- 0 root (0) root (0) 1598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__pack_org.svg\n -rw-r--r-- 0 root (0) root (0) 10572 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__traits.html\n -rw-r--r-- 0 root (0) root (0) 1349 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__traits.js\n -rw-r--r-- 0 root (0) root (0) 2360 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__traits.svg\n -rw-r--r-- 0 root (0) root (0) 1575 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__type__traits_org.svg\n--rw-r--r-- 0 root (0) root (0) 107949 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__views.html\n+-rw-r--r-- 0 root (0) root (0) 115791 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__views.html\n -rw-r--r-- 0 root (0) root (0) 1750 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__views.js\n -rw-r--r-- 0 root (0) root (0) 2383 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__views.svg\n -rw-r--r-- 0 root (0) root (0) 1598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility__views_org.svg\n -rw-r--r-- 0 root (0) root (0) 8775 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/group__utility_org.svg\n -rw-r--r-- 0 root (0) root (0) 64578 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gz__istream_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 82766 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/gz__ostream_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hamming__scoring__scheme_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 19931 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hamming__scoring__scheme_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 22936 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hamming__scoring__scheme_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6279 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hash_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 12121 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hash_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 12208 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hash_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6383 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/header_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 42669 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/header_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 43622 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/header_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6483 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/helper_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10637 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/helper_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 283590 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hierarchy.html\n -rw-r--r-- 0 root (0) root (0) 65703 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hierarchy.js\n -rw-r--r-- 0 root (0) root (0) 6377 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hit_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 54727 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hit_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 55680 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/hit_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 12867 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/howto_porting.html\n -rw-r--r-- 0 root (0) root (0) 20172 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/howto_use_cereal.html\n--rw-r--r-- 0 root (0) root (0) 114153 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/howto_write_a_view.html\n--rw-r--r-- 0 root (0) root (0) 76383 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/howto_write_an_alphabet.html\n+-rw-r--r-- 0 root (0) root (0) 114941 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/howto_write_a_view.html\n+-rw-r--r-- 0 root (0) root (0) 75951 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/howto_write_an_alphabet.html\n -rw-r--r-- 0 root (0) root (0) 6465 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/ignore__output__iterator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 14868 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/ignore__output__iterator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6435 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/in__file__iterator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 24678 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/in__file__iterator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 9069 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/index.html\n -rw-r--r-- 0 root (0) root (0) 3759 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/inherit_graph_0.svg\n -rw-r--r-- 0 root (0) root (0) 1163 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/inherit_graph_1.svg\n@@ -2333,15 +2335,15 @@\n -rw-r--r-- 0 root (0) root (0) 1720 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cereal__input__archive__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8155 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cereal__output__archive.html\n -rw-r--r-- 0 root (0) root (0) 2527 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cereal__output__archive__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1742 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cereal__output__archive__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8120 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cereal__text__archive.html\n -rw-r--r-- 0 root (0) root (0) 2519 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cereal__text__archive__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1734 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cereal__text__archive__inherit__graph_org.svg\n--rw-r--r-- 0 root (0) root (0) 17673 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cerealisable.html\n+-rw-r--r-- 0 root (0) root (0) 17764 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cerealisable.html\n -rw-r--r-- 0 root (0) root (0) 41438 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cerealisable__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 37508 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1cerealisable__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9113 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1const__iterable__range.html\n -rw-r--r-- 0 root (0) root (0) 19184 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1const__iterable__range__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 15244 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1const__iterable__range__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8462 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1container.html\n -rw-r--r-- 0 root (0) root (0) 21916 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1container__inherit__graph.svg\n@@ -2454,95 +2456,95 @@\n -rw-r--r-- 0 root (0) root (0) 8738 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1writable__quality__alphabet__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9509 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1writable__semialphabet.html\n -rw-r--r-- 0 root (0) root (0) 64395 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1writable__semialphabet__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 60456 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interfaceseqan3_1_1writable__semialphabet__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interleave_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 44765 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interleave_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interleaved__bloom__filter_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 178572 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interleaved__bloom__filter_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 196444 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/interleaved__bloom__filter_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6276 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10470 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6395 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2detail_2misc_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 26807 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2detail_2misc_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6306 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2exception_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 27923 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2exception_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 28344 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2exception_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6398 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sam__file_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13065 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sam__file_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6522 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sam__file_2detail_2cigar_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 33003 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sam__file_2detail_2cigar_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6413 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sam__file_2output_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 146733 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sam__file_2output_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 154017 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sam__file_2output_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6413 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sequence__file_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12691 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sequence__file_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6428 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sequence__file_2output_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 86921 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sequence__file_2output_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 88136 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2sequence__file_2output_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6390 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2stream_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8016 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2stream_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2stream_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19559 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2stream_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2structure__file_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11588 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2structure__file_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6431 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2structure__file_2detail_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 23847 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2structure__file_2detail_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6431 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2structure__file_2output_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 99778 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2structure__file_2output_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 101060 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2structure__file_2output_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6387 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2views_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8062 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/io_2views_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6499 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/is__class__template__declarable_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12238 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/is__class__template__declarable_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6525 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/istreambuf__view_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15414 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/istreambuf__view_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/iterator__traits_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 21958 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/iterator__traits_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/join__with_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 10020 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/join__with_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 10441 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/join__with_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 176630 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/jquery.js\n -rw-r--r-- 0 root (0) root (0) 6401 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/kmer__hash_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 87209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/kmer__hash_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/lazy__conditional_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19979 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/lazy__conditional_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 16510 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/load_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6413 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/magic__header_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 26429 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/magic__header_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6375 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/mask_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 19422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/mask_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 19664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/mask_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6385 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/masked_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 39838 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/masked_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 41336 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/masked_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6278 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/math_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 26789 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/math_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 28730 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/math_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6528 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/matrix__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 18345 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/matrix__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6543 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/matrix__coordinate_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 25334 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/matrix__coordinate_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6409 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/max__error_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 61623 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/max__error_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6446 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/max__error__common_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 13414 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/max__error__common_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 13835 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/max__error__common_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 7083 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2alignment__configura6883695739c4d4204ccb044856d893c6.html\n -rw-r--r-- 0 root (0) root (0) 7294 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2alignment__configuraa1e955a8959b8b5735504065b20e91ed.html\n -rw-r--r-- 0 root (0) root (0) 7930 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2alignment__configuration__align__config__band.html\n -rw-r--r-- 0 root (0) root (0) 8526 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2alignment__configuration__align__config__parallel.html\n -rw-r--r-- 0 root (0) root (0) 8263 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2cigar__operation__table.html\n--rw-r--r-- 0 root (0) root (0) 15889 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2dna15__implicit__conversion__from__rna15.html\n--rw-r--r-- 0 root (0) root (0) 15549 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2dna4__implicit__conversion__from__rna4.html\n--rw-r--r-- 0 root (0) root (0) 15773 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2dna5__implicit__conversion__from__rna5.html\n--rw-r--r-- 0 root (0) root (0) 57476 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__sam__file__input.html\n--rw-r--r-- 0 root (0) root (0) 42859 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__sam__file__output.html\n--rw-r--r-- 0 root (0) root (0) 56536 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__structure__input.html\n--rw-r--r-- 0 root (0) root (0) 50092 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__structure__output.html\n--rw-r--r-- 0 root (0) root (0) 15889 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2rna15__implicit__conversion__from__dna15.html\n--rw-r--r-- 0 root (0) root (0) 15549 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2rna4__implicit__conversion__from__dna4.html\n--rw-r--r-- 0 root (0) root (0) 15773 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2rna5__implicit__conversion__from__dna5.html\n--rw-r--r-- 0 root (0) root (0) 47001 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2sequence__file__input.html\n--rw-r--r-- 0 root (0) root (0) 52852 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2sequence__file__output.html\n+-rw-r--r-- 0 root (0) root (0) 17450 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2dna15__implicit__conversion__from__rna15.html\n+-rw-r--r-- 0 root (0) root (0) 17110 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2dna4__implicit__conversion__from__rna4.html\n+-rw-r--r-- 0 root (0) root (0) 17334 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2dna5__implicit__conversion__from__rna5.html\n+-rw-r--r-- 0 root (0) root (0) 59028 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__sam__file__input.html\n+-rw-r--r-- 0 root (0) root (0) 44007 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__sam__file__output.html\n+-rw-r--r-- 0 root (0) root (0) 60398 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__structure__input.html\n+-rw-r--r-- 0 root (0) root (0) 54067 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2io__structure__output.html\n+-rw-r--r-- 0 root (0) root (0) 17450 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2rna15__implicit__conversion__from__dna15.html\n+-rw-r--r-- 0 root (0) root (0) 17110 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2rna4__implicit__conversion__from__dna4.html\n+-rw-r--r-- 0 root (0) root (0) 17334 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2rna5__implicit__conversion__from__dna5.html\n+-rw-r--r-- 0 root (0) root (0) 50301 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2sequence__file__input.html\n+-rw-r--r-- 0 root (0) root (0) 58598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md__2build_2reproducible-path_2seqan3-3_84_80_0irc_83_09ds_2doc_2fragments_2sequence__file__output.html\n -rw-r--r-- 0 root (0) root (0) 6885 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/md_seqan3_2contrib_2README.html\n -rw-r--r-- 0 root (0) root (0) 5925 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/menu.js\n -rw-r--r-- 0 root (0) root (0) 7854 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/menudata.js\n -rw-r--r-- 0 root (0) root (0) 6399 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minimiser_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 66767 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minimiser_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 66777 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minimiser_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minimiser__hash_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 24585 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minimiser__hash_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 12364 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minimisers.png\n -rw-r--r-- 0 root (0) root (0) 582 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minus.svg\n -rw-r--r-- 0 root (0) root (0) 582 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/minusd.svg\n -rw-r--r-- 0 root (0) root (0) 6403 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/misc__input_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 35781 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/misc__input_8hpp_source.html\n@@ -2554,28 +2556,28 @@\n -rw-r--r-- 0 root (0) root (0) 7430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespacemembers_enum.html\n -rw-r--r-- 0 root (0) root (0) 7319 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespacemembers_eval.html\n -rw-r--r-- 0 root (0) root (0) 9979 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespacemembers_func.html\n -rw-r--r-- 0 root (0) root (0) 12396 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespacemembers_type.html\n -rw-r--r-- 0 root (0) root (0) 17026 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespacemembers_vars.html\n -rw-r--r-- 0 root (0) root (0) 124231 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaces.html\n -rw-r--r-- 0 root (0) root (0) 137 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaces_dup.js\n--rw-r--r-- 0 root (0) root (0) 276214 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3.html\n+-rw-r--r-- 0 root (0) root (0) 296688 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3.html\n -rw-r--r-- 0 root (0) root (0) 45883 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3.js\n--rw-r--r-- 0 root (0) root (0) 24806 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1align__cfg.html\n+-rw-r--r-- 0 root (0) root (0) 25066 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1align__cfg.html\n -rw-r--r-- 0 root (0) root (0) 3524 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1align__cfg.js\n -rw-r--r-- 0 root (0) root (0) 9426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1custom.html\n -rw-r--r-- 0 root (0) root (0) 394 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1custom.js\n -rw-r--r-- 0 root (0) root (0) 8654 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1exposition__only.html\n -rw-r--r-- 0 root (0) root (0) 187 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1exposition__only.js\n--rw-r--r-- 0 root (0) root (0) 24039 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1list__traits.html\n--rw-r--r-- 0 root (0) root (0) 33413 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1literals.html\n--rw-r--r-- 0 root (0) root (0) 22839 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1pack__traits.html\n--rw-r--r-- 0 root (0) root (0) 20407 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1search__cfg.html\n+-rw-r--r-- 0 root (0) root (0) 30604 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1list__traits.html\n+-rw-r--r-- 0 root (0) root (0) 38821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1literals.html\n+-rw-r--r-- 0 root (0) root (0) 26869 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1pack__traits.html\n+-rw-r--r-- 0 root (0) root (0) 20667 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1search__cfg.html\n -rw-r--r-- 0 root (0) root (0) 2389 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1search__cfg.js\n--rw-r--r-- 0 root (0) root (0) 25695 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1views.html\n+-rw-r--r-- 0 root (0) root (0) 28815 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1views.html\n -rw-r--r-- 0 root (0) root (0) 2349 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespaceseqan3_1_1views.js\n -rw-r--r-- 0 root (0) root (0) 479643 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespacestd.html\n -rw-r--r-- 0 root (0) root (0) 70714 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/namespacestd.js\n -rw-r--r-- 0 root (0) root (0) 157 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nav_f.png\n -rw-r--r-- 0 root (0) root (0) 159 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nav_fd.png\n -rw-r--r-- 0 root (0) root (0) 95 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nav_g.png\n -rw-r--r-- 0 root (0) root (0) 99 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nav_h.png\n@@ -2599,53 +2601,53 @@\n -rw-r--r-- 0 root (0) root (0) 11167 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/navtreeindex8.js\n -rw-r--r-- 0 root (0) root (0) 12382 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/navtreeindex9.js\n -rw-r--r-- 0 root (0) root (0) 6247 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/new.html\n -rw-r--r-- 0 root (0) root (0) 14735 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/new_source.html\n -rw-r--r-- 0 root (0) root (0) 6562 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/non__propagating__cache_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 17361 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/non__propagating__cache_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6438 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nucleotide__base_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 31204 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nucleotide__base_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 31564 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nucleotide__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6488 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nucleotide__scoring__scheme_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 21920 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nucleotide__scoring__scheme_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 23386 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/nucleotide__scoring__scheme_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6409 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/on__result_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 21615 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/on__result_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 22258 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/on__result_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 119 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/open.png\n -rw-r--r-- 0 root (0) root (0) 6399 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/optional_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 16949 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/optional_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 17902 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/optional_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6440 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/out__file__iterator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 21017 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/out__file__iterator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6107 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pages.html\n -rw-r--r-- 0 root (0) root (0) 6602 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__alignment__algorithm_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 50836 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__alignment__algorithm_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6639 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__alignment__algorithm__banded_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 50703 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__alignment__algorithm__banded_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6492 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__alignment__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12915 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__alignment__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6437 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__combine_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 76183 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pairwise__combine_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/parallel_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11014 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/parallel_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred42_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 22652 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred42_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 25411 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred42_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred63_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 22652 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred63_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 25411 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred63_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6423 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred68solexa_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 23072 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred68solexa_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 25831 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred68solexa_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred94_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 22634 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred94_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 25393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred94_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred__base_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 35480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred__base_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 39554 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/phred__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6479 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pipeable__config__element_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9861 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pipeable__config__element_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6295 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/platform_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 45618 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/platform_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 696 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/plus.svg\n -rw-r--r-- 0 root (0) root (0) 696 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/plusd.svg\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pod__tuple_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 78714 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pod__tuple_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 87441 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pod__tuple_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6599 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__affine__gap__recursion_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 28528 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__affine__gap__recursion_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6636 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__affine__gap__recursion__banded_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15474 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__affine__gap__recursion__banded_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6658 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__affine__gap__with__trace__recursion_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 23895 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__affine__gap__with__trace__recursion_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6695 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__affine__gap__with__trace__recursion__banded_8hpp.html\n@@ -2661,110 +2663,110 @@\n -rw-r--r-- 0 root (0) root (0) 6599 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__optimum__tracker__simd_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 30851 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__optimum__tracker__simd_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6567 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__scoring__scheme_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15883 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__scoring__scheme_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6501 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__search__result__builder_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 28383 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/policy__search__result__builder_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pop__front_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 11053 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pop__front_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 11474 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pop__front_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/predicate_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 29142 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/predicate_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 29707 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/predicate_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/predicate__detail_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 51655 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/predicate__detail_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 51707 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/predicate__detail_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6427 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pretty__print_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15197 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/pretty__print_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6403 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/qualified_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 48991 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/qualified_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 53119 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/qualified_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6564 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/random__access__iterator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 44162 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/random__access__iterator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6390 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/range_2hash_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 13940 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/range_2hash_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 14102 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/range_2hash_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/range_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 26820 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/range_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 28284 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/range_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rank__to_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 13216 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rank__to_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 13050 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rank__to_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6283 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/record_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 60049 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/record_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 62138 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/record_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6408 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/record__like_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 12430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/record__like_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 12487 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/record__like_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6385 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/repeat_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 37600 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/repeat_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6397 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/repeat__n_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13272 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/repeat__n_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 5685 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/resize.js\n -rw-r--r-- 0 root (0) root (0) 6419 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/result__type_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 20106 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/result__type_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 20000 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/result__type_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6386 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna15_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 30247 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna15_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 33381 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna15_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6381 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna4_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 29501 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna4_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 32635 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna4_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6381 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna5_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 29603 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna5_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 32737 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/rna5_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6535 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/row__wise__matrix_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/row__wise__matrix_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6460 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/safe__filesystem__entry_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 17361 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/safe__filesystem__entry_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6400 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2input_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 171664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2input_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 175248 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2input_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6479 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2input__format__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 39737 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2input__format__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6442 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2input__options_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10082 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2input__options_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2output__format__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 35842 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2output__format__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2output__options_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11939 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2output__options_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6405 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2record_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 107974 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2record_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 112662 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__file_2record_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6395 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__flag_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 23809 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__flag_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 24458 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__flag_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__tag__dictionary_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 63116 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__tag__dictionary_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 64905 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sam__tag__dictionary_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6592 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/score__matrix__single__column_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 34934 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/score__matrix__single__column_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6458 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/scoring__scheme__base_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 54117 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/scoring__scheme__base_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 59171 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/scoring__scheme__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6473 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/scoring__scheme__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12695 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/scoring__scheme__concept_8hpp_source.html\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/\n -rw-r--r-- 0 root (0) root (0) 730 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_0.js\n -rw-r--r-- 0 root (0) root (0) 496 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1.js\n--rw-r--r-- 0 root (0) root (0) 108184 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_10.js\n+-rw-r--r-- 0 root (0) root (0) 108519 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_10.js\n -rw-r--r-- 0 root (0) root (0) 540 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_11.js\n -rw-r--r-- 0 root (0) root (0) 2693 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_12.js\n--rw-r--r-- 0 root (0) root (0) 22742 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_13.js\n--rw-r--r-- 0 root (0) root (0) 59783 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_14.js\n--rw-r--r-- 0 root (0) root (0) 19915 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_15.js\n--rw-r--r-- 0 root (0) root (0) 225084 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_16.js\n--rw-r--r-- 0 root (0) root (0) 60622 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_17.js\n+-rw-r--r-- 0 root (0) root (0) 22751 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_13.js\n+-rw-r--r-- 0 root (0) root (0) 59801 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_14.js\n+-rw-r--r-- 0 root (0) root (0) 20007 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_15.js\n+-rw-r--r-- 0 root (0) root (0) 224989 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_16.js\n+-rw-r--r-- 0 root (0) root (0) 60570 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_17.js\n -rw-r--r-- 0 root (0) root (0) 5218 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_18.js\n--rw-r--r-- 0 root (0) root (0) 87244 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_19.js\n--rw-r--r-- 0 root (0) root (0) 196258 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1a.js\n--rw-r--r-- 0 root (0) root (0) 49886 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1b.js\n--rw-r--r-- 0 root (0) root (0) 33492 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1c.js\n--rw-r--r-- 0 root (0) root (0) 17220 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1d.js\n--rw-r--r-- 0 root (0) root (0) 32182 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1e.js\n+-rw-r--r-- 0 root (0) root (0) 87397 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_19.js\n+-rw-r--r-- 0 root (0) root (0) 196377 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1a.js\n+-rw-r--r-- 0 root (0) root (0) 49881 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1b.js\n+-rw-r--r-- 0 root (0) root (0) 33491 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1c.js\n+-rw-r--r-- 0 root (0) root (0) 17219 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1d.js\n+-rw-r--r-- 0 root (0) root (0) 32222 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1e.js\n -rw-r--r-- 0 root (0) root (0) 5068 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_1f.js\n -rw-r--r-- 0 root (0) root (0) 539 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_2.js\n -rw-r--r-- 0 root (0) root (0) 774 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_20.js\n -rw-r--r-- 0 root (0) root (0) 1108 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_21.js\n -rw-r--r-- 0 root (0) root (0) 36806 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_22.js\n -rw-r--r-- 0 root (0) root (0) 1010 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_3.js\n -rw-r--r-- 0 root (0) root (0) 355 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_4.js\n -rw-r--r-- 0 root (0) root (0) 172 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_5.js\n -rw-r--r-- 0 root (0) root (0) 178 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_6.js\n -rw-r--r-- 0 root (0) root (0) 120 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_7.js\n--rw-r--r-- 0 root (0) root (0) 105731 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_8.js\n--rw-r--r-- 0 root (0) root (0) 49175 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_9.js\n--rw-r--r-- 0 root (0) root (0) 114844 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_a.js\n--rw-r--r-- 0 root (0) root (0) 49184 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_b.js\n--rw-r--r-- 0 root (0) root (0) 68547 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_c.js\n--rw-r--r-- 0 root (0) root (0) 101688 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_d.js\n--rw-r--r-- 0 root (0) root (0) 38038 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_e.js\n--rw-r--r-- 0 root (0) root (0) 15652 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_f.js\n+-rw-r--r-- 0 root (0) root (0) 105329 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_8.js\n+-rw-r--r-- 0 root (0) root (0) 49407 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_9.js\n+-rw-r--r-- 0 root (0) root (0) 114915 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_a.js\n+-rw-r--r-- 0 root (0) root (0) 49187 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_b.js\n+-rw-r--r-- 0 root (0) root (0) 68646 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_c.js\n+-rw-r--r-- 0 root (0) root (0) 101605 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_d.js\n+-rw-r--r-- 0 root (0) root (0) 38039 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_e.js\n+-rw-r--r-- 0 root (0) root (0) 15654 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/all_f.js\n -rw-r--r-- 0 root (0) root (0) 25436 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/classes_0.js\n -rw-r--r-- 0 root (0) root (0) 7154 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/classes_1.js\n -rw-r--r-- 0 root (0) root (0) 296 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/classes_10.js\n -rw-r--r-- 0 root (0) root (0) 8378 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/classes_11.js\n -rw-r--r-- 0 root (0) root (0) 20771 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/classes_12.js\n -rw-r--r-- 0 root (0) root (0) 6212 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/classes_13.js\n -rw-r--r-- 0 root (0) root (0) 7958 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search/classes_14.js\n@@ -2974,140 +2976,140 @@\n -rw-r--r-- 0 root (0) root (0) 6430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_2fm__index_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 17002 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_2fm__index_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_2kmer__index_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8028 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_2kmer__index_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6399 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_2views_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8870 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_2views_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6287 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 45082 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 48163 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__common_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12561 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__common_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6452 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__configurator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 38266 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__configurator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6324 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__result_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 43201 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__result_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 46890 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__result_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6474 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__scheme__algorithm_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 121546 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__scheme__algorithm_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__scheme__precomputed_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 25686 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__scheme__precomputed_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__traits_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 19696 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/search__traits_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6442 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/semialphabet__any_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 21720 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/semialphabet__any_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 24653 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/semialphabet__any_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 8253 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/seqan3.css\n -rw-r--r-- 0 root (0) root (0) 7311 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/seqan_logo.svg\n -rw-r--r-- 0 root (0) root (0) 6396 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 10079 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6415 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2input_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 113694 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2input_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 114059 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2input_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6494 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2input__format__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 24154 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2input__format__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6457 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2input__options_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13030 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2input__options_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6499 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2output__format__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 23569 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2output__format__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6462 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2output__options_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 16378 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2output__options_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2record_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 36545 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2record_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 37889 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sequence__file_2record_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6482 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/serialised__resource__pool_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 39880 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/serialised__resource__pool_8hpp_source.html\n--rw-r--r-- 0 root (0) root (0) 23150 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/setup.html\n+-rw-r--r-- 0 root (0) root (0) 23148 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/setup.html\n -rw-r--r-- 0 root (0) root (0) 11664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/setup_tests.html\n -rw-r--r-- 0 root (0) root (0) 6384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/shape_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 21649 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/shape_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 24278 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/shape_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6635 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/simd__match__mismatch__scoring__scheme_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 28524 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/simd__match__mismatch__scoring__scheme_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 28945 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/simd__match__mismatch__scoring__scheme_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6593 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/simd__matrix__scoring__scheme_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 32938 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/simd__matrix__scoring__scheme_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 33663 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/simd__matrix__scoring__scheme_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6444 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/single__pass__input_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 39061 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/single__pass__input_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/slice_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 27304 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/slice_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6421 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/small__string_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 70348 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/small__string_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 75274 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/small__string_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6421 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/small__vector_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 135273 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/small__vector_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 149304 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/small__vector_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/split_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 22897 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/split_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 24078 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/split_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 288 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/splitbar.png\n -rw-r--r-- 0 root (0) root (0) 178 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/splitbard.png\n -rw-r--r-- 0 root (0) root (0) 13256 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/store_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6558 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/stream__buffer__exposer_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15373 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/stream__buffer__exposer_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/strong__type_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 54117 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/strong__type_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6604 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1advanceable__alignment__coordinate__printer.html\n -rw-r--r-- 0 root (0) root (0) 7308 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1advanceable__alignment__coordinate__printer_3_01detail_1_1advanceable__alignment9df13e8b7c4a2713a44bacab9395b9dc.html\n--rw-r--r-- 0 root (0) root (0) 11774 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1advanceable__alignment__coordinate__printer_3_01detail_1_1advanceable__alignmentdfdebf28e21078ded4fcd10c393f729f.html\n+-rw-r--r-- 0 root (0) root (0) 13009 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1advanceable__alignment__coordinate__printer_3_01detail_1_1advanceable__alignmentdfdebf28e21078ded4fcd10c393f729f.html\n -rw-r--r-- 0 root (0) root (0) 337 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1advanceable__alignment__coordinate__printer_3_01detail_1_1advanceable__alignmentdfdebf28e21078ded4fcd10c393f729f.js\n -rw-r--r-- 0 root (0) root (0) 6610 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1extension__score-members.html\n--rw-r--r-- 0 root (0) root (0) 9584 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1extension__score.html\n+-rw-r--r-- 0 root (0) root (0) 9649 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1extension__score.html\n -rw-r--r-- 0 root (0) root (0) 169 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1extension__score.js\n -rw-r--r-- 0 root (0) root (0) 7581 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1extension__score__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3631 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1extension__score__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6734 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__leading-members.html\n--rw-r--r-- 0 root (0) root (0) 9992 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__leading.html\n+-rw-r--r-- 0 root (0) root (0) 10122 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__leading.html\n -rw-r--r-- 0 root (0) root (0) 207 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__leading.js\n -rw-r--r-- 0 root (0) root (0) 4305 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__leading__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3520 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__leading__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6741 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__trailing-members.html\n--rw-r--r-- 0 root (0) root (0) 10009 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__trailing.html\n+-rw-r--r-- 0 root (0) root (0) 10139 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__trailing.html\n -rw-r--r-- 0 root (0) root (0) 209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__trailing.js\n -rw-r--r-- 0 root (0) root (0) 4269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__trailing__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence1__trailing__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6734 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__leading-members.html\n--rw-r--r-- 0 root (0) root (0) 9992 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__leading.html\n+-rw-r--r-- 0 root (0) root (0) 10122 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__leading.html\n -rw-r--r-- 0 root (0) root (0) 207 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__leading.js\n -rw-r--r-- 0 root (0) root (0) 4305 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__leading__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3520 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__leading__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6741 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__trailing-members.html\n--rw-r--r-- 0 root (0) root (0) 10009 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__trailing.html\n+-rw-r--r-- 0 root (0) root (0) 10139 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__trailing.html\n -rw-r--r-- 0 root (0) root (0) 209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__trailing.js\n -rw-r--r-- 0 root (0) root (0) 4269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__trailing__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1free__end__gaps__sequence2__trailing__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6603 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1lower__diagonal-members.html\n--rw-r--r-- 0 root (0) root (0) 9396 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1lower__diagonal.html\n+-rw-r--r-- 0 root (0) root (0) 9461 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1lower__diagonal.html\n -rw-r--r-- 0 root (0) root (0) 167 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1lower__diagonal.js\n -rw-r--r-- 0 root (0) root (0) 3956 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1lower__diagonal__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3171 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1lower__diagonal__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6575 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1open__score-members.html\n--rw-r--r-- 0 root (0) root (0) 9551 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1open__score.html\n+-rw-r--r-- 0 root (0) root (0) 9616 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1open__score.html\n -rw-r--r-- 0 root (0) root (0) 159 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1open__score.js\n -rw-r--r-- 0 root (0) root (0) 7553 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1open__score__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3608 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1open__score__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6603 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1upper__diagonal-members.html\n--rw-r--r-- 0 root (0) root (0) 9396 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1upper__diagonal.html\n+-rw-r--r-- 0 root (0) root (0) 9461 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1upper__diagonal.html\n -rw-r--r-- 0 root (0) root (0) 167 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1upper__diagonal.js\n -rw-r--r-- 0 root (0) root (0) 3958 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1upper__diagonal__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3173 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1align__cfg_1_1upper__diagonal__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7173 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1aligned__allocator_1_1rebind-members.html\n--rw-r--r-- 0 root (0) root (0) 10876 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1aligned__allocator_1_1rebind.html\n+-rw-r--r-- 0 root (0) root (0) 11526 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1aligned__allocator_1_1rebind.html\n -rw-r--r-- 0 root (0) root (0) 164 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1aligned__allocator_1_1rebind.js\n -rw-r--r-- 0 root (0) root (0) 6522 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__matrix__printer.html\n -rw-r--r-- 0 root (0) root (0) 7357 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__matrix__printer_3_01alignment__matrix__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 16175 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__matrix__printer_3_01alignment__matrix__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 18775 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__matrix__printer_3_01alignment__matrix__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 368 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__matrix__printer_3_01alignment__matrix__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6485 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__printer.html\n -rw-r--r-- 0 root (0) root (0) 6765 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__printer_3_01alignment__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11455 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__printer_3_01alignment__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12755 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__printer_3_01alignment__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 193 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__printer_3_01alignment__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6522 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__result__printer.html\n -rw-r--r-- 0 root (0) root (0) 7038 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__result__printer_3_01alignment__result_3_01result__value__t_01_4_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11650 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__result__printer_3_01alignment__result_3_01result__value__t_01_4_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 13210 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__result__printer_3_01alignment__result_3_01result__value__t_01_4_01_4.html\n -rw-r--r-- 0 root (0) root (0) 271 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alignment__result__printer_3_01alignment__result_3_01result__value__t_01_4_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alphabet__printer.html\n -rw-r--r-- 0 root (0) root (0) 6764 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alphabet__printer_3_01alphabet__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11141 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alphabet__printer_3_01alphabet__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12116 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alphabet__printer_3_01alphabet__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 189 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1alphabet__printer_3_01alphabet__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 8599 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1aminoacid__empty__base.html\n -rw-r--r-- 0 root (0) root (0) 15421 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1aminoacid__empty__base__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 11480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1aminoacid__empty__base__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 11076 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1argument__parser__meta__data-members.html\n--rw-r--r-- 0 root (0) root (0) 20615 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1argument__parser__meta__data.html\n+-rw-r--r-- 0 root (0) root (0) 20680 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1argument__parser__meta__data.html\n -rw-r--r-- 0 root (0) root (0) 1773 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1argument__parser__meta__data.js\n -rw-r--r-- 0 root (0) root (0) 8232 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__count.html\n -rw-r--r-- 0 root (0) root (0) 7373 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__count__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__count__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8222 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__index.html\n -rw-r--r-- 0 root (0) root (0) 7368 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__index__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3438 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__index__inherit__graph_org.svg\n@@ -3115,267 +3117,267 @@\n -rw-r--r-- 0 root (0) root (0) 7991 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__literal.html\n -rw-r--r-- 0 root (0) root (0) 132 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__literal.js\n -rw-r--r-- 0 root (0) root (0) 8248 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__size.html\n -rw-r--r-- 0 root (0) root (0) 7386 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__size__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3457 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1bin__size__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6507 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1char__sequence__printer.html\n -rw-r--r-- 0 root (0) root (0) 6829 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1char__sequence__printer_3_01char__sequence__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11277 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1char__sequence__printer_3_01char__sequence__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12902 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1char__sequence__printer_3_01char__sequence__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 213 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1char__sequence__printer_3_01char__sequence__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 7448 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__clipped__bases-members.html\n -rw-r--r-- 0 root (0) root (0) 10551 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__clipped__bases.html\n -rw-r--r-- 0 root (0) root (0) 477 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__clipped__bases.js\n -rw-r--r-- 0 root (0) root (0) 6465 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__printer.html\n -rw-r--r-- 0 root (0) root (0) 6696 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__printer_3_01cigar_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 10618 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__printer_3_01cigar_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 11593 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__printer_3_01cigar_01_4.html\n -rw-r--r-- 0 root (0) root (0) 171 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1cigar__printer_3_01cigar_01_4.js\n--rw-r--r-- 0 root (0) root (0) 8216 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet.html\n+-rw-r--r-- 0 root (0) root (0) 8281 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet.html\n -rw-r--r-- 0 root (0) root (0) 8571 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet_3_01char__type_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 20736 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet_3_01char__type_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 23856 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet_3_01char__type_01_4.html\n -rw-r--r-- 0 root (0) root (0) 8575 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet_3_01uint__type_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 20751 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet_3_01uint__type_01_4.html\n--rw-r--r-- 0 root (0) root (0) 19005 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1argument__parsing.html\n+-rw-r--r-- 0 root (0) root (0) 25886 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1alphabet_3_01uint__type_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 19491 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1custom_1_1argument__parsing.html\n -rw-r--r-- 0 root (0) root (0) 6502 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1debug__stream__printer.html\n -rw-r--r-- 0 root (0) root (0) 7708 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1debug__stream__printer_3_01value__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 18849 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1debug__stream__printer_3_01value__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 22424 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1debug__stream__printer_3_01value__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 447 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1debug__stream__printer_3_01value__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 8372 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1default__printer-members.html\n--rw-r--r-- 0 root (0) root (0) 16032 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1default__printer.html\n+-rw-r--r-- 0 root (0) root (0) 18047 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1default__printer.html\n -rw-r--r-- 0 root (0) root (0) 145 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1default__printer.js\n -rw-r--r-- 0 root (0) root (0) 10573 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1default__printer__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 6639 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1default__printer__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6512 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1dynamic__bitset__printer.html\n -rw-r--r-- 0 root (0) root (0) 6983 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1dynamic__bitset__printer_3_01dynamic__bitset_3_01bit__capacity_01_4_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11446 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1dynamic__bitset__printer_3_01dynamic__bitset_3_01bit__capacity_01_4_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12681 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1dynamic__bitset__printer_3_01dynamic__bitset_3_01bit__capacity_01_4_01_4.html\n -rw-r--r-- 0 root (0) root (0) 257 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1dynamic__bitset__printer_3_01dynamic__bitset_3_01bit__capacity_01_4_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6495 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1enumeration__printer.html\n -rw-r--r-- 0 root (0) root (0) 6741 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1enumeration__printer_3_01enum__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11811 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1enumeration__printer_3_01enum__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12916 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1enumeration__printer_3_01enum__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 187 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1enumeration__printer_3_01enum__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6182 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1fields-members.html\n--rw-r--r-- 0 root (0) root (0) 15234 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1fields.html\n+-rw-r--r-- 0 root (0) root (0) 15542 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1fields.html\n -rw-r--r-- 0 root (0) root (0) 7261 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1file__open__error-members.html\n--rw-r--r-- 0 root (0) root (0) 9990 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1file__open__error.html\n+-rw-r--r-- 0 root (0) root (0) 10055 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1file__open__error.html\n -rw-r--r-- 0 root (0) root (0) 152 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1file__open__error.js\n -rw-r--r-- 0 root (0) root (0) 2556 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1file__open__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1771 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1file__open__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7251 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1format__error-members.html\n--rw-r--r-- 0 root (0) root (0) 9927 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1format__error.html\n+-rw-r--r-- 0 root (0) root (0) 9992 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1format__error.html\n -rw-r--r-- 0 root (0) root (0) 141 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1format__error.js\n -rw-r--r-- 0 root (0) root (0) 2516 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1format__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1731 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1format__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7886 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1function__traits_3_01std_1_1function_3_01return__t_07args__t_8_8_8_08_4_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 16622 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1function__traits_3_01std_1_1function_3_01return__t_07args__t_8_8_8_08_4_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 18192 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1function__traits_3_01std_1_1function_3_01return__t_07args__t_8_8_8_08_4_01_4.html\n -rw-r--r-- 0 root (0) root (0) 435 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1function__traits_3_01std_1_1function_3_01return__t_07args__t_8_8_8_08_4_01_4.js\n -rw-r--r-- 0 root (0) root (0) 8336 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1hash__function__count.html\n -rw-r--r-- 0 root (0) root (0) 7535 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1hash__function__count__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3594 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1hash__function__count__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7268 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1input__range__printer.html\n -rw-r--r-- 0 root (0) root (0) 6741 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1input__range__printer_3_01rng__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 12039 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1input__range__printer_3_01rng__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 13664 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1input__range__printer_3_01rng__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 187 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1input__range__printer_3_01rng__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 3886 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1input__range__printer__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3101 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1input__range__printer__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6522 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integer__sequence__printer.html\n--rw-r--r-- 0 root (0) root (0) 8722 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integer__sequence__printer_3_01integer__sequence__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 8982 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integer__sequence__printer_3_01integer__sequence__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 3881 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integer__sequence__printer_3_01integer__sequence__t_01_4__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3096 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integer__sequence__printer_3_01integer__sequence__t_01_4__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integral__printer.html\n -rw-r--r-- 0 root (0) root (0) 6752 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integral__printer_3_01integral__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 10815 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integral__printer_3_01integral__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 11920 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integral__printer_3_01integral__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 189 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1integral__printer_3_01integral__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 8203 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1invalid__char__assignment-members.html\n--rw-r--r-- 0 root (0) root (0) 16526 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1invalid__char__assignment.html\n+-rw-r--r-- 0 root (0) root (0) 18086 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1invalid__char__assignment.html\n -rw-r--r-- 0 root (0) root (0) 426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1invalid__char__assignment.js\n -rw-r--r-- 0 root (0) root (0) 2649 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1invalid__char__assignment__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1864 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1invalid__char__assignment__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7291 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1io__error-members.html\n--rw-r--r-- 0 root (0) root (0) 10235 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1io__error.html\n+-rw-r--r-- 0 root (0) root (0) 10430 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1io__error.html\n -rw-r--r-- 0 root (0) root (0) 129 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1io__error.js\n -rw-r--r-- 0 root (0) root (0) 2532 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1io__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1747 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1io__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6752 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1is__constexpr__default__constructible-members.html\n--rw-r--r-- 0 root (0) root (0) 12011 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1is__constexpr__default__constructible.html\n+-rw-r--r-- 0 root (0) root (0) 12531 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1is__constexpr__default__constructible.html\n -rw-r--r-- 0 root (0) root (0) 213 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1is__constexpr__default__constructible.js\n -rw-r--r-- 0 root (0) root (0) 3586 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1is__constexpr__default__constructible__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2801 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1is__constexpr__default__constructible__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6460 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mask__printer.html\n -rw-r--r-- 0 root (0) root (0) 6701 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mask__printer_3_01mask__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11256 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mask__printer_3_01mask__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12426 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mask__printer_3_01mask__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 173 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mask__printer_3_01mask__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6635 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1match__score-members.html\n -rw-r--r-- 0 root (0) root (0) 10018 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1match__score.html\n -rw-r--r-- 0 root (0) root (0) 138 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1match__score.js\n -rw-r--r-- 0 root (0) root (0) 7703 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1match__score__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3771 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1match__score__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6662 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mismatch__score-members.html\n -rw-r--r-- 0 root (0) root (0) 10053 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mismatch__score.html\n -rw-r--r-- 0 root (0) root (0) 147 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mismatch__score.js\n -rw-r--r-- 0 root (0) root (0) 7725 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mismatch__score__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3790 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1mismatch__score__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7059 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1no__printer__found.html\n -rw-r--r-- 0 root (0) root (0) 6480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer.html\n -rw-r--r-- 0 root (0) root (0) 6792 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1nullopt__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11099 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1nullopt__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12009 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1nullopt__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 201 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1nullopt__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6853 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1optional_3_01T_01_4_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11333 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1optional_3_01T_01_4_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12828 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1optional_3_01T_01_4_01_4.html\n -rw-r--r-- 0 root (0) root (0) 219 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1optional__printer_3_01std_1_1optional_3_01T_01_4_01_4.js\n -rw-r--r-- 0 root (0) root (0) 7225 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1parse__error-members.html\n--rw-r--r-- 0 root (0) root (0) 9935 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1parse__error.html\n+-rw-r--r-- 0 root (0) root (0) 10000 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1parse__error.html\n -rw-r--r-- 0 root (0) root (0) 138 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1parse__error.js\n -rw-r--r-- 0 root (0) root (0) 2537 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1parse__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1752 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1parse__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8264 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pipeable__config__element.html\n -rw-r--r-- 0 root (0) root (0) 41039 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pipeable__config__element__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 37096 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pipeable__config__element__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9585 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple-members.html\n--rw-r--r-- 0 root (0) root (0) 18164 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple.html\n+-rw-r--r-- 0 root (0) root (0) 20569 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple.html\n -rw-r--r-- 0 root (0) root (0) 852 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple.js\n -rw-r--r-- 0 root (0) root (0) 9858 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_00_01types_8_8_8_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 21237 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_00_01types_8_8_8_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 24193 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_00_01types_8_8_8_01_4.html\n -rw-r--r-- 0 root (0) root (0) 840 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_00_01types_8_8_8_01_4.js\n -rw-r--r-- 0 root (0) root (0) 3363 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_00_01types_8_8_8_01_4__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2578 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_00_01types_8_8_8_01_4__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8607 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 12404 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 14874 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_01_4.html\n -rw-r--r-- 0 root (0) root (0) 721 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1pod__tuple_3_01type0_01_4.js\n -rw-r--r-- 0 root (0) root (0) 7054 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1printer__order-members.html\n--rw-r--r-- 0 root (0) root (0) 15977 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1printer__order.html\n+-rw-r--r-- 0 root (0) root (0) 18317 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1printer__order.html\n -rw-r--r-- 0 root (0) root (0) 144 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1printer__order.js\n -rw-r--r-- 0 root (0) root (0) 10627 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1printer__order__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 6695 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1printer__order__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6598 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1range__innermost__value-members.html\n--rw-r--r-- 0 root (0) root (0) 9621 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1range__innermost__value.html\n+-rw-r--r-- 0 root (0) root (0) 9751 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1range__innermost__value.html\n -rw-r--r-- 0 root (0) root (0) 153 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1range__innermost__value.js\n -rw-r--r-- 0 root (0) root (0) 2690 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1range__innermost__value__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1905 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1range__innermost__value__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9745 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1record-members.html\n--rw-r--r-- 0 root (0) root (0) 24502 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1record.html\n+-rw-r--r-- 0 root (0) root (0) 25322 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1record.html\n -rw-r--r-- 0 root (0) root (0) 753 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1record.js\n -rw-r--r-- 0 root (0) root (0) 20090 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1record__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 16166 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1record__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7100 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1ref__info__not__given.html\n -rw-r--r-- 0 root (0) root (0) 6993 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1remove__rvalue__reference-members.html\n--rw-r--r-- 0 root (0) root (0) 13051 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1remove__rvalue__reference.html\n+-rw-r--r-- 0 root (0) root (0) 13636 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1remove__rvalue__reference.html\n -rw-r--r-- 0 root (0) root (0) 284 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1remove__rvalue__reference.js\n -rw-r--r-- 0 root (0) root (0) 2702 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1remove__rvalue__reference__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1917 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1remove__rvalue__reference__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 9435 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__default__traits-members.html\n--rw-r--r-- 0 root (0) root (0) 33051 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__default__traits.html\n+-rw-r--r-- 0 root (0) root (0) 34492 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__default__traits.html\n -rw-r--r-- 0 root (0) root (0) 1062 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__default__traits.js\n -rw-r--r-- 0 root (0) root (0) 2905 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__default__traits__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2120 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__default__traits__inherit__graph_org.svg\n--rw-r--r-- 0 root (0) root (0) 8556 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__options.html\n+-rw-r--r-- 0 root (0) root (0) 8621 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__options.html\n -rw-r--r-- 0 root (0) root (0) 3443 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__options__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2658 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__input__options__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6912 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__output__options-members.html\n--rw-r--r-- 0 root (0) root (0) 10022 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__output__options.html\n+-rw-r--r-- 0 root (0) root (0) 10412 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__output__options.html\n -rw-r--r-- 0 root (0) root (0) 295 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__output__options.js\n -rw-r--r-- 0 root (0) root (0) 8472 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__program__info__t-members.html\n -rw-r--r-- 0 root (0) root (0) 12482 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__program__info__t.html\n -rw-r--r-- 0 root (0) root (0) 839 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__file__program__info__t.js\n -rw-r--r-- 0 root (0) root (0) 6482 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__flag__printer.html\n -rw-r--r-- 0 root (0) root (0) 6740 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__flag__printer_3_01sam__flag_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 10377 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__flag__printer_3_01sam__flag_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 11287 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__flag__printer_3_01sam__flag_01_4.html\n -rw-r--r-- 0 root (0) root (0) 187 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__flag__printer_3_01sam__flag_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6904 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__tag__type-members.html\n--rw-r--r-- 0 root (0) root (0) 23904 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__tag__type.html\n+-rw-r--r-- 0 root (0) root (0) 24585 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__tag__type.html\n -rw-r--r-- 0 root (0) root (0) 240 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sam__tag__type.js\n -rw-r--r-- 0 root (0) root (0) 8411 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__cfg_1_1error__count.html\n -rw-r--r-- 0 root (0) root (0) 3221 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__cfg_1_1error__count__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2436 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__cfg_1_1error__count__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__cfg_1_1error__rate.html\n -rw-r--r-- 0 root (0) root (0) 7819 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__cfg_1_1error__rate__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3875 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__cfg_1_1error__rate__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6507 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__result__printer.html\n -rw-r--r-- 0 root (0) root (0) 6967 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__result__printer_3_01search__result_3_01specs__t_8_8_8_01_4_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__result__printer_3_01search__result_3_01specs__t_8_8_8_01_4_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12550 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__result__printer_3_01search__result_3_01specs__t_8_8_8_01_4_01_4.html\n -rw-r--r-- 0 root (0) root (0) 255 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1search__result__printer_3_01search__result_3_01specs__t_8_8_8_01_4_01_4.js\n -rw-r--r-- 0 root (0) root (0) 7594 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1seed.html\n -rw-r--r-- 0 root (0) root (0) 3618 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1seed__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2833 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1seed__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8965 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__aa-members.html\n--rw-r--r-- 0 root (0) root (0) 26320 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__aa.html\n+-rw-r--r-- 0 root (0) root (0) 27555 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__aa.html\n -rw-r--r-- 0 root (0) root (0) 346 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__aa.js\n -rw-r--r-- 0 root (0) root (0) 3822 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__aa__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3037 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__aa__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8975 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__dna-members.html\n--rw-r--r-- 0 root (0) root (0) 30101 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__dna.html\n+-rw-r--r-- 0 root (0) root (0) 31158 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__dna.html\n -rw-r--r-- 0 root (0) root (0) 1023 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__dna.js\n -rw-r--r-- 0 root (0) root (0) 3823 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__dna__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3038 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__default__traits__dna__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7466 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__options-members.html\n--rw-r--r-- 0 root (0) root (0) 11127 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__options.html\n+-rw-r--r-- 0 root (0) root (0) 11582 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__options.html\n -rw-r--r-- 0 root (0) root (0) 446 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__options.js\n -rw-r--r-- 0 root (0) root (0) 3578 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__options__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 2793 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__input__options__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8330 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__output__options-members.html\n--rw-r--r-- 0 root (0) root (0) 11649 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__output__options.html\n+-rw-r--r-- 0 root (0) root (0) 12299 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__output__options.html\n -rw-r--r-- 0 root (0) root (0) 832 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__file__output__options.js\n -rw-r--r-- 0 root (0) root (0) 6480 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__printer.html\n -rw-r--r-- 0 root (0) root (0) 6751 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__printer_3_01sequence__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11213 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__printer_3_01sequence__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12448 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__printer_3_01sequence__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 189 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1sequence__printer_3_01sequence__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6460 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1simd__printer.html\n -rw-r--r-- 0 root (0) root (0) 6482 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__byte__printer.html\n -rw-r--r-- 0 root (0) root (0) 6752 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__byte__printer_3_01std_1_1byte_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 10196 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__byte__printer_3_01std_1_1byte_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 11106 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__byte__printer_3_01std_1_1byte_01_4.html\n -rw-r--r-- 0 root (0) root (0) 191 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__byte__printer_3_01std_1_1byte_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6455 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__printer.html\n -rw-r--r-- 0 root (0) root (0) 6688 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__printer_3_01type__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11786 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__printer_3_01type__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 13736 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__printer_3_01type__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 171 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__printer_3_01type__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6497 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__variant__printer.html\n -rw-r--r-- 0 root (0) root (0) 6971 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__variant__printer_3_01std_1_1variant_3_01variant__ts_8_8_8_01_4_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11585 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__variant__printer_3_01std_1_1variant_3_01variant__ts_8_8_8_01_4_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12755 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__variant__printer_3_01std_1_1variant_3_01variant__ts_8_8_8_01_4_01_4.html\n -rw-r--r-- 0 root (0) root (0) 257 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1std__variant__printer_3_01std_1_1variant_3_01variant__ts_8_8_8_01_4_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6497 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1strong__type__printer.html\n -rw-r--r-- 0 root (0) root (0) 13887 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__aa-members.html\n--rw-r--r-- 0 root (0) root (0) 52837 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__aa.html\n+-rw-r--r-- 0 root (0) root (0) 57452 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__aa.html\n -rw-r--r-- 0 root (0) root (0) 620 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__aa.js\n -rw-r--r-- 0 root (0) root (0) 3819 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__aa__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3034 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__aa__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 13903 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__rna-members.html\n--rw-r--r-- 0 root (0) root (0) 51575 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__rna.html\n+-rw-r--r-- 0 root (0) root (0) 55802 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__rna.html\n -rw-r--r-- 0 root (0) root (0) 2769 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__rna.js\n -rw-r--r-- 0 root (0) root (0) 3820 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__rna__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3035 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__default__traits__rna__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6777 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__options-members.html\n--rw-r--r-- 0 root (0) root (0) 9993 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__options.html\n+-rw-r--r-- 0 root (0) root (0) 10253 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__options.html\n -rw-r--r-- 0 root (0) root (0) 177 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__options.js\n -rw-r--r-- 0 root (0) root (0) 7351 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__options__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__input__options__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6963 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__output__options-members.html\n--rw-r--r-- 0 root (0) root (0) 9082 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__output__options.html\n+-rw-r--r-- 0 root (0) root (0) 9277 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__output__options.html\n -rw-r--r-- 0 root (0) root (0) 304 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1structure__file__output__options.js\n -rw-r--r-- 0 root (0) root (0) 7556 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1suffix__array__interval-members.html\n--rw-r--r-- 0 root (0) root (0) 14464 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1suffix__array__interval.html\n+-rw-r--r-- 0 root (0) root (0) 15699 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1suffix__array__interval.html\n -rw-r--r-- 0 root (0) root (0) 495 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1suffix__array__interval.js\n -rw-r--r-- 0 root (0) root (0) 6522 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1trace__directions__printer.html\n -rw-r--r-- 0 root (0) root (0) 7457 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1trace__directions__printer_3_01detail_1_1trace__directions_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 16027 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1trace__directions__printer_3_01detail_1_1trace__directions_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 17977 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1trace__directions__printer_3_01detail_1_1trace__directions_01_4.html\n -rw-r--r-- 0 root (0) root (0) 389 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1trace__directions__printer_3_01detail_1_1trace__directions_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6465 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1tuple__printer.html\n -rw-r--r-- 0 root (0) root (0) 6709 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1tuple__printer_3_01tuple__t_01_4-members.html\n--rw-r--r-- 0 root (0) root (0) 11099 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1tuple__printer_3_01tuple__t_01_4.html\n+-rw-r--r-- 0 root (0) root (0) 12269 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1tuple__printer_3_01tuple__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 177 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1tuple__printer_3_01tuple__t_01_4.js\n -rw-r--r-- 0 root (0) root (0) 6878 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1type__list-members.html\n--rw-r--r-- 0 root (0) root (0) 8952 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1type__list.html\n+-rw-r--r-- 0 root (0) root (0) 9212 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1type__list.html\n -rw-r--r-- 0 root (0) root (0) 127 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1type__list.js\n -rw-r--r-- 0 root (0) root (0) 7329 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unexpected__end__of__input-members.html\n--rw-r--r-- 0 root (0) root (0) 10087 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unexpected__end__of__input.html\n+-rw-r--r-- 0 root (0) root (0) 10152 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unexpected__end__of__input.html\n -rw-r--r-- 0 root (0) root (0) 178 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unexpected__end__of__input.js\n -rw-r--r-- 0 root (0) root (0) 2683 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unexpected__end__of__input__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1898 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unexpected__end__of__input__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6459 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1ungapped-members.html\n -rw-r--r-- 0 root (0) root (0) 7930 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1ungapped.html\n -rw-r--r-- 0 root (0) root (0) 124 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1ungapped.js\n -rw-r--r-- 0 root (0) root (0) 7359 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unhandled__extension__error-members.html\n--rw-r--r-- 0 root (0) root (0) 10050 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unhandled__extension__error.html\n+-rw-r--r-- 0 root (0) root (0) 10115 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unhandled__extension__error.html\n -rw-r--r-- 0 root (0) root (0) 182 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unhandled__extension__error.js\n -rw-r--r-- 0 root (0) root (0) 2650 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unhandled__extension__error__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 1865 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1unhandled__extension__error__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 7876 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1window__size.html\n -rw-r--r-- 0 root (0) root (0) 3848 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1window__size__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 3063 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structseqan3_1_1window__size__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6636 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structstd_1_1hash_3_01alphabet__t_01_4-members.html\n@@ -3418,29 +3420,29 @@\n -rw-r--r-- 0 root (0) root (0) 8463 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structstd_1_1tuple__size_3_01t_3_01types_8_8_8_01_4_01_4.html\n -rw-r--r-- 0 root (0) root (0) 4957 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structstd_1_1tuple__size_3_01t_3_01types_8_8_8_01_4_01_4__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 4172 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structstd_1_1tuple__size_3_01t_3_01types_8_8_8_01_4_01_4__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 8388 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structstd_1_1tuple__size_3_01tuple__t_01_4.html\n -rw-r--r-- 0 root (0) root (0) 8285 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structstd_1_1tuple__size_3_01tuple__t_01_4__inherit__graph.svg\n -rw-r--r-- 0 root (0) root (0) 4341 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structstd_1_1tuple__size_3_01tuple__t_01_4__inherit__graph_org.svg\n -rw-r--r-- 0 root (0) root (0) 6418 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2input_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 146252 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2input_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 145151 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2input_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6497 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2input__format__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 36005 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2input__format__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6460 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2input__options_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11230 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2input__options_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6502 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2output__format__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 35678 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2output__format__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6465 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2output__options_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12028 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2output__options_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6423 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2record_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 49973 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2record_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 51925 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structure__file_2record_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6427 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structured__aa_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 34332 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structured__aa_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 36341 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structured__aa_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6432 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structured__rna_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 43195 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structured__rna_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 46298 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/structured__rna_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 30851 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/subcommand_arg_parse.html\n -rw-r--r-- 0 root (0) root (0) 6445 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/suspendable__queue_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 68804 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/suspendable__queue_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 115249 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/svg.min.js\n -rw-r--r-- 0 root (0) root (0) 812 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sync_off.png\n -rw-r--r-- 0 root (0) root (0) 804 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/sync_on.png\n -rw-r--r-- 0 root (0) root (0) 167 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tab_a.png\n@@ -3461,89 +3463,89 @@\n -rw-r--r-- 0 root (0) root (0) 6450 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/template__inspection_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 29051 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/template__inspection_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6404 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/terminal_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 14436 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/terminal_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6420 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/test__accessor_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8825 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/test__accessor_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6365 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 9600 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 10021 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__char_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 12709 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__char_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6440 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__little__endian_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15057 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__little__endian_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6393 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__rank_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13105 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__rank_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6504 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__string_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11635 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/to__string_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6238 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/todo.html\n -rw-r--r-- 0 root (0) root (0) 23134 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/topics.html\n -rw-r--r-- 0 root (0) root (0) 501 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/topics.js\n -rw-r--r-- 0 root (0) root (0) 6538 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__directions_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 27813 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__directions_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 29695 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__directions_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6528 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__iterator_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13336 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__iterator_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6565 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__iterator__banded_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 18093 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__iterator__banded_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6555 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__iterator__base_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 37209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__iterator__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6545 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__matrix__full_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 43209 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trace__matrix__full_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6494 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/transfer__type__modifier__onto_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 14503 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/transfer__type__modifier__onto_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6410 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/transform_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 19741 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/transform_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 20694 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/transform_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6578 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/transformation__trait__or_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11294 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/transformation__trait__or_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6401 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translate_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 111907 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translate_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6428 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translate__join_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 53713 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translate__join_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6415 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translation_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 21232 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translation_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 22793 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translation_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6457 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translation__details_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 229833 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translation__details_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6484 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translation__genetic__code_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13180 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/translation__genetic__code_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6418 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trim__quality_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 20431 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/trim__quality_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6384 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tuple_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 16346 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tuple_8hpp_source.html\n--rw-r--r-- 0 root (0) root (0) 55146 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_alphabets.html\n--rw-r--r-- 0 root (0) root (0) 9293 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_argument_parser.html\n--rw-r--r-- 0 root (0) root (0) 47855 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_concepts.html\n--rw-r--r-- 0 root (0) root (0) 25368 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_first_example.html\n--rw-r--r-- 0 root (0) root (0) 98556 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_index_search.html\n--rw-r--r-- 0 root (0) root (0) 40310 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_minimiser.html\n--rw-r--r-- 0 root (0) root (0) 99489 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_pairwise_alignment.html\n--rw-r--r-- 0 root (0) root (0) 53369 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_ranges.html\n--rw-r--r-- 0 root (0) root (0) 179918 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_read_mapper.html\n--rw-r--r-- 0 root (0) root (0) 74215 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_sam_file.html\n--rw-r--r-- 0 root (0) root (0) 85648 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_sequence_file.html\n+-rw-r--r-- 0 root (0) root (0) 16995 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tuple_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 56464 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_alphabets.html\n+-rw-r--r-- 0 root (0) root (0) 9294 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_argument_parser.html\n+-rw-r--r-- 0 root (0) root (0) 52380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_concepts.html\n+-rw-r--r-- 0 root (0) root (0) 26033 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_first_example.html\n+-rw-r--r-- 0 root (0) root (0) 108411 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_index_search.html\n+-rw-r--r-- 0 root (0) root (0) 44227 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_minimiser.html\n+-rw-r--r-- 0 root (0) root (0) 106391 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_pairwise_alignment.html\n+-rw-r--r-- 0 root (0) root (0) 52802 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_ranges.html\n+-rw-r--r-- 0 root (0) root (0) 180299 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_read_mapper.html\n+-rw-r--r-- 0 root (0) root (0) 80050 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_sam_file.html\n+-rw-r--r-- 0 root (0) root (0) 89034 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/tutorial_sequence_file.html\n -rw-r--r-- 0 root (0) root (0) 6570 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/two__dimensional__matrix_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 58359 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/two__dimensional__matrix_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6644 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/two__dimensional__matrix__iterator__base_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 52204 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/two__dimensional__matrix__iterator__base_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6659 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/two__dimensional__matrix__iterator__concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 17386 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/two__dimensional__matrix__iterator__concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6413 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list_2traits_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 68834 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list_2traits_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 77280 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list_2traits_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6406 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 12402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 12823 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6556 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list__algorithm_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 18536 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__list__algorithm_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6457 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__name__as__string_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 21228 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__name__as__string_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6413 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__pack_2traits_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 48692 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__pack_2traits_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 56520 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__pack_2traits_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6556 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__pack__algorithm_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13899 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__pack__algorithm_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6412 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__reduce_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 22322 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/type__reduce_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6381 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/uint_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 21679 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/uint_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 23848 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/uint_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6514 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/unidirectional__search__algorithm_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 49337 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/unidirectional__search__algorithm_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6067 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/usergroup0.html\n -rw-r--r-- 0 root (0) root (0) 7097 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/usergroup1.html\n -rw-r--r-- 0 root (0) root (0) 6555 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/usergroup2.html\n -rw-r--r-- 0 root (0) root (0) 6510 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/usergroup3.html\n -rw-r--r-- 0 root (0) root (0) 6154 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/usergroup4.html\n@@ -3562,42 +3564,42 @@\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2range_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8444 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2range_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2range_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 15666 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2range_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2tuple_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9671 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2tuple_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2tuple_2concept_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 25181 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2tuple_2concept_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 25264 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2tuple_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__list_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8489 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__list_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6416 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__pack_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 8089 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__pack_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__traits_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 9498 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__traits_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6442 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__traits_2concept_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 11097 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2type__traits_2concept_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6402 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2views_2all_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 13761 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2views_2all_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6422 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2views_2convert_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 12648 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2views_2convert_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 13373 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/utility_2views_2convert_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6445 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/validate__char__for_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 13847 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/validate__char__for_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 14496 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/validate__char__for_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6316 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/validators_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 201458 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/validators_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 211407 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/validators_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6394 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/variant_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 14951 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/variant_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 15828 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/variant_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 2765 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/version.js\n -rw-r--r-- 0 root (0) root (0) 821 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/version.php\n -rw-r--r-- 0 root (0) root (0) 6194 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/version_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 20832 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/version_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6431 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/version__check_8hpp.html\n -rw-r--r-- 0 root (0) root (0) 96576 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/version__check_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6380 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/wuss_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 52088 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/wuss_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 55217 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/wuss_8hpp_source.html\n -rw-r--r-- 0 root (0) root (0) 6370 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/zip_8hpp.html\n--rw-r--r-- 0 root (0) root (0) 10417 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/zip_8hpp_source.html\n+-rw-r--r-- 0 root (0) root (0) 10838 2025-02-12 09:42:19.000000 ./usr/share/doc/libseqan3-dev/html/zip_8hpp_source.html\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/share/doc/seqan3-doc/\n -rw-r--r-- 0 root (0) root (0) 3695 2025-02-12 09:42:19.000000 ./usr/share/doc/seqan3-doc/changelog.Debian.gz\n -rw-r--r-- 0 root (0) root (0) 15747 2024-12-19 11:51:18.000000 ./usr/share/doc/seqan3-doc/changelog.gz\n -rw-r--r-- 0 root (0) root (0) 4953 2025-02-11 15:44:24.000000 ./usr/share/doc/seqan3-doc/copyright\n drwxr-xr-x 0 root (0) root (0) 0 2025-02-12 09:42:19.000000 ./usr/share/doc-base/\n -rw-r--r-- 0 root (0) root (0) 686 2024-08-15 10:30:06.000000 ./usr/share/doc-base/seqan3-doc.seqan-doc\n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/aa10li_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/aa10li_8hpp_source.html", "unified_diff": "@@ -140,36 +140,36 @@\n
17
\n
18namespace seqan3
\n
19{
\n
\n
79class aa10li : public aminoacid_base<aa10li, 10>
\n
80{
\n
81private:
\n-
83 using base_t = aminoacid_base<aa10li, 10>;
\n+
83 using base_t = aminoacid_base<aa10li, 10>;
\n
84
\n
86 friend base_t;
\n
89 friend base_t::base_t;
\n
91
\n
92public:
\n-
96 constexpr aa10li() noexcept = default;
\n-
97 constexpr aa10li(aa10li const &) noexcept = default;
\n-
98 constexpr aa10li(aa10li &&) noexcept = default;
\n-
99 constexpr aa10li & operator=(aa10li const &) noexcept = default;
\n-
100 constexpr aa10li & operator=(aa10li &&) noexcept = default;
\n-
101 ~aa10li() noexcept = default;
\n+
96 constexpr aa10li() noexcept = default;
\n+
97 constexpr aa10li(aa10li const &) noexcept = default;
\n+
98 constexpr aa10li(aa10li &&) noexcept = default;
\n+
99 constexpr aa10li & operator=(aa10li const &) noexcept = default;
\n+
100 constexpr aa10li & operator=(aa10li &&) noexcept = default;
\n+
101 ~aa10li() noexcept = default;
\n
102
\n-
104 using base_t::base_t;
\n+
104 using base_t::base_t;
\n
106
\n-
107private:
\n-
109 static constexpr char_type rank_to_char_table[alphabet_size]{'A', 'B', 'C', 'F', 'G', 'H', 'I', 'J', 'K', 'P'};
\n+
107private:
\n+
109 static constexpr char_type rank_to_char_table[alphabet_size]{'A', 'B', 'C', 'F', 'G', 'H', 'I', 'J', 'K', 'P'};
\n
110
\n-
112 static constexpr rank_type char_to_rank(char_type const chr)
\n+
112 static constexpr rank_type char_to_rank(char_type const chr)
\n
113 {
\n
114 using index_t = std::make_unsigned_t<char_type>;
\n-
115 return char_to_rank_table[static_cast<index_t>(chr)];
\n+
115 return char_to_rank_table[static_cast<index_t>(chr)];
\n
116 }
\n
117
\n
119 static constexpr char_type rank_to_char(rank_type const rank)
\n
120 {
\n
121 return rank_to_char_table[rank];
\n
122 }
\n
123
\n@@ -236,28 +236,28 @@\n
189
\n
190// ------------------------------------------------------------------
\n
191// literals
\n
192// ------------------------------------------------------------------
\n
193inline namespace literals
\n
194{
\n
195
\n-
209constexpr aa10li operator""_aa10li(char const c) noexcept
\n+
209constexpr aa10li operator""_aa10li(char const c) noexcept
\n
210{
\n-
211 return aa10li{}.assign_char(c);
\n+
211 return aa10li{}.assign_char(c);
\n
212}
\n
213
\n-
225SEQAN3_WORKAROUND_LITERAL aa10li_vector operator""_aa10li(char const * const s, size_t const n)
\n+
225SEQAN3_WORKAROUND_LITERAL aa10li_vector operator""_aa10li(char const * const s, size_t const n)
\n
226{
\n-
227 aa10li_vector r;
\n-
228 r.resize(n);
\n+
227 aa10li_vector r;
\n+
228 r.resize(n);
\n
229
\n-
230 for (size_t i = 0; i < n; ++i)
\n-
231 r[i].assign_char(s[i]);
\n+
230 for (size_t i = 0; i < n; ++i)
\n+
231 r[i].assign_char(s[i]);
\n
232
\n-
233 return r;
\n+
233 return r;
\n
234}
\n
236
\n
237} // namespace literals
\n
238
\n
239} // namespace seqan3
\n
concept.hpp
Provides seqan3::aminoacid_alphabet.
\n
aminoacid_base.hpp
Provides seqan3::aminoacid_base.
\n@@ -266,21 +266,21 @@\n
seqan3::aa10li::aa10li
constexpr aa10li() noexcept=default
Defaulted.
\n
seqan3::alphabet_base< aa10li, size, char >
\n
seqan3::alphabet_base::assign_char
constexpr derived_type & assign_char(char_type const chr) noexcept
Assign from a character, implicitly converts invalid characters.
Definition alphabet_base.hpp:160
\n
seqan3::alphabet_base::rank_type
detail::min_viable_uint_t< size - 1 > rank_type
The type of the alphabet when represented as a number (e.g. via to_rank()).
Definition alphabet_base.hpp:77
\n
seqan3::alphabet_base::alphabet_size
static constexpr detail::min_viable_uint_t< size > alphabet_size
The size of the alphabet, i.e. the number of different values it can take.
Definition alphabet_base.hpp:196
\n
seqan3::alphabet_base::char_type
std::conditional_t< std::same_as< char_t, void >, char, char_t > char_type
The char representation; conditional needed to make semi alphabet definitions legal.
Definition alphabet_base.hpp:69
\n
seqan3::aminoacid_base
A CRTP-base that refines seqan3::alphabet_base and is used by the amino acids.
Definition aminoacid_base.hpp:30
\n+
seqan3::debug_stream_type
A "pretty printer" for most SeqAn data structures and related types.
Definition debug_stream_type.hpp:79
\n \n
std::array::fill
T fill(T... args)
\n \n
seqan3
The main SeqAn3 namespace.
Definition aligned_sequence_concept.hpp:26
\n
seqan3::to_lower
constexpr char_type to_lower(char_type const c) noexcept
Converts 'A'-'Z' to 'a'-'z' respectively; other characters are returned as is.
Definition transform.hpp:74
\n
SEQAN3_WORKAROUND_LITERAL
#define SEQAN3_WORKAROUND_LITERAL
Our char literals returning std::vector should be constexpr if constexpr std::vector is supported.
Definition platform.hpp:294
\n-
std::vector::resize
T resize(T... args)
\n
transform.hpp
Provides utilities for modifying characters.
\n \n
\n \n \n \n \n \n \n \n \n
\n

Table of Contents

\n-
\n

This changelog contains a top-level entry for each release with sections on new features, API changes and notable bug-fixes (not all bug-fixes will be listed).

\n

Get to know SeqAn3 with our tutorials.

\n

Please see the release announcement: https://www.seqan.de/announcing-seqan3/

\n

See the porting guide for some help on porting: https://docs.seqan.de/seqan3/main_user/howto_porting.html

\n

See the documentation on API stability to learn about when API changes are allowed.

\n-

\n+

\n 3.4.0

\n-

\n+

\n New features

\n

I/O

\n \n-

\n+

\n Notable Bug-fixes

\n

Alphabet

\n \n

Alignment

\n
    \n
  • Fixed an issue that caused incorrect begin and end positions for banded alignments (#3269).
    • \n
\n

I/O

\n \n-

\n+

\n API changes

\n

Compiler

\n
    \n
  • Supported compiler:
      \n
    • GCC 12, 13, 14
      • \n
    • Clang 17, 18, 19
      • \n
    • IntelOneAPI/IntelLLVM 2024.0
      • \n@@ -201,17 +201,17 @@\n

      Dependencies

      \n
        \n
      • We now use Doxygen version 1.9.8 to build our documentation (#3197).
        • \n
      • We bumped the minimal CMake version to 3.20 (#3314).
        • \n
      • Dependencies are now managed via CPM instead of submodules (#3328).
        • \n
      • The build_system directory was renamed to cmake (#3292).
        • \n
      \n-

      \n+

      \n 3.3.0

      \n-

      \n+

      \n New features

      \n

      Alignment

      \n \n

      Alphabet

      \n@@ -224,15 +224,15 @@\n \n

      Search

      \n \n-

      \n+

      \n Notable Bug-fixes

      \n

      Alignment

      \n
        \n
      • Resolved an issue resulting in a wrong alignment score (#3098).
        • \n
      \n

      I/O

      \n \n

      Utility

      \n
        \n
      • Fixed spin delay having no effect on the PowerPC platform (#3129).
        • \n
      \n-

      \n+

      \n API changes

      \n

      Alignment

      \n \n

      Compiler

      \n
        \n@@ -258,17 +258,17 @@\n

        Dependencies

        \n
          \n
        • We require at least CMake 3.16 for our test suite. Note that the minimum requirement for using SeqAn3 is unchanged (#3050).
          • \n
        • We now use Doxygen version 1.9.6 to build our documentation (#3116).
          • \n
        • Updated sdsl-lite to 3.0.3 (#3170, #3174).
          • \n
        • Compatibility with SeqAn2: SeqAn2's namespace was changed from seqan to seqan2. For interoperability, an up-to-date checkout of SeqAn2's main branch is required (#3156).
          • \n
        \n-

        \n+

        \n 3.2.0

        \n-

        \n+

        \n New features

        \n

        Alphabet

        \n \n

        I/O

        \n@@ -279,15 +279,15 @@\n
          \n
        • Improved performance of seqan3::counting_vector::operator+= (#2930).
          • \n
        \n

        Utility

        \n \n-

        \n+

        \n Notable Bug-fixes

        \n

        Core

        \n
          \n
        • Added missing implementations for AVX512 (#2920 and #2926).
          • \n
        \n

        IO

        \n
          \n@@ -301,15 +301,15 @@\n
        \n

        Utility

        \n
          \n
        • seqan3::views::single_pass_input cannot propagate the std::ranges::output_range property because it cannot satisfy the following requirement (#2775): cpp *it++ = value; // must be the same as *it = value; ++it; // but it actually would be the same as ++it; *it = value;
          • \n
        • Fixed signature of seqan3::detail::store_sse4. This might have affected some public API (#2893).
          • \n
        • Relaxed seqan3::views::to_simd requirements to be C++20-compatible (#2849).
          • \n
        \n-

        \n+

        \n API changes

        \n

        GCC 7, 8, and 9 have been removed. All headers in seqan3/std/ except charconv and new have been deprecated, please use the equivalent std includes. The namespace std::cpp20 has been deprecated, please use std::.

        \n

        seqan3::views::to has been changed to seqan3::ranges::to. Since it is not a view anymore, it cannot be properly deprecated. Please keep this in mind if you encounter errors with seqan3::views::to.

        \n

        Compiler

        \n
          \n
        • Dropped support for GCC 7 and 8 (#2891).
          • \n
        • Dropped support for GCC 9 (#2952).
          • \n@@ -331,43 +331,43 @@\n

          Dependencies

          \n
            \n
          • We now use Doxygen version 1.9.4 to build our documentation (#2979).
            • \n
          • Removed range-v3 (#2998).
            • \n
          • Updated cereal to 1.3.2 (#3012).
            • \n
          • Updated sdsl-lite to 3.0.1 (#3012).
            • \n
          \n-

          \n+

          \n 3.1.0

          \n-

          \n+

          \n New features

          \n

          Build system

          \n
            \n
          • We now use Doxygen version 1.9.2 to build our documentation (#2765).
            • \n
          \n-

          \n+

          \n Notable Bug-fixes

          \n

          Argument Parser

          \n
            \n
          • Fixed an issue that led to the wrong option type being printed on errors (#2836).
            • \n
          \n

          Search

          \n
            \n
          • Resolved an issue that prevented the FM-Index from being constructed correctly for inputs larger than 4 GiB (#2756).
            • \n
          \n-

          \n+

          \n API changes

          \n

          The files deprecated in 3.0.3 (denoted by [deleted without replacement]) have been removed.

          \n-

          \n+

          \n 3.0.3

          \n

          Note that 3.1.0 will be the first API stable release and interfaces in this release might still change.

          \n
            \n
          • Check out our updated SeqAn3 Cookbook. It contains a listing of code examples on how to perform particular tasks using the library.
            • \n
          • SeqAn 3.0.3 is known to compile with GCC 7.5, 8.4, 9.3, 10.3, and 11.1. Future versions (e.g. GCC 11.2 and 12) might work, but were not yet available at the time of this release.
            • \n
          \n-

          \n+

          \n New features

          \n

          Alphabet

          \n
            \n
          • Added seqan3::phred94, a quality type that represents the full Phred Score range (Sanger format) and is used for PacBio Phred scores of HiFi reads (#2290).
            • \n
          \n

          Argument Parser

          \n

Search

\n \n-

\n+

\n 3.0.2

\n

Note that 3.1.0 will be the first API stable release and interfaces in this release might still change.

\n \n-

\n+

\n New features

\n

Alignment

\n \n@@ -761,15 +761,15 @@\n \n

Search

\n \n-

\n+

\n API changes

\n \n

Alignment

\n

\n Notable Bug-fixes

\n

Alignment

\n \n

Argument Parser

\n@@ -880,18 +880,18 @@\n
  • seqan3::fm_index and seqan3::bi_fm_index construct the index correctly if a collection with a single text is passed as input (#1892).
    • \n \n

    Range

    \n \n-

    \n+

    \n 3.0.1

    \n

    Note that 3.1.0 will be the first API stable release and interfaces in this release might still change.

    \n-

    \n+

    \n New features

    \n

    Alphabet

    \n \n

    Alignment

    \n@@ -939,15 +939,15 @@\n \n

    Std

    \n \n-

    \n+

    \n API changes

    \n \n

    Alphabet

    \n@@ -994,30 +994,30 @@\n

    Search

    \n \n-

    \n+

    \n Notable Bug-fixes

    \n \n-

    \n+

    \n 3.0.0 (\"Escala\")

    \n

    This is the initial release of SeqAn3. It is an entirely new library so there is no changelog that covers the differences to SeqAn2.

    \n

    Note that 3.1.0 will be the first API stable release and interfaces in this release might still change.

    \n \n \n \n \n
    \n

    First of all, thanks for wanting to contribute to SeqAn! Community is important to us and we strive to maintain a great culture and atmosphere. Please have a look at our Code of Conduct.

    \n

    The following is a guide that helps stream-line the process of adding changes. If you haven't contributed to SeqAn before, don't worry about getting something wrong, that's absolutely OK. However, following this guide closely will reduce work for all of us and increases the chance of your changes being merged quickly.

    \n-

    \n+

    \n Pull request workflow

    \n

    The overall workflow of contributing changes to this repository is:

    \n
      \n
    1. Create an issue with bug report or feature request.
      2. \n
    2. Wait for comments from the team and then collectively decide on the best way to solve the issue.
      3. \n
    3. Fork the repository and create a branch on your fork.
      4. \n
    4. Commit the solution to your local branch.
      5. \n
    5. Create a pull-request to our main branch from your branch.
      6. \n
    6. Wait for reviews and resolve reviewer comments.
      7. \n
    7. Wait for the PR to be merged.
      8. \n
    \n-

    \n+

    \n Creating an issue

    \n

    Go to https://github.com/seqan/seqan3/issues and check if someone else has already reported the same issue. If not, create a new issue and follow the template.

    \n

    We usually reply quickly to issues; if there is no reply within a week (and it's not prime vacation season in Europe) feel free to reply to the issue and explicitly mention @seqan/core.

    \n-

    \n+

    \n Creating commits

    \n

    If you have never used the Fork & Pull Model, have a look at this guide.

    \n

    When creating commits to your branch and before requesting a pull, please ensure the following:

    \n
      \n
    • Proper naming of commits (see below).
      • \n
    • Content other than the first line is irrelevant in the commit message.
      • \n
    • The number of commits should be minimal and commits shouldn't revert/change previous ones.
        \n@@ -157,20 +157,20 @@\n
        [FIX] Whenever you fix some wrong code in the source
        \n
        [DOC] Whenever you do something only(!) related to the documentation
        \n
        [INFRA] Whenever you change something of the build system or CI related
        \n
        [TEST] Whenever you do something related to the tests (unit or benchmark)
        \n
        [MISC] Whenever it does not fit to any of the above
        \n

    E.g. [FEATURE] add support for FOO or [FIX] divide by zero in alignment.

    \n

    Alternatively, if your changes are so small that they would fit into one commit, don't worry about any of the above, just state \"Please squash commits\" in the PR and we will take care of the rest.

    \n-

    \n+

    \n Opening a pull-request (\"PR\")

    \n

    When you are done with committing changes to your branch and you have tested your changes, open a pull request. We have continuous integration in place that should inform you of test failures. Please try to resolve any breakage that your pull request introduces.

    \n

    Here is a guide for setting up unit tests locally.

    \n

    If there are test failures that you don't understand, clearly indicate that you have seen the errors, but cannot resolve them \u2013 then the first reviewer will have a look at them. Otherwise the PR will be treated as still being work-in-progress.

    \n-

    \n+

    \n The review process

    \n

    Request first review

    \n

    After opening a PR it goes through the review process. This is a two-step process, first a regular member of the team needs to approve your changes, then one of the project owners (@h-2 or @rrahn) needs to approve and merge it. If you are a collaborator of the project and know the SeqAn team member best suitable for the review you can request a review yourself. Otherwise wait for a reviewer to be assigned to the PR. Do not request reviews from a project owner at this point. Always only request review from one person at a time.

    \n

    Resolve comments

    \n

    If you have not contributed to SeqAn before, you will likely receive a lot of comments on the style of your code. This is not a sign that we don't appreciate your contribution, but we have high code quality standards and everything must conform to our style guide. In the future we hope to automate this step. After you have received the first review, go through all comments and clarify any suggestions and requests. When you are confident that you know how to address all comments, implement the changes and update your PR.

    \n

    Re-request review

    \n

    Now re-request a review from the previous reviewer either by clicking \"re-request review\" or by writing \"please review\n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/about_copyright.html", "source2": "./usr/share/doc/libseqan3-dev/html/about_copyright.html", "unified_diff": "@@ -139,15 +139,15 @@\n

    \n \n \n Dependencies

    \"\"

    \n

    \n \n \n-

    \n+

    \n Source code license

    \n

    The contents of this repository/directory, in particular the library source code of SeqAn3, are licensed under the following terms:

    \n
    Copyright (c) 2006-2023, Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    Copyright (c) 2016-2023, Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    All rights reserved.
    \n
    \n
    Redistribution and use in source and binary forms, with or without
    \n@@ -169,26 +169,26 @@\n
    FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
    \n
    DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR
    \n
    SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER
    \n
    CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
    \n
    LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
    \n
    OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH
    \n
    DAMAGE.
    \n-

    \n+

    \n Documentation

    \n

    The API documentation and manual are additionally provided under the terms of the Creative Commons Attribution 4.0 International License. This includes

    \n

    The source code examples and snippets within the documentation are additionally provided under the terms of the Creative Commons Public Domain Dedication 1.0. This includes:

    \n-

    \n+

    \n Submodules

    \n

    This repository/directory may contain other projects' content in the submodules-subfolder. We try to ensure that all dependencies are permissively licensed (BSD/MIT/X11/ISC/Boost\u2026), but please verify the respective license files yourself.

    \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/align__config__on__result_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/align__config__on__result_8hpp_source.html", "unified_diff": "@@ -142,45 +142,46 @@\n
    19{
    \n
    20
    \n
    49template <std::copy_constructible callback_t>
    \n
    \n
    50class on_result : private seqan3::pipeable_config_element
    \n
    51{
    \n
    52public:
    \n-
    54 seqan3::detail::copyable_wrapper_t<callback_t> callback; // Allows lambdas with capture blocks.
    \n+
    54 seqan3::detail::copyable_wrapper_t<callback_t> callback; // Allows lambdas with capture blocks.
    \n
    55
    \n
    59 constexpr on_result() = default;
    \n
    60 constexpr on_result(on_result const &) = default;
    \n
    61 constexpr on_result(on_result &&) = default;
    \n
    62 constexpr on_result & operator=(on_result const &) = default;
    \n
    63 constexpr on_result & operator=(on_result &&) = default;
    \n
    64 ~on_result() = default;
    \n
    65
    \n
    \n-
    69 constexpr explicit on_result(callback_t && callback) : callback{std::forward<callback_t>(callback)}
    \n+
    69 constexpr explicit on_result(callback_t && callback) : callback{std::forward<callback_t>(callback)}
    \n
    70 {}
    \n
    \n
    72
    \n
    75 static constexpr seqan3::detail::align_config_id id{seqan3::detail::align_config_id::on_result};
    \n
    76};
    \n
    \n
    77
    \n
    82template <std::copy_constructible callback_t>
    \n-
    83on_result(callback_t &&) -> on_result<std::decay_t<callback_t>>;
    \n+
    83on_result(callback_t &&) -> on_result<std::decay_t<callback_t>>;
    \n
    85} // namespace seqan3::align_cfg
    \n
    detail.hpp
    Provides some utility functions for the alignment configurations.
    \n
    seqan3::align_cfg::on_result
    Configuration element to provide a user defined callback function for the alignment.
    Definition align_config_on_result.hpp:51
    \n
    seqan3::align_cfg::on_result::~on_result
    ~on_result()=default
    Defaulted.
    \n
    seqan3::align_cfg::on_result::on_result
    constexpr on_result()=default
    Defaulted.
    \n
    seqan3::align_cfg::on_result::on_result
    constexpr on_result(on_result &&)=default
    Defaulted.
    \n
    seqan3::align_cfg::on_result::operator=
    constexpr on_result & operator=(on_result &&)=default
    Defaulted.
    \n
    seqan3::align_cfg::on_result::operator=
    constexpr on_result & operator=(on_result const &)=default
    Defaulted.
    \n
    seqan3::align_cfg::on_result::on_result
    constexpr on_result(callback_t &&callback)
    Constructs the configuration element with the given user callback.
    Definition align_config_on_result.hpp:69
    \n
    seqan3::align_cfg::on_result::on_result
    constexpr on_result(on_result const &)=default
    Defaulted.
    \n
    seqan3::align_cfg::on_result::callback
    seqan3::detail::copyable_wrapper_t< callback_t > callback
    The stored callable which will be invoked with the alignment result.
    Definition align_config_on_result.hpp:54
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    copyable_wrapper.hpp
    Provides seqan3::detail::copyable_wrapper.
    \n
    seqan3::align_cfg
    A special sub namespace for the alignment configurations.
    Definition align_config_band.hpp:22
    \n
    std
    SeqAn specific customisations in the standard namespace.
    \n
    pipeable_config_element.hpp
    Provides seqan3::pipeable_config_element.
    \n
    seqan3::pipeable_config_element
    Adds pipe interface to configuration elements.
    Definition pipeable_config_element.hpp:29
    \n
    type_traits
    \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/align__config__scoring__scheme_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/align__config__scoring__scheme_8hpp_source.html", "unified_diff": "@@ -162,29 +162,30 @@\n \n
    67
    \n
    70 static constexpr seqan3::detail::align_config_id id{seqan3::detail::align_config_id::scoring};
    \n
    71};
    \n \n
    72
    \n
    79template <typename scheme_t>
    \n-
    80scoring_scheme(scheme_t) -> scoring_scheme<std::remove_cvref_t<scheme_t>>;
    \n+
    80scoring_scheme(scheme_t) -> scoring_scheme<std::remove_cvref_t<scheme_t>>;
    \n
    82
    \n
    83} // namespace seqan3::align_cfg
    \n
    detail.hpp
    Provides some utility functions for the alignment configurations.
    \n
    basic.hpp
    Provides various type traits on generic types.
    \n
    seqan3::align_cfg::scoring_scheme
    Sets the scoring scheme for the alignment algorithm.
    Definition align_config_scoring_scheme.hpp:42
    \n
    seqan3::align_cfg::scoring_scheme::scoring_scheme
    constexpr scoring_scheme(scoring_scheme_t scheme)
    Initialises the scoring scheme config with the given scheme.
    Definition align_config_scoring_scheme.hpp:64
    \n
    seqan3::align_cfg::scoring_scheme::scoring_scheme
    scoring_scheme(scheme_t) -> scoring_scheme< std::remove_cvref_t< scheme_t > >
    Deduces the scoring scheme type from the constructor argument.
    \n
    seqan3::align_cfg::scoring_scheme::scheme
    scoring_scheme_t scheme
    The scoring scheme to be used in the alignment algorithm.
    Definition align_config_scoring_scheme.hpp:45
    \n
    seqan3::align_cfg::scoring_scheme::operator=
    constexpr scoring_scheme & operator=(scoring_scheme &&)=default
    Defaulted.
    \n
    seqan3::align_cfg::scoring_scheme::scoring_scheme
    constexpr scoring_scheme()=default
    Defaulted.
    \n
    seqan3::align_cfg::scoring_scheme::operator=
    constexpr scoring_scheme & operator=(scoring_scheme const &)=default
    Defaulted.
    \n
    seqan3::align_cfg::scoring_scheme::scoring_scheme
    constexpr scoring_scheme(scoring_scheme const &)=default
    Defaulted.
    \n
    seqan3::align_cfg::scoring_scheme::scoring_scheme
    constexpr scoring_scheme(scoring_scheme &&)=default
    Defaulted.
    \n
    seqan3::align_cfg::scoring_scheme::~scoring_scheme
    ~scoring_scheme()=default
    Defaulted.
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::align_cfg
    A special sub namespace for the alignment configurations.
    Definition align_config_band.hpp:22
    \n
    std
    SeqAn specific customisations in the standard namespace.
    \n
    pipeable_config_element.hpp
    Provides seqan3::pipeable_config_element.
    \n
    scoring_scheme_concept.hpp
    Provides seqan3::scoring_scheme_for.
    \n
    seqan3::pipeable_config_element
    Adds pipe interface to configuration elements.
    Definition pipeable_config_element.hpp:29
    \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/align__pairwise_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/align__pairwise_8hpp_source.html", "unified_diff": "@@ -154,21 +154,21 @@\n
    31{
    \n
    32
    \n
    127template <typename sequence_t, typename alignment_config_t>
    \n
    128 requires detail::align_pairwise_single_input<sequence_t>
    \n
    129 && std::copy_constructible<std::remove_reference_t<sequence_t>>
    \n
    130 && detail::is_type_specialisation_of_v<alignment_config_t, configuration>
    \n
    \n-
    131constexpr auto align_pairwise(sequence_t && seq, alignment_config_t const & config)
    \n+
    131constexpr auto align_pairwise(sequence_t && seq, alignment_config_t const & config)
    \n
    132{
    \n
    133 using std::get;
    \n
    134
    \n
    135 if constexpr (std::is_lvalue_reference_v<sequence_t>) // Forward tuple elements as references.
    \n
    136 {
    \n-
    137 return align_pairwise(std::tie(get<0>(seq), get<1>(seq)), config);
    \n+
    137 return align_pairwise(std::tie(get<0>(seq), get<1>(seq)), config);
    \n
    138 }
    \n
    139 else
    \n
    140 {
    \n
    141 static_assert(std::tuple_size_v<std::remove_reference_t<sequence_t>> == 2,
    \n
    142 "Alignment configuration error: Expects exactly two sequences for pairwise alignments.");
    \n
    143
    \n
    144 static_assert(std::ranges::viewable_range<std::tuple_element_t<0, std::remove_reference_t<sequence_t>>>
    \n@@ -245,14 +245,15 @@\n
    algorithm_result_generator_range.hpp
    Provides seqan3::detail::algorithm_result_generator_range.
    \n
    concept.hpp
    Provides concepts needed internally for the alignment algorithms.
    \n
    type_traits.hpp
    Provides helper type traits for the configuration and execution of the alignment algorithm.
    \n
    alignment_configurator.hpp
    Provides seqan3::detail::alignment_selector.
    \n
    alignment_result.hpp
    Provides seqan3::alignment_result.
    \n
    all_view.hpp
    Provides seqan3::detail::all.
    \n
    basic.hpp
    Provides various type traits on generic types.
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n \n \n
    seqan3::align_cfg::parallel
    seqan3::detail::parallel_mode< std::integral_constant< seqan3::detail::align_config_id, seqan3::detail::align_config_id::parallel > > parallel
    Enables the parallel execution of the alignment algorithm if possible for the given configuration.
    Definition align_config_parallel.hpp:35
    \n
    seqan3::align_pairwise
    constexpr auto align_pairwise(sequence_t &&seq, alignment_config_t const &config)
    Computes the pairwise alignment for a pair of sequences or a range over sequence pairs.
    Definition align_pairwise.hpp:131
    \n
    seqan3::field::seq
    @ seq
    The "sequence", usually a range of nucleotides or amino acids.
    \n
    seqan3::views::zip
    seqan::stl::views::zip zip
    A view adaptor that takes several views and returns tuple-like values from every i-th element of each...
    Definition zip.hpp:24
    \n
    seqan3::views::chunk
    seqan::stl::views::chunk chunk
    A view adaptor that divides a range into chunks. <dl class="no-api">This entity is not part of the Se...
    Definition chunk.hpp:23
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/aligned__allocator_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/aligned__allocator_8hpp_source.html", "unified_diff": "@@ -147,123 +147,123 @@\n
    24{
    \n
    25
    \n
    72template <typename value_t, size_t alignment_v = __STDCPP_DEFAULT_NEW_ALIGNMENT__>
    \n
    \n
    73class aligned_allocator
    \n
    74{
    \n
    75public:
    \n-
    77 static constexpr size_t alignment = alignment_v;
    \n+
    77 static constexpr size_t alignment = alignment_v;
    \n
    78
    \n-
    80 using value_type = value_t;
    \n-
    82 using pointer = value_type *;
    \n+
    80 using value_type = value_t;
    \n+
    82 using pointer = value_type *;
    \n
    84 using difference_type = typename std::pointer_traits<pointer>::difference_type;
    \n
    86 using size_type = std::make_unsigned_t<difference_type>;
    \n
    87
    \n
    89 using is_always_equal = std::true_type;
    \n
    90
    \n
    94 aligned_allocator() = default;
    \n
    95 aligned_allocator(aligned_allocator const &) = default;
    \n
    96 aligned_allocator(aligned_allocator &&) = default;
    \n
    97 aligned_allocator & operator=(aligned_allocator const &) = default;
    \n
    98 aligned_allocator & operator=(aligned_allocator &&) = default;
    \n
    99 ~aligned_allocator() = default;
    \n
    100
    \n
    102 template <class other_value_type, size_t other_alignment>
    \n \n
    106
    \n
    \n-
    138 [[nodiscard]] pointer allocate(size_type const n) const
    \n+
    138 [[nodiscard]] pointer allocate(size_type const n) const
    \n
    139 {
    \n
    140 constexpr size_type max_size = std::numeric_limits<size_type>::max() / sizeof(value_type);
    \n
    141 if (n > max_size)
    \n
    142 throw std::bad_alloc{};
    \n
    143
    \n-
    144 size_t bytes_to_allocate = n * sizeof(value_type);
    \n-
    145 if constexpr (alignment <= __STDCPP_DEFAULT_NEW_ALIGNMENT__)
    \n-
    146 return static_cast<pointer>(::operator new(bytes_to_allocate));
    \n+
    144 size_t bytes_to_allocate = n * sizeof(value_type);
    \n+
    145 if constexpr (alignment <= __STDCPP_DEFAULT_NEW_ALIGNMENT__)
    \n+
    146 return static_cast<pointer>(::operator new(bytes_to_allocate));
    \n
    147 else // Use alignment aware allocator function.
    \n-
    148 return static_cast<pointer>(::operator new(bytes_to_allocate, static_cast<std::align_val_t>(alignment)));
    \n+
    148 return static_cast<pointer>(::operator new(bytes_to_allocate, static_cast<std::align_val_t>(alignment)));
    \n
    149 }
    \n
    \n
    150
    \n
    \n-
    177 void deallocate(pointer const p, size_type const n) const noexcept
    \n+
    177 void deallocate(pointer const p, size_type const n) const noexcept
    \n
    178 {
    \n-
    179 size_t bytes_to_deallocate = n * sizeof(value_type);
    \n+
    179 size_t bytes_to_deallocate = n * sizeof(value_type);
    \n
    180
    \n
    181 // Clang doesn't have __cpp_sized_deallocation defined by default even though this is a C++14! feature
    \n
    182 // > In Clang 3.7 and later, sized deallocation is only enabled if the user passes the `-fsized-deallocation`
    \n
    183 // > flag.
    \n
    184 // see also https://clang.llvm.org/cxx_status.html#n3778
    \n
    185#if __cpp_sized_deallocation >= 201309
    \n
    186 // gcc
    \n-
    187 if constexpr (alignment <= __STDCPP_DEFAULT_NEW_ALIGNMENT__)
    \n-
    188 ::operator delete(p, bytes_to_deallocate);
    \n+
    187 if constexpr (alignment <= __STDCPP_DEFAULT_NEW_ALIGNMENT__)
    \n+
    188 ::operator delete(p, bytes_to_deallocate);
    \n
    189 else // Use alignment aware deallocator function.
    \n-
    190 ::operator delete(p, bytes_to_deallocate, static_cast<std::align_val_t>(alignment));
    \n+
    190 ::operator delete(p, bytes_to_deallocate, static_cast<std::align_val_t>(alignment));
    \n
    191#else /*__cpp_sized_deallocation >= 201309*/
    \n
    192 // e.g. clang++
    \n-
    193 (void)bytes_to_deallocate;
    \n-
    194 if constexpr (alignment <= __STDCPP_DEFAULT_NEW_ALIGNMENT__)
    \n+
    193 (void)bytes_to_deallocate;
    \n+
    194 if constexpr (alignment <= __STDCPP_DEFAULT_NEW_ALIGNMENT__)
    \n
    195 ::operator delete(p);
    \n
    196 else // Use alignment aware deallocator function.
    \n
    197 ::operator delete(p, static_cast<std::align_val_t>(alignment));
    \n
    198#endif // __cpp_sized_deallocation >= 201309
    \n
    199 }
    \n
    \n
    200
    \n
    211 template <typename new_value_type>
    \n
    \n
    212 struct rebind
    \n
    213 {
    \n-
    215 static constexpr size_t other_alignment = std::max(alignof(new_value_type), alignment);
    \n-
    217 using other = aligned_allocator<new_value_type, other_alignment>;
    \n+
    215 static constexpr size_t other_alignment = std::max(alignof(new_value_type), alignment);
    \n+
    217 using other = aligned_allocator<new_value_type, other_alignment>;
    \n
    218 };
    \n
    \n
    219
    \n
    224 template <class value_type2, size_t alignment2>
    \n
    \n-
    225 constexpr bool operator==(aligned_allocator<value_type2, alignment2> const &) noexcept
    \n+
    225 constexpr bool operator==(aligned_allocator<value_type2, alignment2> const &) noexcept
    \n
    226 {
    \n-
    227 return alignment == alignment2;
    \n+
    227 return alignment == alignment2;
    \n
    228 }
    \n
    \n
    229
    \n
    231 template <class value_type2, size_t alignment2>
    \n
    \n-
    232 constexpr bool operator!=(aligned_allocator<value_type2, alignment2> const &) noexcept
    \n+
    232 constexpr bool operator!=(aligned_allocator<value_type2, alignment2> const &) noexcept
    \n
    233 {
    \n-
    234 return alignment != alignment2;
    \n+
    234 return alignment != alignment2;
    \n
    235 }
    \n
    \n
    237};
    \n
    \n
    238
    \n
    239} // namespace seqan3
    \n \n \n
    seqan3::aligned_allocator
    Allocates uninitialized storage whose memory-alignment is specified by alignment.
    Definition aligned_allocator.hpp:74
    \n
    seqan3::aligned_allocator::value_type
    value_t value_type
    The value type of the allocation.
    Definition aligned_allocator.hpp:80
    \n
    seqan3::aligned_allocator::deallocate
    void deallocate(pointer const p, size_type const n) const noexcept
    Deallocates the storage referenced by the pointer p, which must be a pointer obtained by an earlier c...
    Definition aligned_allocator.hpp:177
    \n
    seqan3::aligned_allocator::operator==
    constexpr bool operator==(aligned_allocator< value_type2, alignment2 > const &) noexcept
    Returns true if the memory-alignment matches.
    Definition aligned_allocator.hpp:225
    \n
    seqan3::aligned_allocator::operator=
    aligned_allocator & operator=(aligned_allocator &&)=default
    Defaulted.
    \n
    seqan3::aligned_allocator::allocate
    pointer allocate(size_type const n) const
    Allocates sufficiently large memory to hold n many elements of value_type.
    Definition aligned_allocator.hpp:138
    \n-
    seqan3::aligned_allocator::pointer
    value_type * pointer
    The pointer type of the allocation.
    Definition aligned_allocator.hpp:82
    \n
    seqan3::aligned_allocator::operator=
    aligned_allocator & operator=(aligned_allocator const &)=default
    Defaulted.
    \n
    seqan3::aligned_allocator::aligned_allocator
    constexpr aligned_allocator(aligned_allocator< other_value_type, other_alignment > const &) noexcept
    Copy constructor with different value type and alignment.
    Definition aligned_allocator.hpp:103
    \n
    seqan3::aligned_allocator::~aligned_allocator
    ~aligned_allocator()=default
    Defaulted.
    \n
    seqan3::aligned_allocator::operator!=
    constexpr bool operator!=(aligned_allocator< value_type2, alignment2 > const &) noexcept
    Returns false if the memory-alignment mismatches.
    Definition aligned_allocator.hpp:232
    \n
    seqan3::aligned_allocator::aligned_allocator
    aligned_allocator(aligned_allocator const &)=default
    Defaulted.
    \n
    seqan3::aligned_allocator::alignment
    static constexpr size_t alignment
    The memory-alignment of the allocation.
    Definition aligned_allocator.hpp:77
    \n
    seqan3::aligned_allocator::aligned_allocator
    aligned_allocator(aligned_allocator &&)=default
    Defaulted.
    \n
    seqan3::aligned_allocator::aligned_allocator
    aligned_allocator()=default
    Defaulted.
    \n
    seqan3::aligned_allocator::difference_type
    typename std::pointer_traits< pointer >::difference_type difference_type
    The difference type of the allocation.
    Definition aligned_allocator.hpp:84
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n \n \n \n
    std::numeric_limits::max
    T max(T... args)
    \n \n
    seqan3
    The main SeqAn3 namespace.
    Definition aligned_sequence_concept.hpp:26
    \n
    platform.hpp
    Provides platform and dependency checks.
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/aligned__sequence__builder_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/aligned__sequence__builder_8hpp_source.html", "unified_diff": "@@ -170,17 +170,17 @@\n
    66
    \n
    74template <std::ranges::viewable_range first_sequence_t, std::ranges::viewable_range second_sequence_t>
    \n
    75struct make_pairwise_alignment_type
    \n
    76{
    \n
    78 using first_aligned_t = typename make_aligned_sequence_type<first_sequence_t>::type;
    \n
    80 using second_aligned_t = typename make_aligned_sequence_type<second_sequence_t>::type;
    \n
    81
    \n-
    82 static_assert(seqan3::writable_aligned_sequence<first_aligned_t>,
    \n+
    82 static_assert(seqan3::writable_aligned_sequence<first_aligned_t>,
    \n
    83 "first_aligned_t is required to model seqan3::writable_aligned_sequence!");
    \n-
    84 static_assert(seqan3::writable_aligned_sequence<second_aligned_t>,
    \n+
    84 static_assert(seqan3::writable_aligned_sequence<second_aligned_t>,
    \n
    85 "second_aligned_t is required to model seqan3::writable_aligned_sequence!");
    \n
    86
    \n
    88 using type = std::tuple<first_aligned_t, second_aligned_t>;
    \n
    89};
    \n
    90
    \n
    112template <std::ranges::viewable_range fst_sequence_t, std::ranges::viewable_range sec_sequence_t>
    \n
    113class aligned_sequence_builder
    \n@@ -285,20 +285,20 @@\n
    246};
    \n
    247
    \n
    253template <std::ranges::viewable_range fst_sequence_t, std::ranges::viewable_range sec_sequence_t>
    \n
    254aligned_sequence_builder(fst_sequence_t &&,
    \n
    255 sec_sequence_t &&) -> aligned_sequence_builder<fst_sequence_t, sec_sequence_t>;
    \n
    257} // namespace seqan3::detail
    \n
    aligned_sequence_concept.hpp
    Includes the aligned_sequence and the related insert_gap and erase_gap functions to enable stl contai...
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    std::vector::emplace_back
    T emplace_back(T... args)
    \n
    gap_decorator.hpp
    Provides seqan3::gap_decorator.
    \n
    gapped.hpp
    Provides seqan3::gapped.
    \n
    seqan3::field::alignment
    @ alignment
    The (pairwise) alignment stored in an object that models seqan3::detail::pairwise_alignment.
    \n
    seqan3::views::slice
    constexpr auto slice
    A view adaptor that returns a half-open interval on the underlying range.
    Definition slice.hpp:175
    \n-
    writable_aligned_sequence
    The generic concept for an aligned sequence that is writable.
    \n
    is_class_template_declarable.hpp
    Provides a type trait for verifying valid template declarations.
    \n
    lazy_conditional.hpp
    Provides lazy template instantiation traits.
    \n
    matrix_coordinate.hpp
    Provides seqan3::detail::matrix_index, seqan3::detail::matrix_coordinate and associated strong types.
    \n
    std
    SeqAn specific customisations in the standard namespace.
    \n \n
    slice.hpp
    Provides seqan3::views::slice.
    \n
    std::tie
    T tie(T... args)
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/aligned__sequence__concept_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/aligned__sequence__concept_8hpp_source.html", "unified_diff": "@@ -144,28 +144,28 @@\n
    22// unaligned_seq transformation trait
    \n
    23// ---------------------------------------------------------------------------------------------------------------------
    \n
    24
    \n
    \n
    25namespace seqan3::detail
    \n
    26{
    \n
    27
    \n-
    29template <template <typename...> typename container_type, typename seq_alph_t, typename... rest_t>
    \n-
    30 requires container<container_type<gapped<seq_alph_t>, rest_t...>>
    \n+
    29template <template <typename...> typename container_type, typename seq_alph_t, typename... rest_t>
    \n+
    30 requires container<container_type<gapped<seq_alph_t>, rest_t...>>
    \n
    31constexpr auto
    \n-
    32 remove_gap_from_value_type(container_type<gapped<seq_alph_t>, rest_t...>) -> container_type<seq_alph_t, rest_t...>;
    \n+
    32 remove_gap_from_value_type(container_type<gapped<seq_alph_t>, rest_t...>) -> container_type<seq_alph_t, rest_t...>;
    \n
    33
    \n-
    35template <template <typename...> typename container_type,
    \n+
    35template <template <typename...> typename container_type,
    \n
    36 template <typename...>
    \n
    37 typename allocator_type,
    \n-
    38 typename seq_alph_t,
    \n-
    39 typename... rest_t>
    \n-
    40 requires container<container_type<gapped<seq_alph_t>, allocator_type<gapped<seq_alph_t>>, rest_t...>>
    \n+
    38 typename seq_alph_t,
    \n+
    39 typename... rest_t>
    \n+
    40 requires container<container_type<gapped<seq_alph_t>, allocator_type<gapped<seq_alph_t>>, rest_t...>>
    \n
    41constexpr auto
    \n-
    42 remove_gap_from_value_type(container_type<gapped<seq_alph_t>, allocator_type<gapped<seq_alph_t>>, rest_t...>)
    \n-
    43 -> container_type<seq_alph_t, allocator_type<seq_alph_t>, rest_t...>;
    \n+
    42 remove_gap_from_value_type(container_type<gapped<seq_alph_t>, allocator_type<gapped<seq_alph_t>>, rest_t...>)
    \n+
    43 -> container_type<seq_alph_t, allocator_type<seq_alph_t>, rest_t...>;
    \n
    44
    \n
    46template <typename t>
    \n
    47struct unaligned_seq
    \n
    48{};
    \n
    49
    \n
    51template <typename t>
    \n
    52 requires (!requires { typename std::remove_reference_t<t>::unaligned_sequence_type; })
    \n@@ -325,26 +325,25 @@\n
    477inline constexpr bool all_model_aligned_seq = (aligned_sequence<elems> && ...);
    \n
    478
    \n
    482template <typename... elems>
    \n
    483inline constexpr bool all_model_aligned_seq<type_list<elems...>> = all_model_aligned_seq<elems...>;
    \n
    484} // namespace seqan3::detail
    \n \n
    exception.hpp
    Includes customized exception types for the alignment module .
    \n-
    seqan3::alphabet_variant
    A combined alphabet that can hold values of either of its alternatives..
    Definition alphabet_variant.hpp:127
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    gapped.hpp
    Provides seqan3::gapped.
    \n
    writable_aligned_sequence::insert_gap
    aligned_seq_t::iterator insert_gap(aligned_seq_t &aligned_seq, typename aligned_seq_t::const_iterator pos_it, typename aligned_seq_t::size_type size)
    An implementation of seqan3::writable_aligned_sequence::insert_gap for sequence containers.
    Definition aligned_sequence_concept.hpp:276
    \n
    writable_aligned_sequence::assign_unaligned
    void assign_unaligned(aligned_seq_t &aligned_seq, unaligned_sequence_type &&unaligned_seq)
    An implementation of seqan3::writable_aligned_sequence::assign_unaligned_sequence for sequence contai...
    Definition aligned_sequence_concept.hpp:372
    \n
    writable_aligned_sequence::erase_gap
    std::ranges::iterator_t< range_type > erase_gap(range_type &rng, std::ranges::iterator_t< range_type > const first, std::ranges::iterator_t< range_type > const last)
    An implementation of seqan3::writable_aligned_sequence::erase_gap for ranges with the corresponding m...
    Definition aligned_sequence_concept.hpp:461
    \n
    writable_aligned_sequence::erase_gap
    aligned_seq_t::iterator erase_gap(aligned_seq_t &aligned_seq, typename aligned_seq_t::const_iterator pos_it)
    An implementation of seqan3::writable_aligned_sequence::erase_gap for sequence containers.
    Definition aligned_sequence_concept.hpp:304
    \n
    writable_aligned_sequence::erase_gap
    std::ranges::iterator_t< range_type > erase_gap(range_type &rng, std::ranges::iterator_t< range_type > const pos_it)
    An implementation of seqan3::writable_aligned_sequence::erase_gap for ranges with the corresponding m...
    Definition aligned_sequence_concept.hpp:434
    \n
    writable_aligned_sequence::erase_gap
    aligned_seq_t::iterator erase_gap(aligned_seq_t &aligned_seq, typename aligned_seq_t::const_iterator first, typename aligned_seq_t::const_iterator last)
    An implementation of seqan3::writable_aligned_sequence::erase_gap for sequence containers.
    Definition aligned_sequence_concept.hpp:335
    \n
    writable_aligned_sequence::insert_gap
    std::ranges::iterator_t< range_type > insert_gap(range_type &rng, std::ranges::iterator_t< range_type > const pos_it, typename range_type::size_type const size=1)
    An implementation of seqan3::writable_aligned_sequence::insert_gap for ranges with the corresponding ...
    Definition aligned_sequence_concept.hpp:409
    \n
    writable_aligned_sequence::insert_gap
    aligned_seq_t::iterator insert_gap(aligned_seq_t &aligned_seq, typename aligned_seq_t::const_iterator pos_it)
    An implementation of seqan3::writable_aligned_sequence::insert_gap for sequence containers.
    Definition aligned_sequence_concept.hpp:252
    \n
    aligned_sequence
    The generic concept for an aligned sequence.
    \n-
    container
    The (most general) container concept as defined by the standard library.
    \n
    sequence
    The generic concept for a (biological) sequence.
    \n
    weakly_assignable_from
    Resolves to std::is_assignable_v<t>.
    \n
    writable_aligned_sequence
    The generic concept for an aligned sequence that is writable.
    \n
    seqan3
    The main SeqAn3 namespace.
    Definition aligned_sequence_concept.hpp:26
    \n
    SEQAN3_WORKAROUND_GCC_BOGUS_MEMCPY_START
    #define SEQAN3_WORKAROUND_GCC_BOGUS_MEMCPY_START(...)
    Denotes the start of a block where diagnostics are ignored.
    Definition platform.hpp:252
    \n
    SEQAN3_WORKAROUND_GCC_BOGUS_MEMCPY_STOP
    #define SEQAN3_WORKAROUND_GCC_BOGUS_MEMCPY_STOP
    Denotes the end of a block where diagnostics are ignored.
    Definition platform.hpp:261
    \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/alignment__algorithm_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/alignment__algorithm_8hpp_source.html", "unified_diff": "@@ -196,15 +196,15 @@\n
    125 constexpr alignment_algorithm & operator=(alignment_algorithm &&) = default;
    \n
    126 ~alignment_algorithm() = default;
    \n
    127
    \n
    136 explicit constexpr alignment_algorithm(config_t const & cfg) :
    \n
    137 invoke_deferred_crtp_base<algorithm_policies_t, alignment_algorithm<config_t, algorithm_policies_t...>>{cfg}...,
    \n
    138 cfg_ptr{std::make_shared<config_t>(cfg)}
    \n
    139 {
    \n-
    140 this->scoring_scheme = seqan3::get<align_cfg::scoring_scheme>(*cfg_ptr).scheme;
    \n+
    140 this->scoring_scheme = seqan3::get<align_cfg::scoring_scheme>(*cfg_ptr).scheme;
    \n
    141 this->initialise_alignment_state(*cfg_ptr);
    \n
    142 }
    \n
    144
    \n
    190 template <indexed_sequence_pair_range indexed_sequence_pairs_t, typename callback_t>
    \n
    191 requires (!traits_t::is_vectorised) && std::invocable<callback_t, alignment_result_t>
    \n
    192 void operator()(indexed_sequence_pairs_t && indexed_sequence_pairs, callback_t && callback)
    \n
    193 {
    \n@@ -638,14 +638,15 @@\n
    align_result_selector.hpp
    Provides seqan3::detail::align_result_selector.
    \n
    aligned_allocator.hpp
    Provides seqan3::aligned_allocator.
    \n
    aligned_sequence_builder.hpp
    Provides seqan3::detail::aligned_sequence_builder.
    \n
    exception.hpp
    Includes customized exception types for the alignment module .
    \n
    concept.hpp
    Provides concepts needed internally for the alignment algorithms.
    \n
    type_traits.hpp
    Provides helper type traits for the configuration and execution of the alignment algorithm.
    \n \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n \n
    deferred_crtp_base.hpp
    Provides seqan3::detail::deferred_crtp_base.
    \n
    elements.hpp
    Provides seqan3::views::elements.
    \n
    empty_type.hpp
    Provides seqan3::detail::empty_type.
    \n
    function_traits.hpp
    Provides various type traits for use on functions.
    \n
    seqan3::field::offset
    @ offset
    Sequence (seqan3::field::seq) relative start position (0-based), unsigned value.
    \n
    seqan3::list_traits::take
    typename decltype(detail::split_after< i >(list_t{}))::first_type take
    Return a seqan3::type_list of the first n types in the input type list.
    Definition type_list/traits.hpp:374
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/alignment__from__cigar_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/alignment__from__cigar_8hpp_source.html", "unified_diff": "@@ -141,183 +141,182 @@\n
    18#include <seqan3/utility/views/slice.hpp>
    \n
    19
    \n
    20namespace seqan3
    \n
    21{
    \n
    22
    \n
    80template <typename reference_type, typename sequence_type>
    \n
    \n-
    81inline auto alignment_from_cigar(std::vector<cigar> const & cigar_vector,
    \n-
    82 reference_type const & reference,
    \n-
    83 uint32_t const zero_based_reference_start_position,
    \n+
    81inline auto alignment_from_cigar(std::vector<cigar> const & cigar_vector,
    \n+
    82 reference_type const & reference,
    \n+
    83 uint32_t const zero_based_reference_start_position,
    \n
    84 sequence_type const & query)
    \n
    85{
    \n-
    86 if (cigar_vector.empty())
    \n+
    86 if (cigar_vector.empty())
    \n
    87 throw std::logic_error{"An empty CIGAR is not a valid alignment representation."};
    \n
    88
    \n
    89 // compute the length of the aligned region in the reference sequence
    \n
    90 // -------------------------------------------------------------------------
    \n
    91 // this requires a first stream over the cigar vector.
    \n-
    92 uint32_t reference_length{0};
    \n+
    92 uint32_t reference_length{0};
    \n
    93 uint32_t query_length{0};
    \n
    94
    \n-
    95 for (auto [cigar_count, cigar_operation] : cigar_vector)
    \n+
    95 for (auto [cigar_count, cigar_operation] : cigar_vector)
    \n
    96 {
    \n-
    97 if (('M'_cigar_operation == cigar_operation) || ('='_cigar_operation == cigar_operation)
    \n-
    98 || ('X'_cigar_operation == cigar_operation))
    \n+
    97 if (('M'_cigar_operation == cigar_operation) || ('='_cigar_operation == cigar_operation)
    \n+
    98 || ('X'_cigar_operation == cigar_operation))
    \n
    99 {
    \n-
    100 reference_length += cigar_count;
    \n-
    101 query_length += cigar_count;
    \n+
    100 reference_length += cigar_count;
    \n+
    101 query_length += cigar_count;
    \n
    102 }
    \n-
    103 else if ('D'_cigar_operation == cigar_operation)
    \n+
    103 else if ('D'_cigar_operation == cigar_operation)
    \n
    104 {
    \n-
    105 reference_length += cigar_count;
    \n+
    105 reference_length += cigar_count;
    \n
    106 }
    \n-
    107 else if ('I'_cigar_operation == cigar_operation)
    \n+
    107 else if ('I'_cigar_operation == cigar_operation)
    \n
    108 {
    \n-
    109 query_length += cigar_count;
    \n+
    109 query_length += cigar_count;
    \n
    110 }
    \n
    111 }
    \n
    112
    \n-
    113 if (static_cast<size_t>(zero_based_reference_start_position + reference_length) > std::ranges::size(reference))
    \n+
    113 if (static_cast<size_t>(zero_based_reference_start_position + reference_length) > std::ranges::size(reference))
    \n
    114 throw std::logic_error{"The CIGAR string indicates a reference length of at least "
    \n-
    115 + std::to_string(zero_based_reference_start_position + reference_length)
    \n+
    115 + std::to_string(zero_based_reference_start_position + reference_length)
    \n
    116 + ", but the supplied reference sequence is only of size"
    \n
    117 + std::to_string(std::ranges::size(reference)) + "."};
    \n
    118
    \n
    119 // Get soft clipping at the start and end of the CIGAR string
    \n
    120 // -------------------------------------------------------------------------
    \n-
    121 uint32_t soft_clipping_start{0};
    \n-
    122 uint32_t soft_clipping_end{0};
    \n+
    121 uint32_t soft_clipping_start{0};
    \n+
    122 uint32_t soft_clipping_end{0};
    \n
    123
    \n
    124 // Checks whether the given index in the cigar vector is a soft clip.
    \n-
    125 auto soft_clipping_at = [&cigar_vector](size_t const index)
    \n+
    125 auto soft_clipping_at = [&cigar_vector](size_t const index)
    \n
    126 {
    \n-
    127 return cigar_vector[index] == 'S'_cigar_operation;
    \n+
    127 return cigar_vector[index] == 'S'_cigar_operation;
    \n
    128 };
    \n
    129 // Checks whether the given index in the cigar vector is a hard clip.
    \n-
    130 auto hard_clipping_at = [&](size_t const index)
    \n+
    130 auto hard_clipping_at = [&](size_t const index)
    \n
    131 {
    \n-
    132 return cigar_vector[index] == 'H'_cigar_operation;
    \n+
    132 return cigar_vector[index] == 'H'_cigar_operation;
    \n
    133 };
    \n
    134 // Checks whether the given cigar vector has at least min_size many elements.
    \n-
    135 auto vector_size_at_least = [&](size_t const min_size)
    \n+
    135 auto vector_size_at_least = [&](size_t const min_size)
    \n
    136 {
    \n-
    137 return cigar_vector.size() >= min_size;
    \n+
    137 return cigar_vector.size() >= min_size;
    \n
    138 };
    \n
    139 // Returns the cigar count of the ith cigar element in the given cigar vector.
    \n-
    140 auto cigar_count_at = [&](size_t const index)
    \n+
    140 auto cigar_count_at = [&](size_t const index)
    \n
    141 {
    \n-
    142 return get<0>(cigar_vector[index]);
    \n+
    142 return get<0>(cigar_vector[index]);
    \n
    143 };
    \n
    144
    \n
    145 // check for soft clipping at the first two positions
    \n
    146 // cigar is non-empty, checked at the very beginning.
    \n-
    147 if (soft_clipping_at(0))
    \n-
    148 soft_clipping_start = cigar_count_at(0);
    \n-
    149 else if (vector_size_at_least(2) && hard_clipping_at(0) && soft_clipping_at(1))
    \n-
    150 soft_clipping_start = cigar_count_at(1);
    \n+
    147 if (soft_clipping_at(0))
    \n+
    148 soft_clipping_start = cigar_count_at(0);
    \n+
    149 else if (vector_size_at_least(2) && hard_clipping_at(0) && soft_clipping_at(1))
    \n+
    150 soft_clipping_start = cigar_count_at(1);
    \n
    151
    \n
    152 // Check for soft clipping at the last two positions to validate the CIGAR string.
    \n
    153 // Even if the two following arithmetics overflow, they are protected by the corresponding if expressions below.
    \n-
    154 auto const last_index = cigar_vector.size() - 1;
    \n-
    155 auto const second_last_index = last_index - 1;
    \n+
    154 auto const last_index = cigar_vector.size() - 1;
    \n+
    155 auto const second_last_index = last_index - 1;
    \n
    156
    \n-
    157 if (vector_size_at_least(2) && soft_clipping_at(last_index))
    \n-
    158 soft_clipping_end = cigar_count_at(last_index);
    \n-
    159 else if (vector_size_at_least(3) && hard_clipping_at(last_index) && soft_clipping_at(second_last_index))
    \n-
    160 soft_clipping_end = cigar_count_at(second_last_index);
    \n+
    157 if (vector_size_at_least(2) && soft_clipping_at(last_index))
    \n+
    158 soft_clipping_end = cigar_count_at(last_index);
    \n+
    159 else if (vector_size_at_least(3) && hard_clipping_at(last_index) && soft_clipping_at(second_last_index))
    \n+
    160 soft_clipping_end = cigar_count_at(second_last_index);
    \n
    161
    \n-
    162 if (soft_clipping_start + query_length + soft_clipping_end != std::ranges::size(query))
    \n+
    162 if (soft_clipping_start + query_length + soft_clipping_end != std::ranges::size(query))
    \n
    163 throw std::logic_error{"The CIGAR string indicates a query/read sequence length of "
    \n-
    164 + std::to_string(soft_clipping_start + query_length + soft_clipping_end)
    \n+
    164 + std::to_string(soft_clipping_start + query_length + soft_clipping_end)
    \n
    165 + ", but the supplied query/read sequence is of size"
    \n
    166 + std::to_string(std::ranges::size(query)) + "."};
    \n
    167
    \n
    168 // Assign the sequence to the alignment (a tuple of 2 gap decorators)
    \n
    169 // -------------------------------------------------------------------------
    \n-
    170 using gapped_reference_type = gap_decorator<decltype(reference | views::slice(0, 0))>;
    \n-
    171 using gapped_sequence_type = gap_decorator<decltype(query | views::slice(0, 0))>;
    \n+
    170 using gapped_reference_type = gap_decorator<decltype(reference | views::slice(0, 0))>;
    \n+
    171 using gapped_sequence_type = gap_decorator<decltype(query | views::slice(0, 0))>;
    \n
    172 using alignment_type = std::tuple<gapped_reference_type, gapped_sequence_type>;
    \n
    173
    \n
    174 alignment_type alignment{};
    \n
    175
    \n-
    176 assign_unaligned(get<0>(alignment),
    \n+
    176 assign_unaligned(get<0>(alignment),
    \n
    177 reference
    \n-
    178 | views::slice(zero_based_reference_start_position,
    \n-
    179 zero_based_reference_start_position + reference_length));
    \n+
    178 | views::slice(zero_based_reference_start_position,
    \n+
    179 zero_based_reference_start_position + reference_length));
    \n
    180 // query_length already accounts for soft clipping at begin and end
    \n-
    181 assign_unaligned(get<1>(alignment), query | views::slice(soft_clipping_start, soft_clipping_start + query_length));
    \n+
    181 assign_unaligned(get<1>(alignment), query | views::slice(soft_clipping_start, soft_clipping_start + query_length));
    \n
    182
    \n
    183 // Insert gaps into the alignment based on the cigar vector
    \n
    184 // -------------------------------------------------------------------------
    \n
    185 using std::get;
    \n-
    186 auto current_ref_pos = std::ranges::begin(get<0>(alignment));
    \n-
    187 auto current_read_pos = std::ranges::begin(get<1>(alignment));
    \n+
    186 auto current_ref_pos = std::ranges::begin(get<0>(alignment));
    \n+
    187 auto current_read_pos = std::ranges::begin(get<1>(alignment));
    \n
    188
    \n-
    189 for (auto [cigar_count, cigar_operation] : cigar_vector)
    \n+
    189 for (auto [cigar_count, cigar_operation] : cigar_vector)
    \n
    190 {
    \n-
    191 if (('M'_cigar_operation == cigar_operation) || ('='_cigar_operation == cigar_operation)
    \n-
    192 || ('X'_cigar_operation == cigar_operation))
    \n+
    191 if (('M'_cigar_operation == cigar_operation) || ('='_cigar_operation == cigar_operation)
    \n+
    192 || ('X'_cigar_operation == cigar_operation))
    \n
    193 {
    \n-
    194 std::ranges::advance(current_ref_pos, cigar_count);
    \n-
    195 std::ranges::advance(current_read_pos, cigar_count);
    \n+
    194 std::ranges::advance(current_ref_pos, cigar_count);
    \n+
    195 std::ranges::advance(current_read_pos, cigar_count);
    \n
    196 }
    \n-
    197 else if (('D'_cigar_operation == cigar_operation) || ('N'_cigar_operation == cigar_operation))
    \n+
    197 else if (('D'_cigar_operation == cigar_operation) || ('N'_cigar_operation == cigar_operation))
    \n
    198 {
    \n
    199 // insert gaps into query
    \n-
    200 current_read_pos = get<1>(alignment).insert_gap(current_read_pos, cigar_count);
    \n-
    201 ++current_read_pos;
    \n-
    202 std::ranges::advance(current_ref_pos, cigar_count);
    \n+
    200 current_read_pos = get<1>(alignment).insert_gap(current_read_pos, cigar_count);
    \n+
    201 ++current_read_pos;
    \n+
    202 std::ranges::advance(current_ref_pos, cigar_count);
    \n
    203 }
    \n-
    204 else if (('I'_cigar_operation == cigar_operation)) // Insert gaps into ref
    \n+
    204 else if (('I'_cigar_operation == cigar_operation)) // Insert gaps into ref
    \n
    205 {
    \n-
    206 current_ref_pos = get<0>(alignment).insert_gap(current_ref_pos, cigar_count);
    \n-
    207 ++current_ref_pos;
    \n-
    208 std::ranges::advance(current_read_pos, cigar_count);
    \n+
    206 current_ref_pos = get<0>(alignment).insert_gap(current_ref_pos, cigar_count);
    \n+
    207 ++current_ref_pos;
    \n+
    208 std::ranges::advance(current_read_pos, cigar_count);
    \n
    209 }
    \n-
    210 else if (('P'_cigar_operation == cigar_operation)) // skip padding
    \n+
    210 else if (('P'_cigar_operation == cigar_operation)) // skip padding
    \n
    211 {
    \n-
    212 current_ref_pos = get<0>(alignment).insert_gap(current_ref_pos, cigar_count);
    \n-
    213 ++current_ref_pos;
    \n+
    212 current_ref_pos = get<0>(alignment).insert_gap(current_ref_pos, cigar_count);
    \n+
    213 ++current_ref_pos;
    \n
    214
    \n-
    215 current_read_pos = get<1>(alignment).insert_gap(current_read_pos, cigar_count);
    \n-
    216 ++current_read_pos;
    \n+
    215 current_read_pos = get<1>(alignment).insert_gap(current_read_pos, cigar_count);
    \n+
    216 ++current_read_pos;
    \n
    217 }
    \n
    218 // S and H are ignored as they are handled by cropping the sequence
    \n
    219 }
    \n
    220
    \n
    221 return alignment;
    \n
    222}
    \n
    \n
    223
    \n
    227template <typename reference_type, typename sequence_type>
    \n
    \n-
    228inline auto alignment_from_cigar(std::string const & cigar_string,
    \n-
    229 reference_type const & reference,
    \n-
    230 uint32_t const zero_based_reference_start_position,
    \n+
    228inline auto alignment_from_cigar(std::string const & cigar_string,
    \n+
    229 reference_type const & reference,
    \n+
    230 uint32_t const zero_based_reference_start_position,
    \n
    231 sequence_type const & query)
    \n
    232{
    \n-
    233 alignment_from_cigar(detail::parse_cigar(cigar_string), reference, zero_based_reference_start_position, query);
    \n+
    233 alignment_from_cigar(detail::parse_cigar(cigar_string), reference, zero_based_reference_start_position, query);
    \n
    234}
    \n
    \n
    235
    \n
    236} // namespace seqan3
    \n
    aligned_sequence_concept.hpp
    Includes the aligned_sequence and the related insert_gap and erase_gap functions to enable stl contai...
    \n
    cigar.hpp
    Provides the seqan3::cigar alphabet.
    \n \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::gap_decorator
    A gap decorator allows the annotation of sequences with gap symbols while leaving the underlying sequ...
    Definition gap_decorator.hpp:78
    \n-
    std::vector::empty
    T empty(T... args)
    \n
    gap_decorator.hpp
    Provides seqan3::gap_decorator.
    \n
    seqan3::alignment_from_cigar
    auto alignment_from_cigar(std::vector< cigar > const &cigar_vector, reference_type const &reference, uint32_t const zero_based_reference_start_position, sequence_type const &query)
    Construct an alignment from a CIGAR string and the corresponding sequences.
    Definition alignment_from_cigar.hpp:81
    \n
    seqan3::field::alignment
    @ alignment
    The (pairwise) alignment stored in an object that models seqan3::detail::pairwise_alignment.
    \n
    seqan3::views::slice
    constexpr auto slice
    A view adaptor that returns a half-open interval on the underlying range.
    Definition slice.hpp:175
    \n
    cigar.hpp
    Auxiliary functions for the SAM IO.
    \n \n
    seqan3
    The main SeqAn3 namespace.
    Definition aligned_sequence_concept.hpp:26
    \n-
    std::vector::size
    T size(T... args)
    \n
    slice.hpp
    Provides seqan3::views::slice.
    \n
    std::to_string
    T to_string(T... args)
    \n \n \n
    \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/alphabet__proxy_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/alphabet__proxy_8hpp_source.html", "unified_diff": "@@ -156,15 +156,15 @@\n
    61 detail::valid_template_spec_or_t<void, alphabet_char_t, alphabet_type>>>
    \n
    62{
    \n
    63private:
    \n
    65 using base_t =
    \n
    66 std::conditional_t<std::is_class_v<alphabet_type>,
    \n
    67 alphabet_type, // inherit from emulated type if possible
    \n
    68 alphabet_base<derived_type, // else: alphabet_base
    \n-
    69 alphabet_size<alphabet_type>,
    \n+
    69 alphabet_size<alphabet_type>,
    \n
    70 detail::valid_template_spec_or_t<void, alphabet_char_t, alphabet_type>>>;
    \n
    71
    \n
    73 friend base_t;
    \n
    74
    \n
    76 using char_type = detail::valid_template_spec_or_t<char, alphabet_char_t, alphabet_type>;
    \n
    77
    \n
    79 using phred_type = detail::valid_template_spec_or_t<int8_t, alphabet_phred_t, alphabet_type>;
    \n@@ -185,70 +185,70 @@\n
    99 constexpr alphabet_proxy(alphabet_type const a) noexcept
    \n
    100 requires (!std::is_class_v<alphabet_type>)
    \n
    101 : base_t{}
    \n
    102 {
    \n
    103 base_t::assign_rank(seqan3::to_rank(a));
    \n
    104 }
    \n
    105
    \n-
    107 constexpr derived_type & operator=(alphabet_type const & c) noexcept
    \n+
    107 constexpr derived_type & operator=(alphabet_type const & c) noexcept
    \n
    108 {
    \n
    109 if constexpr (std::is_class_v<alphabet_type>)
    \n-
    110 seqan3::assign_rank_to(seqan3::to_rank(c), static_cast<alphabet_type &>(*this));
    \n+
    110 seqan3::assign_rank_to(seqan3::to_rank(c), static_cast<alphabet_type &>(*this));
    \n
    111 else
    \n-
    112 base_t::assign_rank(seqan3::to_rank(c));
    \n+
    112 base_t::assign_rank(seqan3::to_rank(c));
    \n
    113
    \n
    114 static_cast<derived_type &>(*this).on_update(); // <- this invokes the actual proxy behaviour!
    \n
    115 return static_cast<derived_type &>(*this);
    \n
    116 }
    \n
    117
    \n
    119 template <typename indirect_assignable_type>
    \n-
    120 constexpr derived_type & operator=(indirect_assignable_type const & c) noexcept
    \n-
    121 requires weakly_assignable_from<alphabet_type, indirect_assignable_type>
    \n+
    120 constexpr derived_type & operator=(indirect_assignable_type const & c) noexcept
    \n+
    121 requires weakly_assignable_from<alphabet_type, indirect_assignable_type>
    \n
    122 {
    \n
    123 alphabet_type a{};
    \n-
    124 a = c;
    \n+
    124 a = c;
    \n
    125 return operator=(a);
    \n
    126 }
    \n
    128
    \n
    130 friend derived_type;
    \n
    131
    \n
    132public:
    \n-
    134 static constexpr auto alphabet_size = seqan3::alphabet_size<alphabet_type>;
    \n+
    134 static constexpr auto alphabet_size = seqan3::alphabet_size<alphabet_type>;
    \n
    135
    \n
    \n-
    142 constexpr derived_type & assign_rank(alphabet_rank_t<alphabet_type> const r) noexcept
    \n+
    142 constexpr derived_type & assign_rank(alphabet_rank_t<alphabet_type> const r) noexcept
    \n
    143 {
    \n-
    144 alphabet_type tmp{};
    \n-
    145 assign_rank_to(r, tmp);
    \n-
    146 return operator=(tmp);
    \n+
    144 alphabet_type tmp{};
    \n+
    145 assign_rank_to(r, tmp);
    \n+
    146 return operator=(tmp);
    \n
    147 }
    \n
    \n
    148
    \n
    \n-
    150 constexpr derived_type & assign_char(char_type const c) noexcept
    \n-
    151 requires writable_alphabet<alphabet_type>
    \n+
    150 constexpr derived_type & assign_char(char_type const c) noexcept
    \n+
    151 requires writable_alphabet<alphabet_type>
    \n
    152 {
    \n-
    153 alphabet_type tmp{};
    \n-
    154 assign_char_to(c, tmp);
    \n-
    155 return operator=(tmp);
    \n+
    153 alphabet_type tmp{};
    \n+
    154 assign_char_to(c, tmp);
    \n+
    155 return operator=(tmp);
    \n
    156 }
    \n
    \n
    157
    \n
    \n-
    159 constexpr derived_type & assign_phred(phred_type const c) noexcept
    \n-
    160 requires writable_quality_alphabet<alphabet_type>
    \n+
    159 constexpr derived_type & assign_phred(phred_type const c) noexcept
    \n+
    160 requires writable_quality_alphabet<alphabet_type>
    \n
    161 {
    \n-
    162 alphabet_type tmp{};
    \n-
    163 assign_phred_to(c, tmp);
    \n-
    164 return operator=(tmp);
    \n+
    162 alphabet_type tmp{};
    \n+
    163 assign_phred_to(c, tmp);
    \n+
    164 return operator=(tmp);
    \n
    165 }
    \n
    \n
    167
    \n
    \n-
    173 constexpr operator alphabet_type() const noexcept
    \n+
    173 constexpr operator alphabet_type() const noexcept
    \n
    174 {
    \n
    175 if constexpr (std::is_class_v<alphabet_type>)
    \n
    176 return *this;
    \n
    177 else
    \n
    178 return assign_rank_to(base_t::to_rank(), alphabet_type{});
    \n
    179
    \n
    180 /* Instead of static_cast'ing to the alphabet_type which also considers the constructors of the alphabet_type,
    \n@@ -266,98 +266,98 @@\n
    192 */
    \n
    193 }
    \n
    \n
    194
    \n
    196 template <typename other_t>
    \n
    197 requires (!std::is_class_v<alphabet_type>) && std::convertible_to<alphabet_type, other_t>
    \n
    \n-
    198 constexpr operator other_t() const noexcept
    \n+
    198 constexpr operator other_t() const noexcept
    \n
    199 {
    \n
    200 return operator alphabet_type();
    \n
    201 }
    \n
    \n
    202
    \n
    \n-
    204 constexpr auto to_rank() const noexcept
    \n+
    204 constexpr auto to_rank() const noexcept
    \n
    205 {
    \n
    206 return seqan3::to_rank(operator alphabet_type());
    \n
    207 }
    \n
    \n
    208
    \n
    \n-
    210 constexpr auto to_char() const noexcept
    \n-
    211 requires alphabet<alphabet_type>
    \n+
    210 constexpr auto to_char() const noexcept
    \n+
    211 requires alphabet<alphabet_type>
    \n
    212 {
    \n
    213 return seqan3::to_char(operator alphabet_type());
    \n
    214 }
    \n
    \n
    215
    \n
    \n-
    217 constexpr auto to_phred() const noexcept
    \n-
    218 requires quality_alphabet<alphabet_type>
    \n+
    217 constexpr auto to_phred() const noexcept
    \n+
    218 requires quality_alphabet<alphabet_type>
    \n
    219 {
    \n
    220 return seqan3::to_phred(operator alphabet_type());
    \n
    221 }
    \n
    \n
    222
    \n
    \n-
    224 constexpr alphabet_type complement() const noexcept
    \n-
    225 requires nucleotide_alphabet<alphabet_type>
    \n+
    224 constexpr alphabet_type complement() const noexcept
    \n+
    225 requires nucleotide_alphabet<alphabet_type>
    \n
    226 {
    \n
    227 return seqan3::complement(operator alphabet_type());
    \n
    228 }
    \n
    \n
    229
    \n
    \n-
    231 static constexpr bool char_is_valid(char_type const c) noexcept
    \n-
    232 requires writable_alphabet<alphabet_type>
    \n+
    231 static constexpr bool char_is_valid(char_type const c) noexcept
    \n+
    232 requires writable_alphabet<alphabet_type>
    \n
    233 {
    \n-
    234 return char_is_valid_for<alphabet_type>(c);
    \n+
    234 return char_is_valid_for<alphabet_type>(c);
    \n
    235 }
    \n
    \n
    237
    \n
    244private:
    \n
    246 template <typename t>
    \n
    247 static constexpr bool is_alphabet_comparable_with =
    \n
    248 !std::is_same_v<derived_type, t> && detail::weakly_equality_comparable_with<alphabet_type, t>;
    \n
    249
    \n
    250public:
    \n
    252 template <typename t>
    \n
    \n-
    253 friend constexpr auto operator==(derived_type const lhs,
    \n-
    254 t const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n+
    253 friend constexpr auto operator==(derived_type const lhs,
    \n+
    254 t const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n
    255 {
    \n-
    256 return (lhs.operator alphabet_type() == rhs);
    \n+
    256 return (lhs.operator alphabet_type() == rhs);
    \n
    257 }
    \n
    \n
    258
    \n
    260 template <typename t>
    \n
    261 friend constexpr auto
    \n
    \n-
    262 operator==(t const lhs, derived_type const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n+
    262 operator==(t const lhs, derived_type const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n
    263 {
    \n-
    264 return (rhs == lhs);
    \n+
    264 return (rhs == lhs);
    \n
    265 }
    \n
    \n
    266
    \n
    268 template <typename t>
    \n
    \n-
    269 friend constexpr auto operator!=(derived_type const lhs,
    \n-
    270 t const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n+
    269 friend constexpr auto operator!=(derived_type const lhs,
    \n+
    270 t const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n
    271 {
    \n-
    272 return !(lhs == rhs);
    \n+
    272 return !(lhs == rhs);
    \n
    273 }
    \n
    \n
    274
    \n
    276 template <typename t>
    \n
    277 friend constexpr auto
    \n
    \n-
    278 operator!=(t const lhs, derived_type const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n+
    278 operator!=(t const lhs, derived_type const rhs) noexcept -> std::enable_if_t<is_alphabet_comparable_with<t>, bool>
    \n
    279 {
    \n-
    280 return (rhs != lhs);
    \n+
    280 return (rhs != lhs);
    \n
    281 }
    \n
    \n
    283};
    \n \n
    284
    \n
    285} // namespace seqan3
    \n
    concept.hpp
    Provides alphabet helper concepts.
    \n@@ -376,30 +376,27 @@\n
    seqan3::alphabet_proxy::operator==
    friend constexpr auto operator==(t const lhs, derived_type const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
    Allow (in-)equality comparison with types that the emulated type is comparable with.
    Definition alphabet_proxy.hpp:262
    \n
    seqan3::alphabet_proxy::operator==
    friend constexpr auto operator==(derived_type const lhs, t const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
    Allow (in-)equality comparison with types that the emulated type is comparable with.
    Definition alphabet_proxy.hpp:253
    \n
    seqan3::alphabet_proxy::complement
    constexpr alphabet_type complement() const noexcept
    Returns the complement.
    Definition alphabet_proxy.hpp:224
    \n
    seqan3::alphabet_proxy::to_char
    constexpr auto to_char() const noexcept
    Returns the character.
    Definition alphabet_proxy.hpp:210
    \n
    seqan3::alphabet_proxy::to_phred
    constexpr auto to_phred() const noexcept
    Returns the Phred score.
    Definition alphabet_proxy.hpp:217
    \n
    seqan3::alphabet_proxy::to_rank
    constexpr auto to_rank() const noexcept
    Returns the rank.
    Definition alphabet_proxy.hpp:204
    \n
    seqan3::alphabet_proxy::char_is_valid
    static constexpr bool char_is_valid(char_type const c) noexcept
    Delegate to the emulated type's validator.
    Definition alphabet_proxy.hpp:231
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    std::conditional_t
    \n
    std::enable_if_t
    \n
    seqan3::complement
    constexpr auto complement
    Return the complement of a nucleotide object.
    Definition alphabet/nucleotide/concept.hpp:102
    \n
    seqan3::to_phred
    constexpr auto to_phred
    The public getter function for the Phred representation of a quality score.
    Definition alphabet/quality/concept.hpp:97
    \n
    seqan3::assign_phred_to
    constexpr auto assign_phred_to
    Assign a Phred score to a quality alphabet object.
    Definition alphabet/quality/concept.hpp:225
    \n
    seqan3::assign_char_to
    constexpr auto assign_char_to
    Assign a character to an alphabet object.
    Definition alphabet/concept.hpp:517
    \n
    seqan3::to_char
    constexpr auto to_char
    Return the char representation of an alphabet object.
    Definition alphabet/concept.hpp:381
    \n-
    seqan3::alphabet_rank_t
    decltype(seqan3::to_rank(std::declval< semi_alphabet_type >())) alphabet_rank_t
    The rank_type of the semi-alphabet; defined as the return type of seqan3::to_rank....
    Definition alphabet/concept.hpp:164
    \n
    seqan3::assign_rank_to
    constexpr auto assign_rank_to
    Assign a rank to an alphabet object.
    Definition alphabet/concept.hpp:288
    \n
    seqan3::to_rank
    constexpr auto to_rank
    Return the rank representation of a (semi-)alphabet object.
    Definition alphabet/concept.hpp:152
    \n
    alphabet
    The generic alphabet concept that covers most data types used in ranges.
    \n
    nucleotide_alphabet
    A concept that indicates whether an alphabet represents nucleotides.
    \n
    quality_alphabet
    A concept that indicates whether an alphabet represents quality scores.
    \n-
    weakly_assignable_from
    Resolves to std::is_assignable_v<t>.
    \n-
    writable_alphabet
    Refines seqan3::alphabet and adds assignability.
    \n-
    writable_quality_alphabet
    A concept that indicates whether a writable alphabet represents quality scores.
    \n
    seqan3
    The main SeqAn3 namespace.
    Definition aligned_sequence_concept.hpp:26
    \n
    template_inspection.hpp
    Provides type traits for working with templates.
    \n
    concept.hpp
    Provides concepts that do not have equivalents in C++20.
    \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/char_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/char_8hpp_source.html", "unified_diff": "@@ -154,47 +154,48 @@\n
    51{
    \n
    \n
    56 static constexpr auto alphabet_size =
    \n
    57 detail::min_viable_uint_t<detail::size_in_values_v<char_type>>{detail::size_in_values_v<char_type>};
    \n
    \n
    58
    \n
    \n-
    65 static constexpr char_type to_char(char_type const chr) noexcept
    \n+
    65 static constexpr char_type to_char(char_type const chr) noexcept
    \n
    66 {
    \n-
    67 return chr;
    \n+
    67 return chr;
    \n
    68 }
    \n
    \n
    69
    \n
    \n-
    76 static constexpr auto to_rank(char_type const chr) noexcept
    \n+
    76 static constexpr auto to_rank(char_type const chr) noexcept
    \n
    77 {
    \n-
    78 return static_cast<detail::min_viable_uint_t<alphabet_size - 1>>(chr);
    \n+
    78 return static_cast<detail::min_viable_uint_t<alphabet_size - 1>>(chr);
    \n
    79 }
    \n
    \n
    80
    \n
    \n-
    88 static constexpr char_type & assign_char_to(char_type const chr2, char_type & chr) noexcept
    \n+
    88 static constexpr char_type & assign_char_to(char_type const chr2, char_type & chr) noexcept
    \n
    89 {
    \n-
    90 return chr = chr2;
    \n+
    90 return chr = chr2;
    \n
    91 }
    \n
    \n
    92
    \n
    \n
    100 static constexpr char_type & assign_rank_to(decltype(alphabet::to_rank(char_type{})) const rank,
    \n-
    101 char_type & chr) noexcept
    \n+
    101 char_type & chr) noexcept
    \n
    102 {
    \n-
    103 return chr = rank;
    \n+
    103 return chr = rank;
    \n
    104 }
    \n
    \n
    105};
    \n \n
    106
    \n
    107} // namespace seqan3::custom
    \n \n
    concept.hpp
    Core alphabet concept and free function/type trait wrappers.
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    std::conditional_t
    \n
    seqan3::alphabet_size
    constexpr auto alphabet_size
    A type trait that holds the size of a (semi-)alphabet.
    Definition alphabet/concept.hpp:834
    \n
    integer_traits.hpp
    Provides metaprogramming utilities for integer types.
    \n
    seqan3::custom
    A namespace for third party and standard library specialisations of SeqAn customisation points.
    Definition char.hpp:40
    \n
    seqan3::custom::alphabet< char_type >::to_rank
    static constexpr auto to_rank(char_type const chr) noexcept
    Convert char to rank by casting to an unsigned integral type of same size.
    Definition char.hpp:76
    \n
    seqan3::custom::alphabet< char_type >::assign_char_to
    static constexpr char_type & assign_char_to(char_type const chr2, char_type &chr) noexcept
    Assign a char to the char type (same as calling =).
    Definition char.hpp:88
    \n
    seqan3::custom::alphabet< char_type >::to_char
    static constexpr char_type to_char(char_type const chr) noexcept
    Converting char to char is no-op (it will just return the value you pass in).
    Definition char.hpp:65
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/char__to_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/char__to_8hpp_source.html", "unified_diff": "@@ -142,29 +142,29 @@\n
    19{
    \n
    63template <alphabet alphabet_type>
    \n
    \n
    64inline auto const char_to = deep{std::views::transform(
    \n
    65 [](auto && in)
    \n
    66 {
    \n
    67 static_assert(
    \n-
    68 std::common_reference_with<decltype(in), alphabet_char_t<alphabet_type>>,
    \n+
    68 std::common_reference_with<decltype(in), alphabet_char_t<alphabet_type>>,
    \n
    69 "The innermost value type must have a common reference to underlying char type of alphabet_type.");
    \n
    70 // call element-wise assign_char from the alphabet
    \n
    71 return assign_char_to(in, alphabet_type{});
    \n
    72 })};
    \n
    \n
    73
    \n
    74} // namespace seqan3::views
    \n
    concept.hpp
    Core alphabet concept and free function/type trait wrappers.
    \n
    basic.hpp
    Provides various type traits on generic types.
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::views::deep
    A wrapper type around an existing view adaptor that enables "deep view" behaviour for that view.
    Definition deep.hpp:101
    \n
    deep.hpp
    Provides seqan3::views::deep.
    \n
    seqan3::views::char_to
    auto const char_to
    A view over an alphabet, given a range of characters.
    Definition char_to.hpp:64
    \n
    seqan3::assign_char_to
    constexpr auto assign_char_to
    Assign a character to an alphabet object.
    Definition alphabet/concept.hpp:517
    \n-
    seqan3::alphabet_char_t
    decltype(seqan3::to_char(std::declval< alphabet_type const >())) alphabet_char_t
    The char_type of the alphabet; defined as the return type of seqan3::to_char.
    Definition alphabet/concept.hpp:393
    \n
    seqan3::views
    The SeqAn namespace for views.
    Definition char_strictly_to.hpp:19
    \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/chunk_8hpp_source.html", "source2": "./usr/share/doc/libseqan3-dev/html/chunk_8hpp_source.html", "unified_diff": "@@ -134,17 +134,18 @@\n
    11
    \n
    12#include <seqan3/contrib/std/chunk_view.hpp>
    \n
    13#include <seqan3/core/platform.hpp>
    \n
    14
    \n
    15namespace seqan3::views
    \n
    16{
    \n
    17
    \n-
    23using SEQAN3_DOXYGEN_ONLY(chunk =) seqan::stl::views::chunk;
    \n+
    23using SEQAN3_DOXYGEN_ONLY(chunk =) seqan::stl::views::chunk;
    \n
    24
    \n
    25} // namespace seqan3::views
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::views::chunk
    seqan::stl::views::chunk chunk
    A view adaptor that divides a range into chunks. <dl class="no-api">This entity is not part of the Se...
    Definition chunk.hpp:23
    \n
    seqan3::views
    The SeqAn namespace for views.
    Definition char_strictly_to.hpp:19
    \n
    platform.hpp
    Provides platform and dependency checks.
    \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10li.html", "unified_diff": "@@ -137,102 +137,102 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpraa10li & \n \n \n \n+constexpraa10li & \n \n \n \n+ \n \n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr aa10li () noexcept=default
    aa10li () noexcept=default
     Defaulted.
     
    \n-constexpr aa10li (aa10li const &) noexcept=default
    aa10li (aa10li const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa10li (aa10li &&) noexcept=default
    aa10li (aa10li &&) noexcept=default
     Defaulted.
     
    \n-constexpr aa10li & operator= (aa10li const &) noexcept=default
    operator= (aa10li const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa10li & operator= (aa10li &&) noexcept=default
    operator= (aa10li &&) noexcept=default
     Defaulted.
     
    \n- ~aa10li () noexcept=default
    ~aa10li () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::aminoacid_base< aa10li, 10 >
    constexpr aminoacid_base (other_aa_type const other) noexcept
    constexpr aminoacid_base (other_aa_type const other) noexcept
     Allow explicit construction from any other aminoacid type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using aa10li_vector = std::vector< aa10li >
    using aa10li_vector = std::vector< aa10li >
     Alias for a std::vector of seqan3::aa10li.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::aminoacid_base< aa10li, 10 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The reduced Li amino acid alphabet.

    \n

    The alphabet consists of letters A, B, C, F, G, H, I, J, K, P A represents hydrophilic and alocohol residues (A,S,T). B represents charged/polar residues (B,D,E,Q,Z). C represents cystein and the species-specific amino acid Selenocysteine. F represents amino acids with aromatic residues (F,W,Y). H represents a group of hydrophobic residues (H,N). I represents a group of large hydrophobic residues (I,V). J represents a group of large hydrophobic residues (J,L,M). K represents long-chain positively charged residues (K,R) and the species-specific amino acid Pyrrolysine. G and P do not represent any other amino acids other than themselves.

    \n

    This alphabet allows to reduce the aminoacid alphabet size to 10 but is still able to recognize and represent folding of all proteins. Amino acids are grouped together based on residues.

    \n@@ -284,25 +284,25 @@\n
    #include <seqan3/alphabet/aminoacid/aa10li.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::aa10li letter{'A'_aa10li};
    \n+
    seqan3::aa10li letter{'A'_aa10li};
    \n
    \n-
    letter.assign_char('C');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n+
    letter.assign_char('C');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n
    \n-
    letter.assign_char('?'); // Unknown characters are implicitly converted to A.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n+
    letter.assign_char('?'); // Unknown characters are implicitly converted to A.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n
    }
    \n
    aa10li.hpp
    Provides seqan3::aa10li, container aliases and string literals.
    \n
    seqan3::aa10li
    The reduced Li amino acid alphabet.
    Definition aa10li.hpp:80
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is stable. Since version 3.1.

    \n

    Friends And Related Symbol Documentation

    \n \n

    ◆ aa10li_vector

    \n@@ -310,15 +310,15 @@\n
    \n
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using aa10li_vector = std::vector<aa10li>using aa10li_vector = std::vector<aa10li>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa10murphy.html", "unified_diff": "@@ -137,102 +137,102 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpraa10murphy & \n \n \n \n+constexpraa10murphy & \n \n \n \n+ \n \n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr aa10murphy () noexcept=default
    aa10murphy () noexcept=default
     Defaulted.
     
    \n-constexpr aa10murphy (aa10murphy const &) noexcept=default
    aa10murphy (aa10murphy const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa10murphy (aa10murphy &&) noexcept=default
    aa10murphy (aa10murphy &&) noexcept=default
     Defaulted.
     
    \n-constexpr aa10murphy & operator= (aa10murphy const &) noexcept=default
    operator= (aa10murphy const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa10murphy & operator= (aa10murphy &&) noexcept=default
    operator= (aa10murphy &&) noexcept=default
     Defaulted.
     
    \n- ~aa10murphy () noexcept=default
    ~aa10murphy () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::aminoacid_base< aa10murphy, 10 >
    constexpr aminoacid_base (other_aa_type const other) noexcept
    constexpr aminoacid_base (other_aa_type const other) noexcept
     Allow explicit construction from any other aminoacid type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using aa10murphy_vector = std::vector< aa10murphy >
    using aa10murphy_vector = std::vector< aa10murphy >
     Alias for a std::vector of seqan3::aa10murphy.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::aminoacid_base< aa10murphy, 10 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The reduced Murphy amino acid alphabet.

    \n

    The alphabet consists of letters A, B, C, F, G, H, I, K, P, S B represents charged/polar residues (E,D,N,Q). C represents cystein and the species-specific amino acid Selenocysteine. F represents amino acids with large and mainly hydrophobic aromatic side chains (F,W,Y). I represents large hydrophobes (L,V,I,M). K represents long-chain positively charged residues (K,R) and the species-specific amino acid Pyrrolysine. S represents alcohols (S,T) and unknown. A, G, H and P do not represent any other amino acids other than themselves.

    \n

    This alphabet allows to reduce the aminoacid alphabet size to 10 but is still able to recognize and represent folding of all proteins. Amino acids are grouped together based on similar physical and chemical properties.

    \n@@ -284,25 +284,25 @@\n
    #include <seqan3/alphabet/aminoacid/aa10murphy.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::aa10murphy letter{'A'_aa10murphy};
    \n+
    seqan3::aa10murphy letter{'A'_aa10murphy};
    \n
    \n-
    letter.assign_char('C');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n+
    letter.assign_char('C');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n
    \n-
    letter.assign_char('?'); // Unknown characters are implicitly converted to S.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "S"
    \n+
    letter.assign_char('?'); // Unknown characters are implicitly converted to S.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "S"
    \n
    }
    \n
    aa10murphy.hpp
    Provides seqan3::aa10murphy, container aliases and string literals.
    \n
    seqan3::aa10murphy
    The reduced Murphy amino acid alphabet.
    Definition aa10murphy.hpp:79
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is stable. Since version 3.1.

    \n

    Friends And Related Symbol Documentation

    \n \n

    ◆ aa10murphy_vector

    \n@@ -310,15 +310,15 @@\n
    \n
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using aa10murphy_vector = std::vector<aa10murphy>using aa10murphy_vector = std::vector<aa10murphy>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa20.html", "unified_diff": "@@ -137,102 +137,102 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpraa20 & \n \n \n \n+constexpraa20 & \n \n \n \n+ \n \n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr aa20 () noexcept=default
    aa20 () noexcept=default
     Defaulted.
     
    \n-constexpr aa20 (aa20 const &) noexcept=default
    aa20 (aa20 const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa20 (aa20 &&) noexcept=default
    aa20 (aa20 &&) noexcept=default
     Defaulted.
     
    \n-constexpr aa20 & operator= (aa20 const &) noexcept=default
    operator= (aa20 const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa20 & operator= (aa20 &&) noexcept=default
    operator= (aa20 &&) noexcept=default
     Defaulted.
     
    \n- ~aa20 () noexcept=default
    ~aa20 () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::aminoacid_base< aa20, 20 >
    constexpr aminoacid_base (other_aa_type const other) noexcept
    constexpr aminoacid_base (other_aa_type const other) noexcept
     Allow explicit construction from any other aminoacid type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using aa20_vector = std::vector< aa20 >
    using aa20_vector = std::vector< aa20 >
     Alias for a std::vector of seqan3::aa20.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::aminoacid_base< aa20, 20 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The canonical amino acid alphabet.

    \n

    The alphabet consists of letters A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, Y

    \n

    The alphabet may be brace initialized from the static letter members (see above). Note that you cannot assign regular characters, but additional functions for this are available.

    \n@@ -265,25 +265,25 @@\n
    #include <seqan3/alphabet/aminoacid/aa20.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::aa20 letter{'A'_aa20};
    \n+
    seqan3::aa20 letter{'A'_aa20};
    \n
    \n-
    letter.assign_char('C');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n+
    letter.assign_char('C');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n
    \n-
    letter.assign_char('?'); // Unknown characters are implicitly converted to S.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "S"
    \n+
    letter.assign_char('?'); // Unknown characters are implicitly converted to S.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "S"
    \n
    }
    \n
    aa20.hpp
    Provides seqan3::aa20, container aliases and string literals.
    \n
    seqan3::aa20
    The canonical amino acid alphabet.
    Definition aa20.hpp:61
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is stable. Since version 3.1.

    \n

    Friends And Related Symbol Documentation

    \n \n

    ◆ aa20_vector

    \n@@ -291,15 +291,15 @@\n
    \n
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using aa20_vector = std::vector<aa20>using aa20_vector = std::vector<aa20>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aa27.html", "unified_diff": "@@ -137,102 +137,102 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpraa27 & \n \n \n \n+constexpraa27 & \n \n \n \n+ \n \n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr aa27 () noexcept=default
    aa27 () noexcept=default
     Defaulted.
     
    \n-constexpr aa27 (aa27 const &) noexcept=default
    aa27 (aa27 const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa27 (aa27 &&) noexcept=default
    aa27 (aa27 &&) noexcept=default
     Defaulted.
     
    \n-constexpr aa27 & operator= (aa27 const &) noexcept=default
    operator= (aa27 const &) noexcept=default
     Defaulted.
     
    \n-constexpr aa27 & operator= (aa27 &&) noexcept=default
    operator= (aa27 &&) noexcept=default
     Defaulted.
     
    \n- ~aa27 () noexcept=default
    ~aa27 () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::aminoacid_base< aa27, 27 >
    constexpr aminoacid_base (other_aa_type const other) noexcept
    constexpr aminoacid_base (other_aa_type const other) noexcept
     Allow explicit construction from any other aminoacid type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using aa27_vector = std::vector< aa27 >
    using aa27_vector = std::vector< aa27 >
     Alias for a std::vector of seqan3::aa27.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::aminoacid_base< aa27, 27 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The twenty-seven letter amino acid alphabet.

    \n

    The alphabet consists of letters A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S, T, U, V, W, X, Y, Z, *

    \n

    Like most alphabets, this alphabet cannot be initialised directly from its character representation. Instead initialise/assign from the character literal 'X'_aa27 or use the function seqan3::aa27::assign_char().

    \n@@ -243,25 +243,25 @@\n
    #include <seqan3/alphabet/aminoacid/aa27.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::aa27 letter{'A'_aa27};
    \n+
    seqan3::aa27 letter{'A'_aa27};
    \n
    \n-
    letter.assign_char('C');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n+
    letter.assign_char('C');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n
    \n-
    letter.assign_char('?'); // Unknown characters are implicitly converted to X.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "X"
    \n+
    letter.assign_char('?'); // Unknown characters are implicitly converted to X.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "X"
    \n
    }
    \n
    aa27.hpp
    Provides seqan3::aa27, container aliases and string literals.
    \n
    seqan3::aa27
    The twenty-seven letter amino acid alphabet.
    Definition aa27.hpp:43
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is stable. Since version 3.1.

    \n

    Friends And Related Symbol Documentation

    \n \n

    ◆ aa27_vector

    \n@@ -269,15 +269,15 @@\n
    \n
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using aa27_vector = std::vector<aa27>using aa27_vector = std::vector<aa27>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range.html", "unified_diff": "@@ -145,86 +145,86 @@\n  The iterator of seqan3::detail::algorithm_result_generator_range. More...
    \n  \n \n \n \n \n+ \n \n \n \n+ \n \n \n \n+ \n \n \n \n+algorithm_result_generator_range & \n \n \n \n+algorithm_result_generator_range & \n \n \n \n+ \n \n \n \n+ \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n+algorithm_range_iterator \n \n \n-\n+\n \n \n \n+constexpr std::default_sentinel_t \n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n- algorithm_result_generator_range ()=default
    algorithm_result_generator_range ()=default
     Defaulted.
     
    \n- algorithm_result_generator_range (algorithm_result_generator_range const &)=delete
    algorithm_result_generator_range (algorithm_result_generator_range const &)=delete
     This is a move-only type.
     
    \n- algorithm_result_generator_range (algorithm_result_generator_range &&)=default
    algorithm_result_generator_range (algorithm_result_generator_range &&)=default
     Defaulted.
     
    \n-algorithm_result_generator_range & operator= (algorithm_result_generator_range const &)=delete
    operator= (algorithm_result_generator_range const &)=delete
     This is a move-only type.
     
    \n-algorithm_result_generator_range & operator= (algorithm_result_generator_range &&)=default
    operator= (algorithm_result_generator_range &&)=default
     Defaulted.
     
    \n- ~algorithm_result_generator_range ()=default
    ~algorithm_result_generator_range ()=default
     Defaulted.
     
    \n- algorithm_result_generator_range (algorithm_executor_type const &algorithm_executor)=delete
    algorithm_result_generator_range (algorithm_executor_type const &algorithm_executor)=delete
     Explicit deletion to forbid copy construction of the underlying executor.
     
     algorithm_result_generator_range (algorithm_executor_type &&algorithm_executor)
     algorithm_result_generator_range (algorithm_executor_type &&algorithm_executor)
     Constructs a new algorithm range by taking ownership over the passed algorithm buffer.
     
    Iterators
    constexpr algorithm_range_iterator begin ()
    constexpr algorithm_range_iterator begin ()
     Returns an iterator to the first element of the algorithm range.
     
    \n-algorithm_range_iterator begin () const =delete
    begin () const =delete
     This range is not const-iterable.
     
    constexpr std::default_sentinel_t end () noexcept
    constexpr std::default_sentinel_t end () noexcept
     Returns a sentinel signaling the end of the algorithm range.
     
    \n-constexpr std::default_sentinel_t end () const =delete
    end () const =delete
     This range is not const-iterable.
     
    \n \n-\n+\n \n \n

    \n Protected Member Functions

    bool next ()
    bool next ()
     Receives the next algorithm result from the executor buffer.
     
    \n \n \n+class \n \n \n

    \n Friends

    \n-class algorithm_range_iterator
    algorithm_range_iterator
     Befriend the iterator type.
     
    \n \n \n \n \n-\n+template<typenamealgorithm_executor_type > \n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    Type deduction guide
    \n-template<typename algorithm_executor_type >
     algorithm_result_generator_range (algorithm_executor_type &&) -> algorithm_result_generator_range< std::remove_reference_t< algorithm_executor_type > >
     algorithm_result_generator_range (algorithm_executor_type &&) -> algorithm_result_generator_range< std::remove_reference_t< algorithm_executor_type > >
     Deduces from the passed algorithm_executor_type.
     
    \n

    Detailed Description

    \n-
    template<typename algorithm_executor_type>
    \n+
    template<typename algorithm_executor_type>
    \n class seqan3::algorithm_result_generator_range< algorithm_executor_type >

    An input range over the algorithm results generated by the underlying algorithm executor.

    \n
    Template Parameters
    \n \n \n
    algorithm_executor_typeThe type of the underlying algorithm executor; must be of type seqan3::detail::algorithm_executor_blocking.
    \n
    \n
    \n@@ -233,23 +233,23 @@\n

    Constructor & Destructor Documentation

    \n \n

    ◆ algorithm_result_generator_range()

    \n \n
    \n
    \n
    \n-template<typename algorithm_executor_type >
    \n+template<typename algorithm_executor_type >
    \n \n \n \n \n@@ -271,21 +271,21 @@\n

    Member Function Documentation

    \n \n

    ◆ begin()

    \n \n
    \n
    \n
    \n-template<typename algorithm_executor_type >
    \n+template<typename algorithm_executor_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    seqan3::algorithm_result_generator_range< algorithm_executor_type >::algorithm_result_generator_range seqan3::algorithm_result_generator_range< algorithm_executor_type >::algorithm_result_generator_range (algorithm_executor_type && algorithm_executor_type && algorithm_executor)
    \n     		\n inlineexplicit
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr algorithm_range_iterator seqan3::algorithm_result_generator_range< algorithm_executor_type >::begin constexpr algorithm_range_iterator seqan3::algorithm_result_generator_range< algorithm_executor_type >::begin ()
    \n     		\n@@ -302,21 +302,21 @@\n \n \n

    ◆ end()

    \n \n
    \n
    \n
    \n-template<typename algorithm_executor_type >
    \n+template<typename algorithm_executor_type >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr std::default_sentinel_t seqan3::algorithm_result_generator_range< algorithm_executor_type >::end constexpr std::default_sentinel_t seqan3::algorithm_result_generator_range< algorithm_executor_type >::end ()
    \n     		\n@@ -333,21 +333,21 @@\n \n \n

    ◆ next()

    \n \n
    \n
    \n
    \n-template<typename algorithm_executor_type >
    \n+template<typename algorithm_executor_type >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::algorithm_result_generator_range< algorithm_executor_type >::next bool seqan3::algorithm_result_generator_range< algorithm_executor_type >::next ()
    \n     		\n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1algorithm__result__generator__range_1_1algorithm__range__iterator.html", "unified_diff": "@@ -136,120 +136,120 @@\n
    \n
    [legend]
    \n \n \n \n \n+using \n \n \n \n+using \n \n \n \n+using \n \n \n \n+using \n \n \n \n+using \n \n \n

    \n Public Types

    Associated types
    \n-using difference_type = std::ptrdiff_t
    difference_type = std::ptrdiff_t
     Type for distances between iterators.
     
    \n-using value_type = algorithm_result_type
    value_type = algorithm_result_type
     Value type of container elements.
     
    \n-using reference = std::add_lvalue_reference_t< value_type >
    reference = std::add_lvalue_reference_t< value_type >
     Use reference type defined by container.
     
    \n-using pointer = std::add_pointer_t< value_type >
    pointer = std::add_pointer_t< value_type >
     Pointer type is pointer of container element type.
     
    \n-using iterator_category = std::input_iterator_tag
    iterator_category = std::input_iterator_tag
     Sets iterator category as input iterator.
     
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralgorithm_range_iterator & \n \n \n \n+constexpralgorithm_range_iterator & \n \n \n \n+ \n \n \n \n+constexpr \n \n \n \n-\n+\n \n \n \n+pointer \n \n \n \n \n \n \n \n+void \n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr algorithm_range_iterator () noexcept=default
    algorithm_range_iterator () noexcept=default
     Defaulted.
     
    \n-constexpr algorithm_range_iterator (algorithm_range_iterator const &) noexcept=default
    algorithm_range_iterator (algorithm_range_iterator const &) noexcept=default
     Defaulted.
     
    \n-constexpr algorithm_range_iterator (algorithm_range_iterator &&) noexcept=default
    algorithm_range_iterator (algorithm_range_iterator &&) noexcept=default
     Defaulted.
     
    \n-constexpr algorithm_range_iterator & operator= (algorithm_range_iterator const &) noexcept=default
    operator= (algorithm_range_iterator const &) noexcept=default
     Defaulted.
     
    \n-constexpr algorithm_range_iterator & operator= (algorithm_range_iterator &&) noexcept=default
    operator= (algorithm_range_iterator &&) noexcept=default
     Defaulted.
     
    \n- ~algorithm_range_iterator ()=default
    ~algorithm_range_iterator ()=default
     Defaulted.
     
    \n-constexpr algorithm_range_iterator (algorithm_result_generator_range &range)
    algorithm_range_iterator (algorithm_result_generator_range &range)
     Construct from alignment stream.
     
    Access operators
    reference operator* () const noexcept
    reference operator* () const noexcept
     Access the pointed-to element.
     
    \n-pointer operator-> () const noexcept
    operator-> () const noexcept
     Returns a pointer to the current algorithm result.
     
    Increment operators
    \n algorithm_range_iterator & operator++ ()
     Increments the iterator by one.
     
    \n-void operator++ (int)
    operator++ (int)
     Returns an iterator incremented by one.
     
    \n \n \n \n+constexprbool \n \n \n \n+constexprbool \n \n \n \n+constexprbool \n \n \n \n+constexprbool \n \n \n

    \n Friends

    Comparison operators
    \n-constexpr bool operator== (algorithm_range_iterator const &lhs, std::default_sentinel_t const &) noexcept
    operator== (algorithm_range_iterator const &lhs, std::default_sentinel_t const &) noexcept
     Checks whether lhs is equal to the sentinel.
     
    \n-constexpr bool operator== (std::default_sentinel_t const &lhs, algorithm_range_iterator const &rhs) noexcept
    operator== (std::default_sentinel_t const &lhs, algorithm_range_iterator const &rhs) noexcept
     Checks whether lhs is equal to rhs.
     
    \n-constexpr bool operator!= (algorithm_range_iterator const &lhs, std::default_sentinel_t const &rhs) noexcept
    operator!= (algorithm_range_iterator const &lhs, std::default_sentinel_t const &rhs) noexcept
     Checks whether *this is not equal to the sentinel.
     
    \n-constexpr bool operator!= (std::default_sentinel_t const &lhs, algorithm_range_iterator const &rhs) noexcept
    operator!= (std::default_sentinel_t const &lhs, algorithm_range_iterator const &rhs) noexcept
     Checks whether lhs is not equal to rhs.
     
    \n

    Detailed Description

    \n-
    template<typename algorithm_executor_type>
    \n+
    template<typename algorithm_executor_type>
    \n class seqan3::algorithm_result_generator_range< algorithm_executor_type >::algorithm_range_iterator

    The iterator of seqan3::detail::algorithm_result_generator_range.

    \n

    Member Function Documentation

    \n \n

    ◆ operator*()

    \n \n
    \n
    \n
    \n-template<typename algorithm_executor_type >
    \n+template<typename algorithm_executor_type >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    reference seqan3::algorithm_result_generator_range< algorithm_executor_type >::algorithm_range_iterator::operator* reference seqan3::algorithm_result_generator_range< algorithm_executor_type >::algorithm_range_iterator::operator* () const
    \n     		\n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1band__fixed__size.html", "unified_diff": "@@ -137,38 +137,38 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprband_fixed_size & \n \n \n \n+constexprband_fixed_size & \n \n \n \n+ \n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr band_fixed_size ()=default
    band_fixed_size ()=default
     Defaulted.
     
    \n-constexpr band_fixed_size (band_fixed_size const &)=default
    band_fixed_size (band_fixed_size const &)=default
     Defaulted.
     
    \n-constexpr band_fixed_size (band_fixed_size &&)=default
    band_fixed_size (band_fixed_size &&)=default
     Defaulted.
     
    \n-constexpr band_fixed_size & operator= (band_fixed_size const &)=default
    operator= (band_fixed_size const &)=default
     Defaulted.
     
    \n-constexpr band_fixed_size & operator= (band_fixed_size &&)=default
    operator= (band_fixed_size &&)=default
     Defaulted.
     
    \n- ~band_fixed_size ()=default
    ~band_fixed_size ()=default
     Defaulted.
     
    constexpr band_fixed_size (seqan3::align_cfg::lower_diagonal const lower_diagonal, seqan3::align_cfg::upper_diagonal const upper_diagonal)
    constexpr band_fixed_size (seqan3::align_cfg::lower_diagonal const lower_diagonal, seqan3::align_cfg::upper_diagonal const upper_diagonal)
     Initialises the fixed size band by setting the lower and the upper matrix diagonal.
     
    \n \n \n@@ -192,15 +192,15 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_band.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // A symmetric band around the main diagonal.
    \n-
    seqan3::align_cfg::band_fixed_size band_cfg{seqan3::align_cfg::lower_diagonal{-4},
    \n+
    seqan3::align_cfg::band_fixed_size band_cfg{seqan3::align_cfg::lower_diagonal{-4},
    \n
    seqan3::align_cfg::upper_diagonal{4}};
    \n
    \n
    // A band starting with the main diagonal shifted by 3 cells to the right.
    \n
    seqan3::align_cfg::band_fixed_size band_cfg_hi{seqan3::align_cfg::lower_diagonal{3},
    \n
    seqan3::align_cfg::upper_diagonal{7}};
    \n
    \n
    // A band starting with the main diagonal shifted by 3 cells down.
    \n@@ -210,37 +210,38 @@\n
    // An invalid band configuration.
    \n
    // Using this band as a configuration in seqan3::align_pairwise would cause the algorithm to throw an exception.
    \n
    seqan3::align_cfg::band_fixed_size band_cfg_invalid{seqan3::align_cfg::lower_diagonal{7},
    \n
    seqan3::align_cfg::upper_diagonal{3}};
    \n
    }
    \n
    align_config_band.hpp
    Provides seqan3::detail::align_config_band.
    \n
    seqan3::align_cfg::band_fixed_size
    Configuration element for setting a fixed size band.
    Definition align_config_band.hpp:60
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::align_cfg::lower_diagonal
    A strong type representing the lower diagonal of the seqan3::align_cfg::band_fixed_size.
    Definition align_config_band.hpp:28
    \n
    seqan3::align_cfg::upper_diagonal
    A strong type representing the upper diagonal of the seqan3::align_cfg::band_fixed_size.
    Definition align_config_band.hpp:39
    \n
    Remarks
    For a complete overview, take a look at Pairwise Alignments.
    \n

    Constructor & Destructor Documentation

    \n \n

    ◆ band_fixed_size()

    \n \n
    \n
    \n

    \n Public Attributes

    \n int32_t lower_diagonal {std::numeric_limits<int32_t>::lowest()}
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1detail_1_1result__type.html", "unified_diff": "@@ -137,55 +137,55 @@\n
    \n
    \n
    [legend]
    \n
    constexpr seqan3::align_cfg::band_fixed_size::band_fixed_size constexpr seqan3::align_cfg::band_fixed_size::band_fixed_size (seqan3::align_cfg::lower_diagonal const seqan3::align_cfg::lower_diagonal const lower_diagonal,
    seqan3::align_cfg::upper_diagonal const seqan3::align_cfg::upper_diagonal const upper_diagonal 
    )
    \n \n \n+using \n \n \n

    \n Public Types

    \n-using type = alignment_result_t
    type = alignment_result_t
     The result type.
     
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprresult_type & \n \n \n \n+constexprresult_type & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr result_type ()=default
    result_type ()=default
     Defaulted.
     
    \n-constexpr result_type (result_type const &)=default
    result_type (result_type const &)=default
     Defaulted.
     
    \n-constexpr result_type (result_type &&)=default
    result_type (result_type &&)=default
     Defaulted.
     
    \n-constexpr result_type & operator= (result_type const &)=default
    operator= (result_type const &)=default
     Defaulted.
     
    \n-constexpr result_type & operator= (result_type &&)=default
    operator= (result_type &&)=default
     Defaulted.
     
    \n- ~result_type ()=default
    ~result_type ()=default
     Defaulted.
     
    \n \n \n+staticconstexpr seqan3::detail::align_config_id \n \n \n

    \n Static Public Attributes

    \n-static constexpr seqan3::detail::align_config_id id {seqan3::detail::align_config_id::result_type}
    id {seqan3::detail::align_config_id::result_type}
     Internal id to check for consistent configuration settings.
     
    \n

    Detailed Description

    \n-
    template<typename alignment_result_t>
    \n+
    template<typename alignment_result_t>
    \n requires seqan3::detail::is_type_specialisation_of_v<alignment_result_t, seqan3::alignment_result>
    \n class seqan3::align_cfg::detail::result_type< alignment_result_t >

    Configuration element capturing the configured seqan3::alignment_result for the alignment algorithm.

    \n
    Template Parameters
    \n \n \n
    alignment_result_tThe alignment result type to capture; must be a type specialisation of seqan3::alignment_result.
    \n
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1gap__cost__affine.html", "unified_diff": "@@ -137,38 +137,38 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprgap_cost_affine & \n \n \n \n+constexprgap_cost_affine & \n \n \n \n+ \n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr gap_cost_affine ()=default
    gap_cost_affine ()=default
     Defaulted.
     
    \n-constexpr gap_cost_affine (gap_cost_affine const &)=default
    gap_cost_affine (gap_cost_affine const &)=default
     Defaulted.
     
    \n-constexpr gap_cost_affine (gap_cost_affine &&)=default
    gap_cost_affine (gap_cost_affine &&)=default
     Defaulted.
     
    \n-constexpr gap_cost_affine & operator= (gap_cost_affine const &)=default
    operator= (gap_cost_affine const &)=default
     Defaulted.
     
    \n-constexpr gap_cost_affine & operator= (gap_cost_affine &&)=default
    operator= (gap_cost_affine &&)=default
     Defaulted.
     
    \n- ~gap_cost_affine ()=default
    ~gap_cost_affine ()=default
     Defaulted.
     
    constexpr gap_cost_affine (seqan3::align_cfg::open_score open_score, seqan3::align_cfg::extension_score extension_score)
    constexpr gap_cost_affine (seqan3::align_cfg::open_score open_score, seqan3::align_cfg::extension_score extension_score)
     Construction from strongly typed open score and extension score.
     
    \n \n \n@@ -191,29 +191,30 @@\n
    #include <iostream>
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_gap_cost_affine.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Configuration with linear gap costs.
    \n-
    seqan3::align_cfg::gap_cost_affine linear_cfg{seqan3::align_cfg::open_score{0},
    \n+
    seqan3::align_cfg::gap_cost_affine linear_cfg{seqan3::align_cfg::open_score{0},
    \n
    seqan3::align_cfg::extension_score{-1}};
    \n
    \n
    // Configuration with affine gap costs. Score for opening a gap during the alignment algorithm will be -11.
    \n
    seqan3::align_cfg::gap_cost_affine affine_cfg{seqan3::align_cfg::open_score{-1},
    \n
    seqan3::align_cfg::extension_score{-10}};
    \n
    \n
    // Accessing the members of the gap scheme
    \n
    int open = affine_cfg.open_score;
    \n
    int extension = affine_cfg.extension_score;
    \n
    std::cout << open << '\\n'; // -1
    \n
    std::cout << extension << '\\n'; // -10
    \n
    }
    \n
    align_config_gap_cost_affine.hpp
    Provides seqan3::align_config::gap_cost_affine.
    \n
    seqan3::align_cfg::gap_cost_affine
    A configuration element for the affine gap cost scheme.
    Definition align_config_gap_cost_affine.hpp:72
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n \n \n
    seqan3::align_cfg::extension_score
    A strong type of underlying type int32_t that represents the score (usually negative) of any characte...
    Definition align_config_gap_cost_affine.hpp:48
    \n
    seqan3::align_cfg::open_score
    A strong type of underlying type int32_t that represents a score (usually negative) that is incurred ...
    Definition align_config_gap_cost_affine.hpp:31
    \n

    Constructor & Destructor Documentation

    \n \n

    ◆ gap_cost_affine()

    \n@@ -221,15 +222,15 @@\n
    \n
    \n

    \n Public Attributes

    \n int32_t extension_score {-1}
    \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__global.html", "unified_diff": "@@ -137,70 +137,71 @@\n
    \n
    [legend]
    \n
    constexpr seqan3::align_cfg::gap_cost_affine::gap_cost_affine constexpr seqan3::align_cfg::gap_cost_affine::gap_cost_affine (seqan3::align_cfg::open_score open_score,
    \n \n \n \n+ \n \n \n \n+ \n \n \n \n+ \n \n \n \n+method_global & \n \n \n \n+method_global & \n \n \n \n+ \n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n- method_global ()=default
    method_global ()=default
     Defaulted.
     
    \n- method_global (method_global const &)=default
    method_global (method_global const &)=default
     Defaulted.
     
    \n- method_global (method_global &&)=default
    method_global (method_global &&)=default
     Defaulted.
     
    \n-method_global & operator= (method_global const &)=default
    operator= (method_global const &)=default
     Defaulted.
     
    \n-method_global & operator= (method_global &&)=default
    operator= (method_global &&)=default
     Defaulted.
     
    \n- ~method_global ()=default
    ~method_global ()=default
     Defaulted.
     
    constexpr method_global (seqan3::align_cfg::free_end_gaps_sequence1_leading free_sequence1_leading, seqan3::align_cfg::free_end_gaps_sequence2_leading free_sequence2_leading, seqan3::align_cfg::free_end_gaps_sequence1_trailing free_sequence1_trailing, seqan3::align_cfg::free_end_gaps_sequence2_trailing free_sequence2_trailing) noexcept
    constexpr method_global (seqan3::align_cfg::free_end_gaps_sequence1_leading free_sequence1_leading, seqan3::align_cfg::free_end_gaps_sequence2_leading free_sequence2_leading, seqan3::align_cfg::free_end_gaps_sequence1_trailing free_sequence1_trailing, seqan3::align_cfg::free_end_gaps_sequence2_trailing free_sequence2_trailing) noexcept
     Construct method_global with a specific free end gap configuration.
     
    \n \n \n+bool \n \n \n \n+bool \n \n \n \n+bool \n \n \n \n+bool \n \n \n

    \n Public Attributes

    \n-bool free_end_gaps_sequence1_leading {false}
    free_end_gaps_sequence1_leading {false}
     If set to true, leading gaps in sequence1 are not penalised when computing the optimal alignment.
     
    \n-bool free_end_gaps_sequence1_trailing {false}
    free_end_gaps_sequence1_trailing {false}
     If set to true, trailing gaps in sequence1 are not penalised when computing the optimal alignment.
     
    \n-bool free_end_gaps_sequence2_leading {false}
    free_end_gaps_sequence2_leading {false}
     If set to true, leading gaps in sequence2 are not penalised when computing the optimal alignment.
     
    \n-bool free_end_gaps_sequence2_trailing {false}
    free_end_gaps_sequence2_trailing {false}
     If set to true, trailing gaps in sequence2 are not penalised when computing the optimal alignment.
     
    \n

    Detailed Description

    \n

    Sets the global alignment method.

    \n

    There are several methods for sequence alignment. We distinguish between local and global alignments. The semi-global alignment is implemented as a variation of the global alignment.

    \n-

    Global Alignment:

    --T--CC-C-AGT--TATGT-CAGGGGACACG-A-GCATGCAGA-GAC
    \n+

    Global Alignment:

    --T--CC-C-AGT--TATGT-CAGGGGACACG-A-GCATGCAGA-GAC
    \n
    | || | || | | | ||| || | | | | |||| |
    \n-
    AATTGCCGCC-GTCGT-T-TTCAG----CA-GTTATG-T-CAGAT--C
    \n+
    AATTGCCGCC-GTCGT-T-TTCAG----CA-GTTATG-T-CAGAT--C
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n

    Finding the optimal global alignment of two sequences is solved by the Needleman-Wunsch algorithm.
    \n-Semi-global Alignment (e.g. overlapping sequences):

    TCCCAGTTATGTCAGgggacacgagcatgcagagac
    \n+Semi-global Alignment (e.g. overlapping sequences):

    TCCCAGTTATGTCAGgggacacgagcatgcagagac
    \n
    |||||||||||||||
    \n-
    aattgccgccgtcgttttTCCCAGTTATGTCAG
    \n+
    aattgccgccgtcgttttTCCCAGTTATGTCAG
    \n

    The semi-global alignment is a specially configured global alignment, namely we do not penalize gaps at the ends of the alignment. Semi-global alignments are often used in genome assembly applications when trying to find matching overlaps.

    \n

    Example

    \n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_method.hpp>
    \n@@ -211,24 +212,24 @@\n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    using namespace seqan3::literals;
    \n
    \n
    int main()
    \n
    {
    \n
    // configure a global alignment for DNA sequences
    \n-
    auto min_cfg = seqan3::align_cfg::method_global{}
    \n+
    auto min_cfg = seqan3::align_cfg::method_global{}
    \n
    | seqan3::align_cfg::scoring_scheme{seqan3::nucleotide_scoring_scheme{seqan3::match_score{4},
    \n
    seqan3::mismatch_score{-5}}}
    \n
    | seqan3::align_cfg::gap_cost_affine{seqan3::align_cfg::open_score{-10},
    \n
    seqan3::align_cfg::extension_score{-1}};
    \n
    \n-
    auto seq1 = "TCGT"_dna4;
    \n-
    auto seq2 = "ACGA"_dna4;
    \n-
    for (auto res : seqan3::align_pairwise(std::tie(seq1, seq2), min_cfg))
    \n-
    seqan3::debug_stream << res.score() << '\\n'; // print out the alignment score
    \n+
    auto seq1 = "TCGT"_dna4;
    \n+
    auto seq2 = "ACGA"_dna4;
    \n+
    for (auto res : seqan3::align_pairwise(std::tie(seq1, seq2), min_cfg))
    \n+
    seqan3::debug_stream << res.score() << '\\n'; // print out the alignment score
    \n
    }
    \n
    align_config_method.hpp
    Provides global and local alignment configurations.
    \n
    align_config_scoring_scheme.hpp
    Provides seqan3::align_cfg::scoring_scheme.
    \n
    align_pairwise.hpp
    Provides pairwise alignment function.
    \n
    seqan3::align_cfg::gap_cost_affine
    A configuration element for the affine gap cost scheme.
    Definition align_config_gap_cost_affine.hpp:72
    \n
    seqan3::align_cfg::method_global
    Sets the global alignment method.
    Definition align_config_method.hpp:119
    \n
    seqan3::align_cfg::scoring_scheme
    Sets the scoring scheme for the alignment algorithm.
    Definition align_config_scoring_scheme.hpp:42
    \n@@ -254,15 +255,15 @@\n
    \n
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1method__local.html", "unified_diff": "@@ -136,44 +136,45 @@\n
    \n
    [legend]
    \n
    constexpr seqan3::align_cfg::method_global::method_global constexpr seqan3::align_cfg::method_global::method_global (seqan3::align_cfg::free_end_gaps_sequence1_leading free_sequence1_leading,
    \n \n \n \n+ \n \n \n \n+ \n \n \n \n+ \n \n \n \n+method_local & \n \n \n \n+method_local & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n- method_local ()=default
    method_local ()=default
     Defaulted.
     
    \n- method_local (method_local const &)=default
    method_local (method_local const &)=default
     Defaulted.
     
    \n- method_local (method_local &&)=default
    method_local (method_local &&)=default
     Defaulted.
     
    \n-method_local & operator= (method_local const &)=default
    operator= (method_local const &)=default
     Defaulted.
     
    \n-method_local & operator= (method_local &&)=default
    operator= (method_local &&)=default
     Defaulted.
     
    \n- ~method_local ()=default
    ~method_local ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n

    Sets the local alignment method.

    \n

    There are several methods for sequence alignment. We distinguish between local and global alignments. The semi-global alignment is implemented as a variation of the global alignment.

    \n-

    Local Alignment (better suited to find conserved segments):

    tccCAGTTATGTCAGgggacacgagcatgcagagac
    \n+

    Local Alignment (better suited to find conserved segments):

    tccCAGTTATGTCAGgggacacgagcatgcagagac
    \n
    ||||||||||||
    \n-
    aattgccgccgtcgttttcagCAGTTATGTCAGatc
    \n+
    aattgccgccgtcgttttcagCAGTTATGTCAGatc
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n

    A local alignment is effectively a global alignment of two partial sequences. For example when two genes from different species are similar in short conserved regions and dissimilar in the remaining regions. A global alignment would not find the local matching because it would try to align the entire sequence. This is solved by the Smith-Waterman algorithm.

    \n

    Example

    \n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_method.hpp>
    \n@@ -184,22 +185,22 @@\n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    using namespace seqan3::literals;
    \n
    \n
    int main()
    \n
    {
    \n
    // configure a local alignment for DNA sequences
    \n-
    auto min_cfg = seqan3::align_cfg::method_local{}
    \n+
    auto min_cfg = seqan3::align_cfg::method_local{}
    \n
    | seqan3::align_cfg::scoring_scheme{
    \n
    seqan3::nucleotide_scoring_scheme{seqan3::match_score{4}, seqan3::mismatch_score{-5}}};
    \n
    \n-
    auto seq1 = "TCGT"_dna4;
    \n-
    auto seq2 = "ACGA"_dna4;
    \n-
    for (auto res : seqan3::align_pairwise(std::tie(seq1, seq2), min_cfg))
    \n-
    seqan3::debug_stream << res.score() << '\\n'; // print out the alignment score
    \n+
    auto seq1 = "TCGT"_dna4;
    \n+
    auto seq2 = "ACGA"_dna4;
    \n+
    for (auto res : seqan3::align_pairwise(std::tie(seq1, seq2), min_cfg))
    \n+
    seqan3::debug_stream << res.score() << '\\n'; // print out the alignment score
    \n
    }
    \n
    align_config_method.hpp
    Provides global and local alignment configurations.
    \n
    align_config_scoring_scheme.hpp
    Provides seqan3::align_cfg::scoring_scheme.
    \n
    align_pairwise.hpp
    Provides pairwise alignment function.
    \n
    seqan3::align_cfg::method_local
    Sets the local alignment method.
    Definition align_config_method.hpp:42
    \n
    seqan3::align_cfg::scoring_scheme
    Sets the scoring scheme for the alignment algorithm.
    Definition align_config_scoring_scheme.hpp:42
    \n
    seqan3::nucleotide_scoring_scheme
    A data structure for managing and computing the score of two nucleotides.
    Definition nucleotide_scoring_scheme.hpp:35
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1min__score.html", "unified_diff": "@@ -138,52 +138,52 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprmin_score & \n \n \n \n+constexprmin_score & \n \n \n \n+ \n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr min_score () noexcept=default
    min_score () noexcept=default
     Defaulted.
     
    \n-constexpr min_score (min_score const &) noexcept=default
    min_score (min_score const &) noexcept=default
     Defaulted.
     
    \n-constexpr min_score (min_score &&) noexcept=default
    min_score (min_score &&) noexcept=default
     Defaulted.
     
    \n-constexpr min_score & operator= (min_score const &) noexcept=default
    operator= (min_score const &) noexcept=default
     Defaulted.
     
    \n-constexpr min_score & operator= (min_score &&) noexcept=default
    operator= (min_score &&) noexcept=default
     Defaulted.
     
    \n- ~min_score () noexcept=default
    ~min_score () noexcept=default
     Defaulted.
     
    constexpr min_score (int32_t const score)
    constexpr min_score (int32_t const score)
     Initialises the minimal score.
     
    \n \n \n \n \n

    \n Public Attributes

    \n int32_t score {std::numeric_limits<int32_t>::lowest()}
     Minimal score for the distance computation [default: -infinity].
     
    \n \n \n+staticconstexpr seqan3::detail::align_config_id \n \n \n

    \n Static Public Attributes

    \n-static constexpr seqan3::detail::align_config_id id {seqan3::detail::align_config_id::min_score}
    id {seqan3::detail::align_config_id::min_score}
     Internal id to check for consistent configuration settings.
     
    \n

    Detailed Description

    \n

    Sets the minimal score (maximal errors) allowed during an distance computation e.g. edit distance.

    \n

    This configuration can only be used for computing the edit distance. It restricts the number of substitutions, insertions, and deletions within the alignment to the given value and can thereby speed up the edit distance computation. A typical use case is to verify a candidate region during read mapping where the number of maximal errors is given beforehand. If this configuration is used for an alignment algorithm that does not compute the edit distance, a seqan3::invalid_alignment_configuration exception will be thrown.

    \n

    Example

    \n@@ -213,17 +213,17 @@\n
    \n
    \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1on__result.html", "unified_diff": "@@ -137,45 +137,45 @@\n
    \n
    [legend]
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::align_cfg::min_score::min_score constexpr seqan3::align_cfg::min_score::min_score (int32_t const int32_t const score)
    \n     		\n inlineconstexpr
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpron_result & \n \n \n \n+constexpron_result & \n \n \n \n+ \n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr on_result ()=default
    on_result ()=default
     Defaulted.
     
    \n-constexpr on_result (on_result const &)=default
    on_result (on_result const &)=default
     Defaulted.
     
    \n-constexpr on_result (on_result &&)=default
    on_result (on_result &&)=default
     Defaulted.
     
    \n-constexpr on_result & operator= (on_result const &)=default
    operator= (on_result const &)=default
     Defaulted.
     
    \n-constexpr on_result & operator= (on_result &&)=default
    operator= (on_result &&)=default
     Defaulted.
     
    \n- ~on_result ()=default
    ~on_result ()=default
     Defaulted.
     
    constexpr on_result (callback_t &&callback)
    constexpr on_result (callback_t &&callback)
     Constructs the configuration element with the given user callback.
     
    \n \n \n+seqan3::detail::copyable_wrapper_t< callback_t > \n \n \n

    \n Public Attributes

    \n-seqan3::detail::copyable_wrapper_t< callback_t > callback
    callback
     The stored callable which will be invoked with the alignment result.
     
    \n

    Detailed Description

    \n
    template<std::copy_constructible callback_t>
    \n class seqan3::align_cfg::on_result< callback_t >

    Configuration element to provide a user defined callback function for the alignment.

    \n
    Template Parameters
    \n@@ -192,21 +192,22 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_on_result.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    seqan3::align_cfg::on_result cfg{[](auto && result)
    \n+
    seqan3::align_cfg::on_result cfg{[](auto && result)
    \n
    {
    \n-
    seqan3::debug_stream << result << '\\n';
    \n+
    seqan3::debug_stream << result << '\\n';
    \n
    }};
    \n
    }
    \n
    align_config_on_result.hpp
    Provides seqan3::align_cfg::on_result.
    \n
    seqan3::align_cfg::on_result
    Configuration element to provide a user defined callback function for the alignment.
    Definition align_config_on_result.hpp:51
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n

    Constructor & Destructor Documentation

    \n \n

    ◆ on_result()

    \n \n
    \n@@ -214,17 +215,17 @@\n
    \n template<std::copy_constructible callback_t>
    \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__alignment.html", "unified_diff": "@@ -136,35 +136,35 @@\n
    \n
    [legend]
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::align_cfg::on_result< callback_t >::on_result constexpr seqan3::align_cfg::on_result< callback_t >::on_result (callback_t && callback_t && callback)
    \n     		\n inlineexplicitconstexpr
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexproutput_alignment & \n \n \n \n+constexproutput_alignment & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr output_alignment ()=default
    output_alignment ()=default
     Defaulted.
     
    \n-constexpr output_alignment (output_alignment const &)=default
    output_alignment (output_alignment const &)=default
     Defaulted.
     
    \n-constexpr output_alignment (output_alignment &&)=default
    output_alignment (output_alignment &&)=default
     Defaulted.
     
    \n-constexpr output_alignment & operator= (output_alignment const &)=default
    operator= (output_alignment const &)=default
     Defaulted.
     
    \n-constexpr output_alignment & operator= (output_alignment &&)=default
    operator= (output_alignment &&)=default
     Defaulted.
     
    \n- ~output_alignment ()=default
    ~output_alignment ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n

    Configures the alignment result to output the alignment.

    \n

    This option forces the alignment to compute and output the actual aligned sequences.

    \n

    If this option is not set in the alignment configuration, accessing the alignment via the seqan3::alignment_result object is forbidden and will lead to a compile time error.

    \n@@ -174,19 +174,20 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_output.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Compute only the alignment.
    \n-
    seqan3::configuration cfg = seqan3::align_cfg::output_alignment{};
    \n+
    seqan3::configuration cfg = seqan3::align_cfg::output_alignment{};
    \n
    }
    \n
    align_config_output.hpp
    Provides configuration for alignment output.
    \n
    seqan3::align_cfg::output_alignment
    Configures the alignment result to output the alignment.
    Definition align_config_output.hpp:168
    \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    See also
    seqan3::align_cfg::output_score
    \n
    \n seqan3::align_cfg::output_end_position
    \n
    \n seqan3::align_cfg::output_begin_position
    \n
    \n seqan3::align_cfg::output_sequence1_id
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__begin__position.html", "unified_diff": "@@ -136,35 +136,35 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexproutput_begin_position & \n \n \n \n+constexproutput_begin_position & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr output_begin_position ()=default
    output_begin_position ()=default
     Defaulted.
     
    \n-constexpr output_begin_position (output_begin_position const &)=default
    output_begin_position (output_begin_position const &)=default
     Defaulted.
     
    \n-constexpr output_begin_position (output_begin_position &&)=default
    output_begin_position (output_begin_position &&)=default
     Defaulted.
     
    \n-constexpr output_begin_position & operator= (output_begin_position const &)=default
    operator= (output_begin_position const &)=default
     Defaulted.
     
    \n-constexpr output_begin_position & operator= (output_begin_position &&)=default
    operator= (output_begin_position &&)=default
     Defaulted.
     
    \n- ~output_begin_position ()=default
    ~output_begin_position ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n

    Configures the alignment result to output the begin positions.

    \n

    This option forces the alignment to compute and output the begin positions of the aligned sequences. The begin positions must not be identical to the begin position of the original source sequences. For example, the optimal local alignment might only represent a slice of the original sequences. The begin positions denote the begin of the alignment within the original sequences, i.e. the positions of the first aligned characters.

    \n

    If this option is not set in the alignment configuration, accessing the begin positions via the seqan3::alignment_result object is forbidden and will lead to a compile time error.

    \n@@ -174,19 +174,20 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_output.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Compute only the begin position of the aligned sequences.
    \n-
    seqan3::configuration cfg = seqan3::align_cfg::output_begin_position{};
    \n+
    seqan3::configuration cfg = seqan3::align_cfg::output_begin_position{};
    \n
    }
    \n
    align_config_output.hpp
    Provides configuration for alignment output.
    \n
    seqan3::align_cfg::output_begin_position
    Configures the alignment result to output the begin positions.
    Definition align_config_output.hpp:128
    \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    See also
    seqan3::align_cfg::output_score
    \n
    \n seqan3::align_cfg::output_end_position
    \n
    \n seqan3::align_cfg::output_alignment
    \n
    \n seqan3::align_cfg::output_sequence1_id
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__end__position.html", "unified_diff": "@@ -136,35 +136,35 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexproutput_end_position & \n \n \n \n+constexproutput_end_position & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr output_end_position ()=default
    output_end_position ()=default
     Defaulted.
     
    \n-constexpr output_end_position (output_end_position const &)=default
    output_end_position (output_end_position const &)=default
     Defaulted.
     
    \n-constexpr output_end_position (output_end_position &&)=default
    output_end_position (output_end_position &&)=default
     Defaulted.
     
    \n-constexpr output_end_position & operator= (output_end_position const &)=default
    operator= (output_end_position const &)=default
     Defaulted.
     
    \n-constexpr output_end_position & operator= (output_end_position &&)=default
    operator= (output_end_position &&)=default
     Defaulted.
     
    \n- ~output_end_position ()=default
    ~output_end_position ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n

    Configures the alignment result to output the end position.

    \n

    This option forces the alignment to compute and output the end positions of the aligned sequences. The end positions must not be identical to the end of the original source sequences. For example, the optimal local alignment might only represent a slice of the original sequences. The end positions denote the end of the alignment within the original sequences, i.e. the positions behind the last aligned characters.

    \n

    If this option is not set in the alignment configuration, then accessing the end positions via the seqan3::alignment_result object is forbidden and will lead to a compile time error.

    \n@@ -174,19 +174,20 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_output.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Compute only the end position of the aligned sequences.
    \n-
    seqan3::configuration cfg = seqan3::align_cfg::output_end_position{};
    \n+
    seqan3::configuration cfg = seqan3::align_cfg::output_end_position{};
    \n
    }
    \n
    align_config_output.hpp
    Provides configuration for alignment output.
    \n
    seqan3::align_cfg::output_end_position
    Configures the alignment result to output the end position.
    Definition align_config_output.hpp:84
    \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    See also
    seqan3::align_cfg::output_score
    \n
    \n seqan3::align_cfg::output_begin_position
    \n
    \n seqan3::align_cfg::output_alignment
    \n
    \n seqan3::align_cfg::output_sequence1_id
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__score.html", "unified_diff": "@@ -136,35 +136,35 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexproutput_score & \n \n \n \n+constexproutput_score & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr output_score ()=default
    output_score ()=default
     Defaulted.
     
    \n-constexpr output_score (output_score const &)=default
    output_score (output_score const &)=default
     Defaulted.
     
    \n-constexpr output_score (output_score &&)=default
    output_score (output_score &&)=default
     Defaulted.
     
    \n-constexpr output_score & operator= (output_score const &)=default
    operator= (output_score const &)=default
     Defaulted.
     
    \n-constexpr output_score & operator= (output_score &&)=default
    operator= (output_score &&)=default
     Defaulted.
     
    \n- ~output_score ()=default
    ~output_score ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n

    Configures the alignment result to output the score.

    \n

    This option forces the alignment to compute and output the score. If this option is not set in the alignment configuration, accessing the score via the seqan3::alignment_result object is forbidden and will lead to a compile time error.

    \n

    Example

    \n@@ -173,19 +173,20 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_output.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Compute only the score.
    \n-
    seqan3::configuration cfg = seqan3::align_cfg::output_score{};
    \n+
    seqan3::configuration cfg = seqan3::align_cfg::output_score{};
    \n
    }
    \n
    align_config_output.hpp
    Provides configuration for alignment output.
    \n
    seqan3::align_cfg::output_score
    Configures the alignment result to output the score.
    Definition align_config_output.hpp:40
    \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    See also
    seqan3::align_cfg::output_end_position
    \n
    \n seqan3::align_cfg::output_begin_position
    \n
    \n seqan3::align_cfg::output_alignment
    \n
    \n seqan3::align_cfg::output_sequence1_id
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence1__id.html", "unified_diff": "@@ -136,35 +136,35 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexproutput_sequence1_id & \n \n \n \n+constexproutput_sequence1_id & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr output_sequence1_id ()=default
    output_sequence1_id ()=default
     Defaulted.
     
    \n-constexpr output_sequence1_id (output_sequence1_id const &)=default
    output_sequence1_id (output_sequence1_id const &)=default
     Defaulted.
     
    \n-constexpr output_sequence1_id (output_sequence1_id &&)=default
    output_sequence1_id (output_sequence1_id &&)=default
     Defaulted.
     
    \n-constexpr output_sequence1_id & operator= (output_sequence1_id const &)=default
    operator= (output_sequence1_id const &)=default
     Defaulted.
     
    \n-constexpr output_sequence1_id & operator= (output_sequence1_id &&)=default
    operator= (output_sequence1_id &&)=default
     Defaulted.
     
    \n- ~output_sequence1_id ()=default
    ~output_sequence1_id ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n

    Configures the alignment result to output the id of the first sequence.

    \n

    This option forces the alignment to output the id of the first sequence.

    \n

    If this option is not set in the alignment configuration, accessing the id of the first sequence via the seqan3::alignment_result object is forbidden and will lead to a compile time error.

    \n@@ -174,19 +174,20 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_output.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Output only the id of the first sequence.
    \n-
    seqan3::configuration cfg = seqan3::align_cfg::output_sequence1_id{};
    \n+
    seqan3::configuration cfg = seqan3::align_cfg::output_sequence1_id{};
    \n
    }
    \n
    align_config_output.hpp
    Provides configuration for alignment output.
    \n
    seqan3::align_cfg::output_sequence1_id
    Configures the alignment result to output the id of the first sequence.
    Definition align_config_output.hpp:208
    \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    See also
    seqan3::align_cfg::output_score
    \n
    \n seqan3::align_cfg::output_end_position
    \n
    \n seqan3::align_cfg::output_begin_position
    \n
    \n seqan3::align_cfg::output_alignment
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1output__sequence2__id.html", "unified_diff": "@@ -136,35 +136,35 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexproutput_sequence2_id & \n \n \n \n+constexproutput_sequence2_id & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr output_sequence2_id ()=default
    output_sequence2_id ()=default
     Defaulted.
     
    \n-constexpr output_sequence2_id (output_sequence2_id const &)=default
    output_sequence2_id (output_sequence2_id const &)=default
     Defaulted.
     
    \n-constexpr output_sequence2_id (output_sequence2_id &&)=default
    output_sequence2_id (output_sequence2_id &&)=default
     Defaulted.
     
    \n-constexpr output_sequence2_id & operator= (output_sequence2_id const &)=default
    operator= (output_sequence2_id const &)=default
     Defaulted.
     
    \n-constexpr output_sequence2_id & operator= (output_sequence2_id &&)=default
    operator= (output_sequence2_id &&)=default
     Defaulted.
     
    \n- ~output_sequence2_id ()=default
    ~output_sequence2_id ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n

    Configures the alignment result to output the id of the second sequence.

    \n

    This option forces the alignment to output the id of the second sequence.

    \n

    If this option is not set in the alignment configuration, accessing the id of the second sequence via the seqan3::alignment_result object is forbidden and will lead to a compile time error.

    \n@@ -174,19 +174,20 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alignment/configuration/align_config_output.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Output only the id of the second sequence.
    \n-
    seqan3::configuration cfg = seqan3::align_cfg::output_sequence2_id{};
    \n+
    seqan3::configuration cfg = seqan3::align_cfg::output_sequence2_id{};
    \n
    }
    \n
    align_config_output.hpp
    Provides configuration for alignment output.
    \n
    seqan3::align_cfg::output_sequence2_id
    Configures the alignment result to output the id of the second sequence.
    Definition align_config_output.hpp:247
    \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    See also
    seqan3::align_cfg::output_score
    \n
    \n seqan3::align_cfg::output_end_position
    \n
    \n seqan3::align_cfg::output_begin_position
    \n
    \n seqan3::align_cfg::output_alignment
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1align__cfg_1_1score__type.html", "unified_diff": "@@ -136,43 +136,43 @@\n
    \n
    \n
    [legend]
    \n \n \n \n+using \n \n \n

    \n Public Types

    \n-using type = score_t
    type = score_t
     The selected score type.
     
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprscore_type & \n \n \n \n+constexprscore_type & \n \n \n \n+ \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr score_type ()=default
    score_type ()=default
     Defaulted.
     
    \n-constexpr score_type (score_type const &)=default
    score_type (score_type const &)=default
     Defaulted.
     
    \n-constexpr score_type (score_type &&)=default
    score_type (score_type &&)=default
     Defaulted.
     
    \n-constexpr score_type & operator= (score_type const &)=default
    operator= (score_type const &)=default
     Defaulted.
     
    \n-constexpr score_type & operator= (score_type &&)=default
    operator= (score_type &&)=default
     Defaulted.
     
    \n- ~score_type ()=default
    ~score_type ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n
    template<arithmetic score_t>
    \n class seqan3::align_cfg::score_type< score_t >

    A configuration element to set the score type used in the alignment algorithm.

    \n
    Template Parameters
    \n@@ -189,21 +189,22 @@\n
    \n
    #include <seqan3/alignment/configuration/align_config_score_type.hpp>
    \n
    #include <seqan3/core/configuration/configuration.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Compute only the score.
    \n-
    seqan3::configuration cfg1 =
    \n+
    seqan3::configuration cfg1 =
    \n
    seqan3::align_cfg::score_type<int16_t>{}; // Now the alignment computes 16 bit integers.
    \n-
    seqan3::configuration cfg2 = seqan3::align_cfg::score_type<float>{}; // Now the alignment computes float scores.
    \n+
    seqan3::configuration cfg2 = seqan3::align_cfg::score_type<float>{}; // Now the alignment computes float scores.
    \n
    }
    \n
    align_config_score_type.hpp
    Provides alignment configuration seqan3::align_cfg::score_type.
    \n
    seqan3::align_cfg::score_type
    A configuration element to set the score type used in the alignment algorithm.
    Definition align_config_score_type.hpp:33
    \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    configuration.hpp
    Provides seqan3::configuration and utility functions.
    \n
    The documentation for this class was generated from the following file:\n \n \n
    The documentation for this class was generated from the following file:\n \n \n

    Will output something like:

    Item: 1 (0x55d5d0722f00, 128-byte aligned offset: 0)
    \n
    Item: 2 (0x55d5d0722f02, 128-byte aligned offset: 2)
    \n
    Item: 3 (0x55d5d0722f04, 128-byte aligned offset: 4)
    \n
    Item: 4 (0x55d5d0722f06, 128-byte aligned offset: 6)
    \n@@ -296,23 +297,23 @@\n

    Member Function Documentation

    \n \n

    ◆ allocate()

    \n \n
    \n
    \n
    \n-template<typename value_t , size_t alignment_v = __STDCPP_DEFAULT_NEW_ALIGNMENT__>
    \n+template<typename value_t , size_t alignment_v = __STDCPP_DEFAULT_NEW_ALIGNMENT__>
    \n \n \n \n \n@@ -346,29 +347,29 @@\n \n \n

    ◆ deallocate()

    \n \n
    \n
    \n
    \n-template<typename value_t , size_t alignment_v = __STDCPP_DEFAULT_NEW_ALIGNMENT__>
    \n+template<typename value_t , size_t alignment_v = __STDCPP_DEFAULT_NEW_ALIGNMENT__>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    pointer seqan3::aligned_allocator< value_t, alignment_v >::allocate pointer seqan3::aligned_allocator< value_t, alignment_v >::allocate (size_type const size_type const n) const
    \n     		\n inline
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alignment__result.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alignment__result.html", "unified_diff": "@@ -131,78 +131,78 @@\n

    #include <seqan3/alignment/pairwise/alignment_result.hpp>

    \n
    void seqan3::aligned_allocator< value_t, alignment_v >::deallocate void seqan3::aligned_allocator< value_t, alignment_v >::deallocate (pointer const pointer const p,
    size_type const size_type const n 
    ) const
    \n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Access functions

    Functions to access elements of the alignment result type.

    \n
    constexpr sequence1_id_t sequence1_id () const noexcept
    constexpr sequence1_id_t sequence1_id () const noexcept
     Returns the alignment identifier of the first sequence.
     
    constexpr sequence2_id_t sequence2_id () const noexcept
    constexpr sequence2_id_t sequence2_id () const noexcept
     Returns the alignment identifier of the second sequence.
     
    constexpr score_t score () const noexcept
    constexpr score_t score () const noexcept
     Returns the alignment score.
     
    constexpr auto sequence1_end_position () const noexcept
    constexpr auto sequence1_end_position () const noexcept
     Returns the end position of the first sequence of the alignment.
     
    constexpr auto sequence2_end_position () const noexcept
    constexpr auto sequence2_end_position () const noexcept
     Returns the end position of the second sequence of the alignment.
     
    constexpr auto sequence1_begin_position () const noexcept
    constexpr auto sequence1_begin_position () const noexcept
     Returns the begin position of the first sequence of the alignment.
     
    constexpr auto sequence2_begin_position () const noexcept
    constexpr auto sequence2_begin_position () const noexcept
     Returns the begin position of the second sequence of the alignment.
     
    constexpr alignment_t const & alignment () const noexcept
    constexpr alignment_t const & alignment () const noexcept
     Returns the actual alignment, i.e. the base pair matching.
     
    \n \n \n-\n+template<typename > \n+\n \n \n-\n+template<typenameconfiguration_t > \n+\n \n \n

    \n Friends

    \n-template<typename >
    struct alignment_result_printer
    struct alignment_result_printer
     
    \n-template<typename configuration_t >
    class detail::policy_alignment_result_builder
    class detail::policy_alignment_result_builder
     Befriend alignment result builder.
     
    \n \n-\n+\n \n \n+ \n \n \n \n+ \n \n \n \n+alignment_result & \n \n \n \n+alignment_result & \n \n \n \n+ \n \n \n

    Constructors, destructor and assignment

     alignment_result ()=default
     alignment_result ()=default
     
    \n- alignment_result (alignment_result const &)=default
    alignment_result (alignment_result const &)=default
     Defaulted.
     
    \n- alignment_result (alignment_result &&)=default
    alignment_result (alignment_result &&)=default
     Defaulted.
     
    \n-alignment_result & operator= (alignment_result const &)=default
    operator= (alignment_result const &)=default
     Defaulted.
     
    \n-alignment_result & operator= (alignment_result &&)=default
    operator= (alignment_result &&)=default
     Defaulted.
     
    \n- ~alignment_result ()=default
    ~alignment_result ()=default
     Defaulted.
     
    \n

    Detailed Description

    \n-
    template<typename alignment_result_value_t>
    \n-requires detail::is_type_specialisation_of_v<alignment_result_value_t, detail::alignment_result_value_type>
    \n+
    template<typename alignment_result_value_t>
    \n+requires detail::is_type_specialisation_of_v<alignment_result_value_t, detail::alignment_result_value_type>
    \n class seqan3::alignment_result< alignment_result_value_t >

    Stores the alignment results and gives access to score, alignment and the front and end positions.

    \n
    Template Parameters
    \n \n \n
    alignment_result_value_tThe underlying value type containing the information from the alignment computation.
    \n
    \n
    \n@@ -211,21 +211,21 @@\n

    Constructor & Destructor Documentation

    \n \n

    ◆ alignment_result()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    seqan3::alignment_result< alignment_result_value_t >::alignment_result seqan3::alignment_result< alignment_result_value_t >::alignment_result ()
    \n     		\n@@ -240,21 +240,21 @@\n

    Member Function Documentation

    \n \n

    ◆ alignment()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr alignment_t const & seqan3::alignment_result< alignment_result_value_t >::alignment constexpr alignment_t const & seqan3::alignment_result< alignment_result_value_t >::alignment () const
    \n     		\n@@ -271,21 +271,21 @@\n \n \n

    ◆ score()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr score_t seqan3::alignment_result< alignment_result_value_t >::score constexpr score_t seqan3::alignment_result< alignment_result_value_t >::score () const
    \n     		\n@@ -301,21 +301,21 @@\n \n \n

    ◆ sequence1_begin_position()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence1_begin_position constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence1_begin_position () const
    \n     		\n@@ -334,21 +334,21 @@\n \n \n

    ◆ sequence1_end_position()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence1_end_position constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence1_end_position () const
    \n     		\n@@ -366,21 +366,21 @@\n \n \n

    ◆ sequence1_id()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr sequence1_id_t seqan3::alignment_result< alignment_result_value_t >::sequence1_id constexpr sequence1_id_t seqan3::alignment_result< alignment_result_value_t >::sequence1_id () const
    \n     		\n@@ -396,21 +396,21 @@\n \n \n

    ◆ sequence2_begin_position()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence2_begin_position constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence2_begin_position () const
    \n     		\n@@ -429,21 +429,21 @@\n \n \n

    ◆ sequence2_end_position()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence2_end_position constexpr auto seqan3::alignment_result< alignment_result_value_t >::sequence2_end_position () const
    \n     		\n@@ -461,21 +461,21 @@\n \n \n

    ◆ sequence2_id()

    \n \n
    \n
    \n
    \n-template<typename alignment_result_value_t >
    \n+template<typename alignment_result_value_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr sequence2_id_t seqan3::alignment_result< alignment_result_value_t >::sequence2_id constexpr sequence2_id_t seqan3::alignment_result< alignment_result_value_t >::sequence2_id () const
    \n     		\n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__base.html", "unified_diff": "@@ -137,92 +137,92 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    Read functions
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    Write functions
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n-\n+\n \n \n

    \n Static Public Attributes

    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Protected Types

    Member types
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Friends

    Comparison operators
    constexpr bool operator== (derived_type const lhs, derived_type const rhs) noexcept
    constexpr bool operator== (derived_type const lhs, derived_type const rhs) noexcept
     Checks whether the letters lhs and rhs are equal.
     
    constexpr bool operator!= (derived_type const lhs, derived_type const rhs) noexcept
    constexpr bool operator!= (derived_type const lhs, derived_type const rhs) noexcept
     Checks whether the letters lhs and rhs are unequal.
     
    constexpr bool operator< (derived_type const lhs, derived_type const rhs) noexcept
    constexpr bool operator< (derived_type const lhs, derived_type const rhs) noexcept
     Checks whether the letter lhs is smaller than rhs.
     
    constexpr bool operator> (derived_type const lhs, derived_type const rhs) noexcept
    constexpr bool operator> (derived_type const lhs, derived_type const rhs) noexcept
     Checks whether the letter lhs is greater than rhs.
     
    constexpr bool operator<= (derived_type const lhs, derived_type const rhs) noexcept
    constexpr bool operator<= (derived_type const lhs, derived_type const rhs) noexcept
     Checks whether the letter lhs is smaller than or equal to rhs.
     
    constexpr bool operator>= (derived_type const lhs, derived_type const rhs) noexcept
    constexpr bool operator>= (derived_type const lhs, derived_type const rhs) noexcept
     Checks whether the letter lhs is bigger than or equal to rhs.
     
    \n

    Detailed Description

    \n-
    template<typename derived_type, size_t size, typename char_t = char>
    \n+
    template<typename derived_type, size_t size, typename char_t = char>
    \n class seqan3::alphabet_base< derived_type, size, char_t >

    A CRTP-base that makes defining a custom alphabet easier.

    \n
    Template Parameters
    \n \n \n \n \n
    derived_typeThe CRTP parameter type.
    sizeThe size of the alphabet.
    char_tThe character type of the alphabet (set this to void when defining just a seqan3::semialphabet).
    \n@@ -239,37 +239,37 @@\n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alphabet/alphabet_base.hpp>
    \n
    #include <seqan3/alphabet/concept.hpp>
    \n
    #include <seqan3/utility/char_operations/transform.hpp> // seqan3::to_lower
    \n
    \n-
    class ab : public seqan3::alphabet_base<ab, 2>
    \n+
    class ab : public seqan3::alphabet_base<ab, 2>
    \n
    {
    \n
    private:
    \n
    // make the base class a friend so it can access the tables:
    \n-
    friend alphabet_base<ab, 2>;
    \n+
    friend alphabet_base<ab, 2>;
    \n
    \n
    // This function is expected by seqan3::alphabet_base
    \n
    static constexpr char_type rank_to_char(rank_type const rank)
    \n
    {
    \n
    // via a lookup table
    \n
    return rank_to_char_table[rank];
    \n
    // or via an arithmetic expression
    \n
    return rank == 1 ? 'B' : 'A';
    \n
    }
    \n
    \n
    // This function is expected by seqan3::alphabet_base
    \n-
    static constexpr rank_type char_to_rank(char_type const chr)
    \n+
    static constexpr rank_type char_to_rank(char_type const chr)
    \n
    {
    \n
    // via a lookup table
    \n
    using index_t = std::make_unsigned_t<char_type>;
    \n-
    return char_to_rank_table[static_cast<index_t>(chr)];
    \n+
    return char_to_rank_table[static_cast<index_t>(chr)];
    \n
    // or via an arithmetic expression
    \n-
    return seqan3::to_lower(chr) == 'b' ? 1 : 0;
    \n+
    return seqan3::to_lower(chr) == 'b' ? 1 : 0;
    \n
    }
    \n
    \n
    private:
    \n
    // === lookup-table implementation detail ===
    \n
    \n
    // map 0 -> A and 1 -> B
    \n
    static constexpr std::array<char_type, alphabet_size> rank_to_char_table{'A', 'B'};
    \n@@ -286,41 +286,40 @@\n
    ret['B'] = 1;
    \n
    \n
    return ret;
    \n
    }()};
    \n
    };
    \n
    \n
    // The class ab satisfies the alphabet concept.
    \n-
    static_assert(seqan3::alphabet<ab>);
    \n-
    static_assert(seqan3::writable_alphabet<ab>);
    \n+
    static_assert(seqan3::alphabet<ab>);
    \n+
    static_assert(seqan3::writable_alphabet<ab>);
    \n
    concept.hpp
    Core alphabet concept and free function/type trait wrappers.
    \n
    alphabet_base.hpp
    Provides seqan3::alphabet_base.
    \n \n
    seqan3::alphabet_base
    A CRTP-base that makes defining a custom alphabet easier.
    Definition alphabet_base.hpp:54
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n \n-
    alphabet
    The generic alphabet concept that covers most data types used in ranges.
    \n-
    writable_alphabet
    Refines seqan3::alphabet and adds assignability.
    \n \n
    seqan3::to_lower
    constexpr char_type to_lower(char_type const c) noexcept
    Converts 'A'-'Z' to 'a'-'z' respectively; other characters are returned as is.
    Definition transform.hpp:74
    \n
    transform.hpp
    Provides utilities for modifying characters.
    \n

    This entity is stable. Since version 3.1.

    \n

    Member Typedef Documentation

    \n \n

    ◆ char_type

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using seqan3::alphabet_base< derived_type, size, char_t >::char_type = std::conditional_t<std::same_as<char_t, void>, char, char_t>using seqan3::alphabet_base< derived_type, size, char_t >::char_type = std::conditional_t<std::same_as<char_t, void>, char, char_t>
    \n     		\n protected
    \n@@ -335,21 +334,21 @@\n
    \n \n

    ◆ rank_type

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using seqan3::alphabet_base< derived_type, size, char_t >::rank_type = detail::min_viable_uint_t<size - 1>using seqan3::alphabet_base< derived_type, size, char_t >::rank_type = detail::min_viable_uint_t<size - 1>
    \n     		\n protected
    \n@@ -364,23 +363,23 @@\n

    Member Function Documentation

    \n \n

    ◆ assign_char()

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n \n \n \n \n@@ -406,23 +405,23 @@\n \n \n

    ◆ assign_rank()

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr derived_type & seqan3::alphabet_base< derived_type, size, char_t >::assign_char constexpr derived_type & seqan3::alphabet_base< derived_type, size, char_t >::assign_char (char_type const char_type const chr)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -448,21 +447,21 @@\n \n \n

    ◆ to_char()

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr derived_type & seqan3::alphabet_base< derived_type, size, char_t >::assign_rank constexpr derived_type & seqan3::alphabet_base< derived_type, size, char_t >::assign_rank (rank_type const rank_type const c)
    \n     		\n inlineconstexprnoexcept
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr char_type seqan3::alphabet_base< derived_type, size, char_t >::to_char constexpr char_type seqan3::alphabet_base< derived_type, size, char_t >::to_char () const
    \n     		\n@@ -483,21 +482,21 @@\n \n \n

    ◆ to_rank()

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr rank_type seqan3::alphabet_base< derived_type, size, char_t >::to_rank constexpr rank_type seqan3::alphabet_base< derived_type, size, char_t >::to_rank () const
    \n     		\n@@ -519,29 +518,29 @@\n

    Friends And Related Symbol Documentation

    \n \n

    ◆ operator!=

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -560,29 +559,29 @@\n \n \n

    ◆ operator<

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    constexpr bool operator!= constexpr bool operator!= (derived_type const derived_type const lhs,
    derived_type const derived_type const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -601,29 +600,29 @@\n \n \n

    ◆ operator<=

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    constexpr bool operator< constexpr bool operator< (derived_type const derived_type const lhs,
    derived_type const derived_type const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -642,29 +641,29 @@\n \n \n

    ◆ operator==

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    constexpr bool operator<= constexpr bool operator<= (derived_type const derived_type const lhs,
    derived_type const derived_type const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -683,29 +682,29 @@\n \n \n

    ◆ operator>

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    constexpr bool operator== constexpr bool operator== (derived_type const derived_type const lhs,
    derived_type const derived_type const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -724,29 +723,29 @@\n \n \n

    ◆ operator>=

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    constexpr bool operator> constexpr bool operator> (derived_type const derived_type const lhs,
    derived_type const derived_type const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -766,21 +765,21 @@\n

    Member Data Documentation

    \n \n

    ◆ alphabet_size

    \n \n
    \n
    \n
    \n-template<typename derived_type , size_t size, typename char_t = char>
    \n+template<typename derived_type , size_t size, typename char_t = char>
    \n
    constexpr bool operator>= constexpr bool operator>= (derived_type const derived_type const lhs,
    derived_type const derived_type const rhs 
    )
    \n \n \n \n \n
    \n \n \n- \n+ \n \n
    constexpr detail::min_viable_uint_t<size> seqan3::alphabet_base< derived_type, size, char_t >::alphabet_size = sizeconstexpr detail::min_viable_uint_t<size> seqan3::alphabet_base< derived_type, size, char_t >::alphabet_size = size
    \n     		\n staticconstexpr
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__proxy.html", "unified_diff": "@@ -139,93 +139,93 @@\n \n \n \n \n \n+constexpr derived_type & \n \n \n \n+constexpr derived_type & \n \n \n \n+constexpr derived_type & \n \n \n

    \n Public Member Functions

    Write functions

    All of these call the emulated type's write functions and then delegate to the assignment operator which invokes derived behaviour.

    \n
    \n-constexpr derived_type & assign_rank (alphabet_rank_t< alphabet_type > const r) noexcept
    assign_rank (alphabet_rank_t< alphabet_type > const r) noexcept
     Assigns a rank.
     
    \n-constexpr derived_type & assign_char (char_type const c) noexcept
    assign_char (char_type const c) noexcept
     Assigns a character.
     
    \n-constexpr derived_type & assign_phred (phred_type const c) noexcept
    assign_phred (phred_type const c) noexcept
     Assigns a Phred score.
     
    \n \n \n+staticconstexprauto \n \n \n

    \n Static Public Attributes

    \n-static constexpr auto alphabet_size = seqan3::alphabet_size<alphabet_type>
    alphabet_size = seqan3::alphabet_size<alphabet_type>
     The alphabet size.
     
    \n \n \n \n-\n+template<typename t > \n+\n \n \n \n-\n+template<typename t > \n+\n \n \n \n-\n+template<typename t > \n+\n \n \n \n-\n+template<typename t > \n+\n \n \n

    Comparison operators

    These are only required if the emulated type allows comparison with types it is not convertible to, e.g. seqan3::alphabet_variant.

    \n
    \n-template<typename t >
    constexpr auto operator== (derived_type const lhs, t const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
    constexpr auto operator== (derived_type const lhs, t const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
     Allow (in-)equality comparison with types that the emulated type is comparable with.
     
    \n-template<typename t >
    constexpr auto operator== (t const lhs, derived_type const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
    constexpr auto operator== (t const lhs, derived_type const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
     Allow (in-)equality comparison with types that the emulated type is comparable with.
     
    \n-template<typename t >
    constexpr auto operator!= (derived_type const lhs, t const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
    constexpr auto operator!= (derived_type const lhs, t const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
     Allow (in-)equality comparison with types that the emulated type is comparable with.
     
    \n-template<typename t >
    constexpr auto operator!= (t const lhs, derived_type const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
    constexpr auto operator!= (t const lhs, derived_type const rhs) noexcept -> std::enable_if_t< is_alphabet_comparable_with< t >, bool >
     Allow (in-)equality comparison with types that the emulated type is comparable with.
     
    \n \n \n \n+constexpr \n \n \n \n-\n+template<typenameother_t >
    \n+requires (!std::is_class_v<alphabet_type>) && std::convertible_to<alphabet_type, other_t>\n+\n \n \n \n+constexprauto \n \n \n \n+constexprauto \n \n \n \n+constexprauto \n \n \n \n+constexpr alphabet_type \n \n \n \n+staticconstexprbool \n \n \n

    Read functions

    All of these call the emulated type's read functions.

    \n
    \n-constexpr operator alphabet_type () const noexcept
    operator alphabet_type () const noexcept
     Implicit conversion to the emulated type.
     
    \n-template<typename other_t >
    \n-requires (!std::is_class_v<alphabet_type>) && std::convertible_to<alphabet_type, other_t>
    constexpr operator other_t () const noexcept
    constexpr operator other_t () const noexcept
     Implicit conversion to types that the emulated type is convertible to.
     
    \n-constexpr auto to_rank () const noexcept
    to_rank () const noexcept
     Returns the rank.
     
    \n-constexpr auto to_char () const noexcept
    to_char () const noexcept
     Returns the character.
     
    \n-constexpr auto to_phred () const noexcept
    to_phred () const noexcept
     Returns the Phred score.
     
    \n-constexpr alphabet_type complement () const noexcept
    complement () const noexcept
     Returns the complement.
     
    \n-static constexpr bool char_is_valid (char_type const c) noexcept
    char_is_valid (char_type const c) noexcept
     Delegate to the emulated type's validator.
     
    \n

    Detailed Description

    \n-
    template<typename derived_type, writable_semialphabet alphabet_type>
    \n+
    template<typename derived_type, writable_semialphabet alphabet_type>
    \n requires std::regular<alphabet_type>
    \n class seqan3::alphabet_proxy< derived_type, alphabet_type >

    A CRTP-base that eases the definition of proxy types returned in place of regular alphabets.

    \n
    Template Parameters
    \n \n \n \n
    derived_typeThe CRTP parameter type.
    alphabet_typeThe type of the alphabet that this proxy emulates; must model at least seqan3::writable_semialphabet and std::regular.
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__tuple__base.html", "unified_diff": "@@ -138,173 +138,173 @@\n
    [legend]
    \n \n \n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n \n

    \n Friends

    Comparison operators (against indirect component_list)

    These overloads enable comparison for all types that a component type is comparable with.

    \n
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator== (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator== (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator== (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator== (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator!= (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator!= (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator!= (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator!= (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_eq_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator< (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator< (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator< (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator< (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator<= (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator<= (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator<= (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator<= (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator> (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator> (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator> (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator> (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator>= (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator>= (derived_type_t const lhs, indirect_component_type const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator>= (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
    template<typename derived_type_t , typename indirect_component_type >
    constexpr auto operator>= (indirect_component_type const lhs, derived_type_t const rhs) noexcept -> std::enable_if_t< detail::tuple_order_guard< derived_type_t, derived_type, indirect_component_type, component_types... >, bool >
     Comparison against types comparable with components.
     
    Comparison operators
    \n \n \n \n+constexpr \n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n

    Constructors, destructor and assignment

    Attention
    Please do not directly use the CRTP base class. The functions are only public for the usage in their derived classes (e.g. seqan3::qualified, seqan3::masked, seqan3::structure_rna and seqan3::structure_aa).
    \n
    \n-constexpr alphabet_tuple_base (component_types... components) noexcept
    alphabet_tuple_base (component_types... components) noexcept
     Construction from initialiser-list.
     
    template<typename component_type >
    \n-requires (!std::is_base_of_v<alphabet_tuple_base, component_type>) && is_unique_component<component_type>
    constexpr alphabet_tuple_base (component_type const alph) noexcept
    template<typename component_type >
    \n+requires (!std::is_base_of_v<alphabet_tuple_base, component_type>) && is_unique_component<component_type>
    constexpr alphabet_tuple_base (component_type const alph) noexcept
     Construction via a value of one of the components.
     
    template<typename indirect_component_type >
    \n-requires ((detail::instantiate_if_v< detail::lazy<std::is_convertible, indirect_component_type, component_types>, detail::tuple_general_guard<derived_type, indirect_component_type, component_types...>> || ...))
    constexpr alphabet_tuple_base (indirect_component_type const alph) noexcept
    template<typename indirect_component_type >
    \n+requires ((detail::instantiate_if_v< detail::lazy<std::is_convertible, indirect_component_type, component_types>, detail::tuple_general_guard<derived_type, indirect_component_type, component_types...>> || ...))
    constexpr alphabet_tuple_base (indirect_component_type const alph) noexcept
     Construction via a value of a subtype that is assignable to one of the components.
     
    template<typename component_type >
    \n-requires (!std::derived_from<component_type, alphabet_tuple_base>) && is_unique_component<component_type>
    constexpr derived_type & operator= (component_type const alph) noexcept
    template<typename component_type >
    \n+requires (!std::derived_from<component_type, alphabet_tuple_base>) && is_unique_component<component_type>
    constexpr derived_type & operator= (component_type const alph) noexcept
     Assignment via a value of one of the components.
     
    template<typename indirect_component_type >
    \n-requires ((!std::derived_from<indirect_component_type, alphabet_tuple_base>) && (!is_unique_component<indirect_component_type>) && (std::assignable_from<component_types, indirect_component_type> || ...))
    constexpr derived_type & operator= (indirect_component_type const alph) noexcept
    template<typename indirect_component_type >
    \n+requires ((!std::derived_from<indirect_component_type, alphabet_tuple_base>) && (!is_unique_component<indirect_component_type>) && (std::assignable_from<component_types, indirect_component_type> || ...))
    constexpr derived_type & operator= (indirect_component_type const alph) noexcept
     Assignment via a value of a subtype that is assignable to one of the components.
     
    \n \n \n-\n-\n+\n \n \n \n-\n+\n \n \n-\n-\n+\n \n \n \n-\n+\n \n \n-\n-\n+\n \n \n

    Read functions

    All read operations are constant complexity.

    \n
    template<typename type >
    \n+
    template<typename type >
    \n requires is_unique_component<type>
    constexpr operator type () const noexcept
    constexpr operator type () const noexcept
     Implicit cast to a single letter. Works only if the type is unique in the type list.
     
    template<size_t index>
    constexpr auto get (alphabet_tuple_base &l) noexcept
    constexpr auto get (alphabet_tuple_base &l) noexcept
     Tuple-like access to the contained components.
     
    template<typename type >
    \n+
    template<typename type >
    \n requires is_unique_component<type>
    constexpr auto get (alphabet_tuple_base &l) noexcept
    constexpr auto get (alphabet_tuple_base &l) noexcept
     Tuple-like access to the contained components.
     
    template<size_t index>
    constexpr auto get (alphabet_tuple_base const &l) noexcept
    constexpr auto get (alphabet_tuple_base const &l) noexcept
     Tuple-like access to the contained components.
     
    template<typename type >
    \n+
    template<typename type >
    \n requires is_unique_component<type>
    constexpr type get (alphabet_tuple_base const &l) noexcept
    constexpr type get (alphabet_tuple_base const &l) noexcept
     Tuple-like access to the contained components.
     
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type,(1 *... *alphabet_size< component_types >), void >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type,(1 *... *alphabet_size< component_types >), void >
    static constexpr detail::min_viable_uint_t< size > alphabet_size
    static constexpr detail::min_viable_uint_t< size > alphabet_size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type,(1 *... *alphabet_size< component_types >), void >
    using char_type = std::conditional_t< std::same_as< void, void >, char, void >
    using char_type = std::conditional_t< std::same_as< void, void >, char, void >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n-
    template<typename derived_type, typename... component_types>
    \n-requires (detail::writable_constexpr_semialphabet<component_types> && ...) && (std::regular<component_types> && ...)
    \n+
    template<typename derived_type, typename... component_types>
    \n+requires (detail::writable_constexpr_semialphabet<component_types> && ...) && (std::regular<component_types> && ...)
    \n class seqan3::alphabet_tuple_base< derived_type, component_types >

    The CRTP base for a combined alphabet that contains multiple values of different alphabets at the same time.

    \n

    .

    \n
    Template Parameters
    \n \n \n
    component_typesTypes of letters; must model std::regular and seqan3::writable_semialphabet and all required function calls need to be callable in constexpr-context.
    \n
    \n@@ -326,26 +326,26 @@\n

    Constructor & Destructor Documentation

    \n \n

    ◆ alphabet_tuple_base() [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename component_type >
    \n-requires (!std::is_base_of_v<alphabet_tuple_base, component_type>) && is_unique_component<component_type>
    \n+template<typename component_type >
    \n+requires (!std::is_base_of_v<alphabet_tuple_base, component_type>) && is_unique_component<component_type>
    \n \n \n \n \n@@ -375,21 +375,21 @@\n
    #include <seqan3/alphabet/quality/qualified.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'C'_dna4}; // creates {'C'_dna4, '!'_phred42}
    \n-
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter2{'"'_phred42}; // creates {'A'_dna4, '"'_phred42}
    \n+
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'C'_dna4}; // creates {'C'_dna4, '!'_phred42}
    \n+
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter2{'"'_phred42}; // creates {'A'_dna4, '"'_phred42}
    \n
    \n-
    if (letter1 == letter2)
    \n+
    if (letter1 == letter2)
    \n
    seqan3::debug_stream << "yeah\\n"; // yeah
    \n
    }
    \n-
    seqan3::qualified
    Joins an arbitrary alphabet with a quality alphabet.
    Definition qualified.hpp:59
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna4.hpp
    Provides seqan3::dna4, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n
    phred42.hpp
    Provides seqan3::phred42 quality scores.
    \n
    qualified.hpp
    Provides quality alphabet composites.
    \n

    This entity is stable. Since version 3.1.

    \n@@ -398,26 +398,26 @@\n \n \n

    ◆ alphabet_tuple_base() [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename indirect_component_type >
    \n-requires ((detail::instantiate_if_v< detail::lazy<std::is_convertible, indirect_component_type, component_types>, detail::tuple_general_guard<derived_type, indirect_component_type, component_types...>> || ...))
    \n+template<typename indirect_component_type >
    \n+requires ((detail::instantiate_if_v< detail::lazy<std::is_convertible, indirect_component_type, component_types>, detail::tuple_general_guard<derived_type, indirect_component_type, component_types...>> || ...))
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::alphabet_tuple_base< derived_type, component_types >::alphabet_tuple_base constexpr seqan3::alphabet_tuple_base< derived_type, component_types >::alphabet_tuple_base (component_type const component_type const alph)
    \n     		\n inlineexplicitconstexprnoexcept
    \n \n \n \n@@ -449,43 +449,43 @@\n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    // The following creates {'C'_dna4, '!'_phred42}
    \n-
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'C'_dna4};
    \n+
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'C'_dna4};
    \n
    // The following also creates {'C'_dna4, '!'_phred42}, since rna4 assignable to dna4
    \n-
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter2{'C'_rna4};
    \n+
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter2{'C'_rna4};
    \n
    \n-
    if (letter1 == letter2)
    \n+
    if (letter1 == letter2)
    \n
    seqan3::debug_stream << "yeah\\n"; // yeah
    \n
    }
    \n
    all.hpp
    Meta-header for the Alphabet / Nucleotide submodule .
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n \n \n

    Member Function Documentation

    \n \n

    ◆ operator type()

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename type >
    \n+template<typename type >
    \n requires is_unique_component<type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::alphabet_tuple_base< derived_type, component_types >::alphabet_tuple_base constexpr seqan3::alphabet_tuple_base< derived_type, component_types >::alphabet_tuple_base (indirect_component_type const indirect_component_type const alph)
    \n     		\n inlineexplicitconstexprnoexcept
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr seqan3::alphabet_tuple_base< derived_type, component_types >::operator type constexpr seqan3::alphabet_tuple_base< derived_type, component_types >::operator type () const
    \n     		\n@@ -501,26 +501,26 @@\n \n \n

    ◆ operator=() [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename component_type >
    \n-requires (!std::derived_from<component_type, alphabet_tuple_base>) && is_unique_component<component_type>
    \n+template<typename component_type >
    \n+requires (!std::derived_from<component_type, alphabet_tuple_base>) && is_unique_component<component_type>
    \n \n \n \n \n@@ -549,41 +549,41 @@\n
    #include <seqan3/alphabet/quality/phred42.hpp>
    \n
    #include <seqan3/alphabet/quality/qualified.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'T'_dna4, '"'_phred42};
    \n+
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'T'_dna4, '"'_phred42};
    \n
    \n-
    letter1 = 'C'_dna4; // yields {'C'_dna4, '"'_phred42}
    \n-
    letter1 = '#'_phred42; // yields {'C'_dna4, '#'_phred42}
    \n+
    letter1 = 'C'_dna4; // yields {'C'_dna4, '"'_phred42}
    \n+
    letter1 = '#'_phred42; // yields {'C'_dna4, '#'_phred42}
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n \n

    ◆ operator=() [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename indirect_component_type >
    \n-requires ((!std::derived_from<indirect_component_type, alphabet_tuple_base>) && (!is_unique_component<indirect_component_type>) && (std::assignable_from<component_types, indirect_component_type> || ...))
    \n+template<typename indirect_component_type >
    \n+requires ((!std::derived_from<indirect_component_type, alphabet_tuple_base>) && (!is_unique_component<indirect_component_type>) && (std::assignable_from<component_types, indirect_component_type> || ...))
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr derived_type & seqan3::alphabet_tuple_base< derived_type, component_types >::operator= constexpr derived_type & seqan3::alphabet_tuple_base< derived_type, component_types >::operator= (component_type const component_type const alph)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -612,40 +612,40 @@\n
    #include <seqan3/alphabet/quality/phred42.hpp>
    \n
    #include <seqan3/alphabet/quality/qualified.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'T'_dna4, '"'_phred42};
    \n+
    seqan3::qualified<seqan3::dna4, seqan3::phred42> letter1{'T'_dna4, '"'_phred42};
    \n
    \n-
    letter1 = 'C'_rna4; // yields {'C'_dna4, '"'_phred42}
    \n+
    letter1 = 'C'_rna4; // yields {'C'_dna4, '"'_phred42}
    \n
    }
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n \n \n

    Friends And Related Symbol Documentation

    \n \n

    ◆ get [1/4]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n template<size_t index>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr derived_type & seqan3::alphabet_tuple_base< derived_type, component_types >::operator= constexpr derived_type & seqan3::alphabet_tuple_base< derived_type, component_types >::operator= (indirect_component_type const indirect_component_type const alph)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -667,26 +667,26 @@\n \n \n

    ◆ get [2/4]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename type >
    \n+template<typename type >
    \n requires is_unique_component<type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr auto get constexpr auto get (alphabet_tuple_base< derived_type, component_types > & alphabet_tuple_base< derived_type, component_types > & l)
    \n     		\n friend
    \n \n \n \n@@ -708,25 +708,25 @@\n \n \n

    ◆ get [3/4]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n template<size_t index>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr auto get constexpr auto get (alphabet_tuple_base< derived_type, component_types > & alphabet_tuple_base< derived_type, component_types > & l)
    \n     		\n friend
    \n \n \n \n@@ -748,26 +748,26 @@\n \n \n

    ◆ get [4/4]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename type >
    \n+template<typename type >
    \n requires is_unique_component<type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr auto get constexpr auto get (alphabet_tuple_base< derived_type, component_types > const & alphabet_tuple_base< derived_type, component_types > const & l)
    \n     		\n friend
    \n \n \n \n@@ -789,39 +789,39 @@\n \n \n

    ◆ operator!= [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr type get constexpr type get (alphabet_tuple_base< derived_type, component_types > const & alphabet_tuple_base< derived_type, component_types > const & l)
    \n     		\n friend
    \n \n \n \n \n@@ -850,39 +850,39 @@\n \n \n

    ◆ operator!= [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator!= constexpr auto operator!= (derived_type_t const derived_type_t const lhs,
    indirect_component_type const indirect_component_type const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -911,39 +911,39 @@\n \n \n

    ◆ operator< [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator!= constexpr auto operator!= (indirect_component_type const indirect_component_type const lhs,
    derived_type_t const derived_type_t const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -972,39 +972,39 @@\n \n \n

    ◆ operator< [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator< constexpr auto operator< (derived_type_t const derived_type_t const lhs,
    indirect_component_type const indirect_component_type const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1033,39 +1033,39 @@\n \n \n

    ◆ operator<= [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator< constexpr auto operator< (indirect_component_type const indirect_component_type const lhs,
    derived_type_t const derived_type_t const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1094,39 +1094,39 @@\n \n \n

    ◆ operator<= [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator<= constexpr auto operator<= (derived_type_t const derived_type_t const lhs,
    indirect_component_type const indirect_component_type const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1155,39 +1155,39 @@\n \n \n

    ◆ operator== [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator<= constexpr auto operator<= (indirect_component_type const indirect_component_type const lhs,
    derived_type_t const derived_type_t const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1216,39 +1216,39 @@\n \n \n

    ◆ operator== [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator== constexpr auto operator== (derived_type_t const derived_type_t const lhs,
    indirect_component_type const indirect_component_type const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1277,39 +1277,39 @@\n \n \n

    ◆ operator> [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator== constexpr auto operator== (indirect_component_type const indirect_component_type const lhs,
    derived_type_t const derived_type_t const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_eq_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1338,39 +1338,39 @@\n \n \n

    ◆ operator> [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator> constexpr auto operator> (derived_type_t const derived_type_t const lhs,
    indirect_component_type const indirect_component_type const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1399,39 +1399,39 @@\n \n \n

    ◆ operator>= [1/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator> constexpr auto operator> (indirect_component_type const indirect_component_type const lhs,
    derived_type_t const derived_type_t const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n@@ -1460,39 +1460,39 @@\n \n \n

    ◆ operator>= [2/2]

    \n \n
    \n
    \n
    \n-template<typename derived_type , typename... component_types>
    \n+template<typename derived_type , typename... component_types>
    \n
    \n-template<typename derived_type_t , typename indirect_component_type >
    \n+template<typename derived_type_t , typename indirect_component_type >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator>= constexpr auto operator>= (derived_type_t const derived_type_t const lhs,
    indirect_component_type const indirect_component_type const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1alphabet__variant.html", "unified_diff": "@@ -137,178 +137,178 @@\n
    \n
    [legend]
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n
    constexpr auto operator>= constexpr auto operator>= (indirect_component_type const indirect_component_type const lhs,
    derived_type_t const derived_type_t const rhs 
    ) -> std::enable_if_t<\n- detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n- bool>\n+ detail::tuple_order_guard<derived_type_t, derived_type, indirect_component_type, component_types...>,\n+ bool>\n
    \n     		\n friend
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_variant & \n \n \n \n+constexpralphabet_variant & \n \n \n \n+ \n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr alphabet_variant () noexcept=default
    alphabet_variant () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_variant (alphabet_variant const &) noexcept=default
    alphabet_variant (alphabet_variant const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_variant (alphabet_variant &&) noexcept=default
    alphabet_variant (alphabet_variant &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_variant & operator= (alphabet_variant const &) noexcept=default
    operator= (alphabet_variant const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_variant & operator= (alphabet_variant &&) noexcept=default
    operator= (alphabet_variant &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_variant () noexcept=default
    ~alphabet_variant () noexcept=default
     Defaulted.
     
    template<typename alternative_t >
    \n-requires (!std::same_as<alternative_t, alphabet_variant>) && (!detail::is_span<alternative_t>::value) && (!std::is_base_of_v<alphabet_variant, alternative_t>) && (!list_traits::contains< alphabet_variant, detail::transformation_trait_or_t<detail::recursive_required_types<alternative_t>, type_list<>>>) && (is_alternative<alternative_t>())
    constexpr alphabet_variant (alternative_t const alternative) noexcept
    template<typename alternative_t >
    \n+requires (!std::same_as<alternative_t, alphabet_variant>) && (!detail::is_span<alternative_t>::value) && (!std::is_base_of_v<alphabet_variant, alternative_t>) && (!list_traits::contains< alphabet_variant, detail::transformation_trait_or_t<detail::recursive_required_types<alternative_t>, type_list<>>>) && (is_alternative<alternative_t>())
    constexpr alphabet_variant (alternative_t const alternative) noexcept
     Construction via the value of an alternative.
     
    template<typename indirect_alternative_t >
    \n-requires (!detail::is_span<indirect_alternative_t>::value) && (( detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    constexpr alphabet_variant (indirect_alternative_t const rhs) noexcept
    template<typename indirect_alternative_t >
    \n+requires (!detail::is_span<indirect_alternative_t>::value) && (( detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    constexpr alphabet_variant (indirect_alternative_t const rhs) noexcept
     Constructor for arguments implicitly convertible to an alternative.
     
    template<typename indirect_alternative_t >
    \n-requires ( (!(detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...)) && (detail::instantiate_if_v<detail::lazy<std::is_constructible, alternative_types, indirect_alternative_t>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    constexpr alphabet_variant (indirect_alternative_t const rhs) noexcept
    template<typename indirect_alternative_t >
    \n+requires ( (!(detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...)) && (detail::instantiate_if_v<detail::lazy<std::is_constructible, alternative_types, indirect_alternative_t>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    constexpr alphabet_variant (indirect_alternative_t const rhs) noexcept
     Constructor for arguments explicitly (but not implicitly) convertible to an alternative.
     
    template<typename indirect_alternative_t >
    \n-requires (detail::variant_general_guard<indirect_alternative_t, alternative_types...> && (weakly_assignable_from<alternative_types, indirect_alternative_t> || ...))
    constexpr alphabet_variant & operator= (indirect_alternative_t const &rhs) noexcept
    template<typename indirect_alternative_t >
    \n+requires (detail::variant_general_guard<indirect_alternative_t, alternative_types...> && (weakly_assignable_from<alternative_types, indirect_alternative_t> || ...))
    constexpr alphabet_variant & operator= (indirect_alternative_t const &rhs) noexcept
     Assignment for arguments assignable to an alternative.
     
    Conversion (by index)
    template<size_t index>
    constexpr bool holds_alternative () const noexcept
    constexpr bool holds_alternative () const noexcept
     Whether the variant alphabet currently holds a value of the given alternative.
     
    template<size_t index>
    constexpr auto convert_to () const
    constexpr auto convert_to () const
     Convert to the specified alphabet (throws if holds_alternative() would be false).
     
    template<size_t index>
    constexpr auto convert_unsafely_to () const noexcept
    constexpr auto convert_unsafely_to () const noexcept
     Convert to the specified alphabet (undefined behaviour if holds_alternative() would be false).
     
    Conversion (by type)
    template<typename alternative_t >
    \n-requires (is_alternative<alternative_t>())
    constexpr bool holds_alternative () const noexcept
    template<typename alternative_t >
    \n+requires (is_alternative<alternative_t>())
    constexpr bool holds_alternative () const noexcept
     Whether the variant alphabet currently holds a value of the given alternative.
     
    template<typename alternative_t >
    \n-requires (is_alternative<alternative_t>())
    constexpr alternative_t convert_to () const
    template<typename alternative_t >
    \n+requires (is_alternative<alternative_t>())
    constexpr alternative_t convert_to () const
     Convert to the specified alphabet (throws if holds_alternative() would be false).
     
    template<typename alternative_t >
    \n-requires (is_alternative<alternative_t>())
    constexpr alternative_t convert_unsafely_to () const noexcept
    template<typename alternative_t >
    \n+requires (is_alternative<alternative_t>())
    constexpr alternative_t convert_unsafely_to () const noexcept
     Convert to the specified alphabet (undefined behaviour if holds_alternative() would be false).
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< alphabet_variant< alternative_types... >,(static_cast< size_t >(alphabet_size< alternative_types >)+...), char >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr alphabet_variant< alternative_types... > & assign_char (char_type const chr) noexcept
    constexpr alphabet_variant< alternative_types... > & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr alphabet_variant< alternative_types... > & assign_rank (rank_type const c) noexcept
    constexpr alphabet_variant< alternative_types... > & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n

    \n Static Public Member Functions

    static constexpr bool char_is_valid (char_type const chr) noexcept
    static constexpr bool char_is_valid (char_type const chr) noexcept
     Validate whether a character is valid in the combined alphabet.
     
    template<typename alternative_t >
    static constexpr bool is_alternative () noexcept
    template<typename alternative_t >
    static constexpr bool is_alternative () noexcept
     Returns true if alternative_t is one of the given alternative types.
     
    \n \n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n \n

    \n Friends

    Comparison operators (against indirect alternatives)

    Defines comparison against types that are not subject to implicit construction/conversion but are comparable against alternatives, e.g. alphabet_variant<seqan3::rna4, seqan3::gap> vs alphabet_variant<seqan3::dna4, seqan3::gap>. Only (in-)equality comparison is defined as reasoning about order of variants is inherently difficult.

    \n
    template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    constexpr bool operator== (alphabet_variant_t const lhs, indirect_alternative_type const rhs) noexcept
    template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    constexpr bool operator== (alphabet_variant_t const lhs, indirect_alternative_type const rhs) noexcept
     (In-)Equality comparison against types comparable with alternatives but not convertible to the variant.
     
    template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    constexpr bool operator!= (alphabet_variant_t const lhs, indirect_alternative_type const rhs) noexcept
    template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    constexpr bool operator!= (alphabet_variant_t const lhs, indirect_alternative_type const rhs) noexcept
     (In-)Equality comparison against types comparable with alternatives but not convertible to the variant.
     
    template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    constexpr bool operator== (indirect_alternative_type const lhs, alphabet_variant_t const rhs) noexcept
    template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    constexpr bool operator== (indirect_alternative_type const lhs, alphabet_variant_t const rhs) noexcept
     (In-)Equality comparison against types comparable with alternatives but not convertible to the variant.
     
    template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    constexpr bool operator!= (indirect_alternative_type const lhs, alphabet_variant_t const rhs) noexcept
    template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    constexpr bool operator!= (indirect_alternative_type const lhs, alphabet_variant_t const rhs) noexcept
     (In-)Equality comparison against types comparable with alternatives but not convertible to the variant.
     
    Comparison operators
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< alphabet_variant< alternative_types... >,(static_cast< size_t >(alphabet_size< alternative_types >)+...), char >
    static constexpr detail::min_viable_uint_t< size > alphabet_size
    static constexpr detail::min_viable_uint_t< size > alphabet_size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< alphabet_variant< alternative_types... >,(static_cast< size_t >(alphabet_size< alternative_types >)+...), char >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n
    template<typename... alternative_types>
    \n-requires (detail::writable_constexpr_alphabet<alternative_types> && ...) && (std::regular<alternative_types> && ...) && (sizeof...(alternative_types) >= 2)
    \n+requires (detail::writable_constexpr_alphabet<alternative_types> && ...) && (std::regular<alternative_types> && ...) && (sizeof...(alternative_types) >= 2)
    \n class seqan3::alphabet_variant< alternative_types >

    A combined alphabet that can hold values of either of its alternatives.

    \n

    .

    \n
    Template Parameters
    \n \n \n
    ...alternative_typesTypes of possible values (at least 2); all must model seqan3::writable_alphabet, std::regular and must be unique; all required functions for seqan3::writable_alphabet need to be callable in a constexpr-context.
    \n
    \n@@ -331,33 +331,32 @@\n
    #include <seqan3/alphabet/gap/gap.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::alphabet_variant<seqan3::dna5, seqan3::gap> letter{}; // implicitly 'A'_dna5
    \n-
    seqan3::alphabet_variant<seqan3::dna5, seqan3::gap> letter2{'C'_dna5}; // constructed from alternative (== 'C'_dna5)
    \n-
    seqan3::alphabet_variant<seqan3::dna5, seqan3::gap> letter3{
    \n-
    'U'_rna5}; // constructed from type that alternative is constructible from (== 'T'_dna5)
    \n-
    \n-
    letter2.assign_char('T'); // == 'T'_dna5
    \n-
    letter2.assign_char('-'); // == gap{}
    \n-
    letter2.assign_char('K'); // unknown characters map to the default/unknown
    \n+
    seqan3::alphabet_variant<seqan3::dna5, seqan3::gap> letter{}; // implicitly 'A'_dna5
    \n+
    seqan3::alphabet_variant<seqan3::dna5, seqan3::gap> letter2{'C'_dna5}; // constructed from alternative (== 'C'_dna5)
    \n+
    seqan3::alphabet_variant<seqan3::dna5, seqan3::gap> letter3{
    \n+
    'U'_rna5}; // constructed from type that alternative is constructible from (== 'T'_dna5)
    \n+
    \n+
    letter2.assign_char('T'); // == 'T'_dna5
    \n+
    letter2.assign_char('-'); // == gap{}
    \n+
    letter2.assign_char('K'); // unknown characters map to the default/unknown
    \n
    // character of the first alternative type (== 'N'_dna5)
    \n
    \n-
    letter2 = seqan3::gap{}; // assigned from alternative (== gap{})
    \n-
    letter2 = 'U'_rna5; // assigned from type that alternative is assignable from (== 'T'_dna5)
    \n+
    letter2 = seqan3::gap{}; // assigned from alternative (== gap{})
    \n+
    letter2 = 'U'_rna5; // assigned from type that alternative is assignable from (== 'T'_dna5)
    \n
    \n-
    seqan3::dna5 letter4 = letter2.convert_to<seqan3::dna5>();
    \n+
    seqan3::dna5 letter4 = letter2.convert_to<seqan3::dna5>();
    \n
    }
    \n
    all.hpp
    Meta-header for the Alphabet / Nucleotide submodule .
    \n
    alphabet_variant.hpp
    Provides seqan3::alphabet_variant.
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n-
    seqan3::alphabet_variant
    A combined alphabet that can hold values of either of its alternatives..
    Definition alphabet_variant.hpp:127
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dna5
    The five letter DNA alphabet of A,C,G,T and the unknown character N.
    Definition dna5.hpp:48
    \n
    seqan3::gap
    The alphabet of a gap character '-'.
    Definition gap.hpp:36
    \n
    gap.hpp
    Provides seqan3::gap.
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    The char representation of an alphabet_variant

    \n

    Part of the seqan3::alphabet concept requires that the alphabet_variant provides a char representation in addition to the rank representation. For an object of seqan3::alphabet_variant, the to_char() member function will always return the same character as if invoked on the respective alternative. In contrast, the assign_char() member function might be ambiguous between the alternative alphabets in a variant.

    \n

    For example, assigning a '!' to seqan3::dna15 resolves to an object of rank 8 with char representation 'N' while assigning '!' to seqan3::gap always resolves to rank 0, the gap symbol itself ('-'_gap). We tackle this ambiguousness by defaulting unknown characters to the representation of the first alternative (e.g. ‘alphabet_variant<dna15, gap>{}.assign_char(’!')resolves to rank 8, representingN`_dna15).

    \n@@ -370,38 +369,38 @@\n
    #include <seqan3/alphabet/composite/alphabet_variant.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::alphabet_variant<seqan3::dna4, seqan3::dna5> var;
    \n-
    var.assign_char('A'); // will be in the "dna4-state"
    \n-
    var = 'A'_dna5; // will be in the "dna5-state"
    \n+
    seqan3::alphabet_variant<seqan3::dna4, seqan3::dna5> var;
    \n+
    var.assign_char('A'); // will be in the "dna4-state"
    \n+
    var = 'A'_dna5; // will be in the "dna5-state"
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n

    Constructor & Destructor Documentation

    \n \n

    ◆ alphabet_variant() [1/3]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alternative_t >
    \n-requires (!std::same_as<alternative_t, alphabet_variant>) && (!detail::is_span<alternative_t>::value) && (!std::is_base_of_v<alphabet_variant, alternative_t>) && (!list_traits::contains< alphabet_variant, detail::transformation_trait_or_t<detail::recursive_required_types<alternative_t>, type_list<>>>) && (is_alternative<alternative_t>())
    \n+template<typename alternative_t >
    \n+requires (!std::same_as<alternative_t, alphabet_variant>) && (!detail::is_span<alternative_t>::value) && (!std::is_base_of_v<alphabet_variant, alternative_t>) && (!list_traits::contains< alphabet_variant, detail::transformation_trait_or_t<detail::recursive_required_types<alternative_t>, type_list<>>>) && (is_alternative<alternative_t>())
    \n \n \n \n \n@@ -430,39 +429,39 @@\n
    #include <seqan3/alphabet/gap/gap.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter1{'C'_dna4}; // or
    \n-
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter2 = seqan3::gap{};
    \n+
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter1{'C'_dna4}; // or
    \n+
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter2 = seqan3::gap{};
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n \n

    ◆ alphabet_variant() [2/3]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename indirect_alternative_t >
    \n-requires (!detail::is_span<indirect_alternative_t>::value) && (( detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    \n+template<typename indirect_alternative_t >
    \n+requires (!detail::is_span<indirect_alternative_t>::value) && (( detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::alphabet_variant< alternative_types >::alphabet_variant constexpr seqan3::alphabet_variant< alternative_types >::alphabet_variant (alternative_t const alternative_t const alternative)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -493,16 +492,16 @@\n
    #include <seqan3/alphabet/gap/gap.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter1{'C'_rna4};
    \n-
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter2 = 'C'_rna4;
    \n+
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter1{'C'_rna4};
    \n+
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter2 = 'C'_rna4;
    \n
    }
    \n
      \n
    • seqan3::dna4 and seqan3::rna4 are implicitly convertible to each other so the variant accepts either.
      • \n
    • Construction via {} considers implicit and explicit conversions.
      • \n
    • Construction via = considers only implicit conversions (but that is sufficient here).
      • \n
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n@@ -513,24 +512,24 @@\n

    ◆ alphabet_variant() [3/3]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename indirect_alternative_t >
    \n-requires ( (!(detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...)) && (detail::instantiate_if_v<detail::lazy<std::is_constructible, alternative_types, indirect_alternative_t>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    \n+template<typename indirect_alternative_t >
    \n+requires ( (!(detail::instantiate_if_v<detail::lazy<std::is_convertible, indirect_alternative_t, alternative_types>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...)) && (detail::instantiate_if_v<detail::lazy<std::is_constructible, alternative_types, indirect_alternative_t>, detail::variant_general_guard<indirect_alternative_t, alternative_types...>> || ...))
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::alphabet_variant< alternative_types >::alphabet_variant constexpr seqan3::alphabet_variant< alternative_types >::alphabet_variant (indirect_alternative_t const indirect_alternative_t const rhs)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -561,15 +560,15 @@\n
    #include <seqan3/alphabet/nucleotide/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    // possible:
    \n-
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter1{'C'_dna5};
    \n+
    seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter1{'C'_dna5};
    \n
    // not possible:
    \n
    // seqan3::alphabet_variant<seqan3::dna4, seqan3::gap> letter2 = 'C'_dna5;
    \n
    }
    \n
      \n
    • seqan3::dna4 and seqan3::dna5 are not implicitly convertible to each other, only explicitly.
      • \n
    • Construction via {} considers implicit and explicit conversions so this works.
      • \n
    • Construction via = considers only implicit conversions so it does not work.
      • \n@@ -587,17 +586,17 @@\n
      \n template<typename... alternative_types>
      \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::alphabet_variant< alternative_types >::alphabet_variant constexpr seqan3::alphabet_variant< alternative_types >::alphabet_variant (indirect_alternative_t const indirect_alternative_t const rhs)
    \n     		\n inlineexplicitconstexprnoexcept
    \n \n \n \n@@ -620,15 +619,15 @@\n
    \n template<size_t index>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    static constexpr bool seqan3::alphabet_variant< alternative_types >::char_is_valid static constexpr bool seqan3::alphabet_variant< alternative_types >::char_is_valid (char_type const char_type const chr)
    \n     		\n inlinestaticconstexprnoexcept
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr auto seqan3::alphabet_variant< alternative_types >::convert_to constexpr auto seqan3::alphabet_variant< alternative_types >::convert_to () const
    \n     		\n@@ -658,22 +657,22 @@\n

    ◆ convert_to() [2/2]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alternative_t >
    \n-requires (is_alternative<alternative_t>())
    \n+template<typename alternative_t >
    \n+requires (is_alternative<alternative_t>())
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr alternative_t seqan3::alphabet_variant< alternative_types >::convert_to constexpr alternative_t seqan3::alphabet_variant< alternative_types >::convert_to () const
    \n     		\n@@ -709,15 +708,15 @@\n
    \n template<size_t index>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr auto seqan3::alphabet_variant< alternative_types >::convert_unsafely_to constexpr auto seqan3::alphabet_variant< alternative_types >::convert_unsafely_to () const
    \n     		\n@@ -741,22 +740,22 @@\n

    ◆ convert_unsafely_to() [2/2]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alternative_t >
    \n-requires (is_alternative<alternative_t>())
    \n+template<typename alternative_t >
    \n+requires (is_alternative<alternative_t>())
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr alternative_t seqan3::alphabet_variant< alternative_types >::convert_unsafely_to constexpr alternative_t seqan3::alphabet_variant< alternative_types >::convert_unsafely_to () const
    \n     		\n@@ -786,15 +785,15 @@\n
    \n template<size_t index>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr bool seqan3::alphabet_variant< alternative_types >::holds_alternative constexpr bool seqan3::alphabet_variant< alternative_types >::holds_alternative () const
    \n     		\n@@ -819,22 +818,22 @@\n

    ◆ holds_alternative() [2/2]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alternative_t >
    \n-requires (is_alternative<alternative_t>())
    \n+template<typename alternative_t >
    \n+requires (is_alternative<alternative_t>())
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr bool seqan3::alphabet_variant< alternative_types >::holds_alternative constexpr bool seqan3::alphabet_variant< alternative_types >::holds_alternative () const
    \n     		\n@@ -858,21 +857,21 @@\n

    ◆ is_alternative()

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alternative_t >
    \n+template<typename alternative_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    static constexpr bool seqan3::alphabet_variant< alternative_types >::is_alternative static constexpr bool seqan3::alphabet_variant< alternative_types >::is_alternative ()
    \n     		\n@@ -896,15 +895,15 @@\n
    \n
    #include <seqan3/alphabet/composite/alphabet_variant.hpp>
    \n
    #include <seqan3/alphabet/gap/gap.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    using variant_t = seqan3::alphabet_variant<seqan3::dna5, seqan3::gap>;
    \n+
    using variant_t = seqan3::alphabet_variant<seqan3::dna5, seqan3::gap>;
    \n
    \n
    static_assert(variant_t::is_alternative<seqan3::dna5>(), "dna5 is an alternative of variant_t");
    \n
    static_assert(!variant_t::is_alternative<seqan3::dna4>(), "dna4 is not an alternative of variant_t");
    \n
    static_assert(variant_t::is_alternative<seqan3::gap>(), "gap is an alternative of variant_t");
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -914,24 +913,24 @@\n

    ◆ operator=()

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename indirect_alternative_t >
    \n-requires (detail::variant_general_guard<indirect_alternative_t, alternative_types...> && (weakly_assignable_from<alternative_types, indirect_alternative_t> || ...))
    \n+template<typename indirect_alternative_t >
    \n+requires (detail::variant_general_guard<indirect_alternative_t, alternative_types...> && (weakly_assignable_from<alternative_types, indirect_alternative_t> || ...))
    \n \n \n \n \n@@ -962,30 +961,30 @@\n

    ◆ operator!= [1/2]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    \n+template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr alphabet_variant & seqan3::alphabet_variant< alternative_types >::operator= constexpr alphabet_variant & seqan3::alphabet_variant< alternative_types >::operator= (indirect_alternative_t const & indirect_alternative_t const & rhs)
    \n     		\n inlineconstexprnoexcept
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1022,30 +1021,30 @@\n

    ◆ operator!= [2/2]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    \n+template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    \n
    constexpr bool operator!= constexpr bool operator!= (alphabet_variant_t const alphabet_variant_t const lhs,
    indirect_alternative_type const indirect_alternative_type const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1082,30 +1081,30 @@\n

    ◆ operator== [1/2]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    \n+template<typename alphabet_variant_t , typename indirect_alternative_type >
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, false, alternative_types...>)
    \n
    constexpr bool operator!= constexpr bool operator!= (indirect_alternative_type const indirect_alternative_type const lhs,
    alphabet_variant_t const alphabet_variant_t const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1142,30 +1141,30 @@\n

    ◆ operator== [2/2]

    \n \n
    \n
    \n
    \n template<typename... alternative_types>
    \n
    \n-template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n-requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    \n+template<typename alphabet_variant_t , typename indirect_alternative_type , typename = void>
    \n+requires (!detail::is_span<alphabet_variant_t>::value) && (detail::variant_comparison_guard<alphabet_variant_t, indirect_alternative_type, true, alternative_types...>)
    \n
    constexpr bool operator== constexpr bool operator== (alphabet_variant_t const alphabet_variant_t const lhs,
    indirect_alternative_type const indirect_alternative_type const rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__base.html", "unified_diff": "@@ -135,78 +135,78 @@\n \n
    \n
    \n
    [legend]
    \n
    constexpr bool operator== constexpr bool operator== (indirect_alternative_type const indirect_alternative_type const lhs,
    alphabet_variant_t const alphabet_variant_t const rhs 
    )
    \n \n-\n+\n \n \n

    \n Static Public Member Functions

    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \n \n-\n-\n+\n+\n \n \n

    Constructors, destructor and assignment

    template<typename other_aa_type >
    \n-requires (!std::same_as<aminoacid_base, other_aa_type>) && (!std::same_as<derived_type, other_aa_type>) && aminoacid_alphabet<other_aa_type> && detail::convertable_to_through_char_representation<other_aa_type, derived_type>
    constexpr aminoacid_base (other_aa_type const other) noexcept
    template<typename other_aa_type >
    \n+requires (!std::same_as<aminoacid_base, other_aa_type>) && (!std::same_as<derived_type, other_aa_type>) && aminoacid_alphabet<other_aa_type> && detail::convertable_to_through_char_representation<other_aa_type, derived_type>
    constexpr aminoacid_base (other_aa_type const other) noexcept
     Allow explicit construction from any other aminoacid type and convert via the character representation.
     
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char >
    static constexpr detail::min_viable_uint_t< size > alphabet_size
    static constexpr detail::min_viable_uint_t< size > alphabet_size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n-
    template<typename derived_type, auto size>
    \n+
    template<typename derived_type, auto size>
    \n class seqan3::aminoacid_base< derived_type, size >

    A CRTP-base that refines seqan3::alphabet_base and is used by the amino acids.

    \n
    Template Parameters
    \n \n \n \n
    derived_typeThe CRTP parameter type.
    sizeThe size of the alphabet.
    \n
    \n@@ -215,26 +215,26 @@\n

    Constructor & Destructor Documentation

    \n \n

    ◆ aminoacid_base()

    \n \n
    \n
    \n
    \n-template<typename derived_type , auto size>
    \n+template<typename derived_type , auto size>
    \n
    \n-template<typename other_aa_type >
    \n-requires (!std::same_as<aminoacid_base, other_aa_type>) && (!std::same_as<derived_type, other_aa_type>) && aminoacid_alphabet<other_aa_type> && detail::convertable_to_through_char_representation<other_aa_type, derived_type>
    \n+template<typename other_aa_type >
    \n+requires (!std::same_as<aminoacid_base, other_aa_type>) && (!std::same_as<derived_type, other_aa_type>) && aminoacid_alphabet<other_aa_type> && detail::convertable_to_through_char_representation<other_aa_type, derived_type>
    \n \n \n \n \n@@ -250,23 +250,23 @@\n

    Member Function Documentation

    \n \n

    ◆ char_is_valid()

    \n \n
    \n
    \n
    \n-template<typename derived_type , auto size>
    \n+template<typename derived_type , auto size>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::aminoacid_base< derived_type, size >::aminoacid_base constexpr seqan3::aminoacid_base< derived_type, size >::aminoacid_base (other_aa_type const other_aa_type const other)
    \n     		\n inlineexplicitconstexprnoexcept
    \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1aminoacid__scoring__scheme.html", "unified_diff": "@@ -135,139 +135,139 @@\n
    \n
    \n
    [legend]
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    static constexpr bool seqan3::aminoacid_base< derived_type, size >::char_is_valid static constexpr bool seqan3::aminoacid_base< derived_type, size >::char_is_valid (char_type const char_type const c)
    \n     		\n inlinestaticconstexprnoexcept
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprscoring_scheme_base & \n \n \n \n+constexprscoring_scheme_base & \n \n \n \n+ \n \n \n \n+constexpr \n \n \n \n-\n+\n \n \n-\n+\n \n \n \n+constexprvoid \n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n \n+constexprbool \n \n \n \n+constexprbool \n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    constexpr aminoacid_scoring_scheme () noexcept=default
    constexpr aminoacid_scoring_scheme () noexcept=default
     The default constructor (delegates to set_hamming_distance()).
     
    template<arithmetic score_arg_t>
    constexpr aminoacid_scoring_scheme (match_score< score_arg_t > const ms, mismatch_score< score_arg_t > const mms)
    constexpr aminoacid_scoring_scheme (match_score< score_arg_t > const ms, mismatch_score< score_arg_t > const mms)
     Constructor for the simple scheme (delegates to set_simple_scheme()).
     
    constexpr aminoacid_scoring_scheme (matrix_type const &matrix) noexcept
    constexpr aminoacid_scoring_scheme (matrix_type const &matrix) noexcept
     Constructor for a custom scheme (delegates to set_custom_matrix()).
     
    constexpr aminoacid_scoring_scheme (aminoacid_similarity_matrix const matrix_id)
    constexpr aminoacid_scoring_scheme (aminoacid_similarity_matrix const matrix_id)
     Construct for seqan3::aminoacid_similarity_matrix.
     
    Scheme selection
    constexpr void set_similarity_matrix (aminoacid_similarity_matrix const matrix_id)
    constexpr void set_similarity_matrix (aminoacid_similarity_matrix const matrix_id)
     Set the similarity matrix scheme (e.g. blosum62).
     
    \"-\"/ Public Member Functions inherited from seqan3::scoring_scheme_base< derived_t, alphabet_t, score_t >
    \n-constexpr scoring_scheme_base (scoring_scheme_base const &) noexcept=default
    scoring_scheme_base (scoring_scheme_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr scoring_scheme_base (scoring_scheme_base &&) noexcept=default
    scoring_scheme_base (scoring_scheme_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr scoring_scheme_base & operator= (scoring_scheme_base const &) noexcept=default
    operator= (scoring_scheme_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr scoring_scheme_base & operator= (scoring_scheme_base &&) noexcept=default
    operator= (scoring_scheme_base &&) noexcept=default
     Defaulted.
     
    \n- ~scoring_scheme_base () noexcept=default
    ~scoring_scheme_base () noexcept=default
     Defaulted.
     
    \n-constexpr scoring_scheme_base () noexcept
    scoring_scheme_base () noexcept
     The default constructor (delegates to set_hamming_distance()).
     
    template<arithmetic score_arg_t>
    constexpr scoring_scheme_base (match_score< score_arg_t > const ms, mismatch_score< score_arg_t > const mms)
    constexpr scoring_scheme_base (match_score< score_arg_t > const ms, mismatch_score< score_arg_t > const mms)
     Constructor for the simple scheme (delegates to set_simple_scheme()).
     
    constexpr scoring_scheme_base (matrix_type const &matrix) noexcept
    constexpr scoring_scheme_base (matrix_type const &matrix) noexcept
     Constructor for a custom scheme (delegates to set_custom_matrix()).
     
    \n-constexpr void set_hamming_distance () noexcept
    set_hamming_distance () noexcept
     Set the hamming scheme, a variant of the simple scheme where match is scored 0 and mismatch -1.
     
    template<arithmetic score_arg_t>
    constexpr void set_simple_scheme (match_score< score_arg_t > const ms, mismatch_score< score_arg_t > const mms)
    constexpr void set_simple_scheme (match_score< score_arg_t > const ms, mismatch_score< score_arg_t > const mms)
     Set the simple scheme (everything is either match or mismatch).
     
    constexpr void set_custom_matrix (matrix_type const &matrix) noexcept
    constexpr void set_custom_matrix (matrix_type const &matrix) noexcept
     Set a custom scheme by passing a full matrix with arbitrary content.
     
    template<typename alph1_t , typename alph2_t >
    \n-requires explicitly_convertible_to<alph1_t, alphabet_t> && explicitly_convertible_to<alph2_t, alphabet_t>
    constexpr score_t & score (alph1_t const alph1, alph2_t const alph2) noexcept
    template<typename alph1_t , typename alph2_t >
    \n+requires explicitly_convertible_to<alph1_t, alphabet_t> && explicitly_convertible_to<alph2_t, alphabet_t>
    constexpr score_t & score (alph1_t const alph1, alph2_t const alph2) noexcept
     Score two letters (either two nucleotids or two amino acids).
     
    template<typename alph1_t , typename alph2_t >
    \n-requires explicitly_convertible_to<alph1_t, alphabet_t> && explicitly_convertible_to<alph2_t, alphabet_t>
    constexpr score_t score (alph1_t const alph1, alph2_t const alph2) const noexcept
    template<typename alph1_t , typename alph2_t >
    \n+requires explicitly_convertible_to<alph1_t, alphabet_t> && explicitly_convertible_to<alph2_t, alphabet_t>
    constexpr score_t score (alph1_t const alph1, alph2_t const alph2) const noexcept
     Score two letters (either two nucleotids or two amino acids).
     
    \n-constexpr bool operator== (derived_t const &rhs) const noexcept
    operator== (derived_t const &rhs) const noexcept
     Checks whether *this is equal to rhs.
     
    \n-constexpr bool operator!= (derived_t const &rhs) const noexcept
    operator!= (derived_t const &rhs) const noexcept
     Checks whether *this is not equal to rhs.
     
    \n \n \n \n \n \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    Type deduction guides
    \n  aminoacid_scoring_scheme () -> aminoacid_scoring_scheme< int8_t >
     Default constructed objects deduce to int8_t.
     
    \n template<arithmetic score_arg_type>
     aminoacid_scoring_scheme (match_score< score_arg_type >, mismatch_score< score_arg_type >) -> aminoacid_scoring_scheme< int8_t >
     aminoacid_scoring_scheme (match_score< score_arg_type >, mismatch_score< score_arg_type >) -> aminoacid_scoring_scheme< int8_t >
     Attention: This guide does not actually deduce from the underlying type, but always defaults to int8_t. To use a larger type, specify the template argument manually.
     
    \n template<arithmetic score_arg_type>
     aminoacid_scoring_scheme (std::array< std::array< score_arg_type, 27 >, 27 >) -> aminoacid_scoring_scheme< score_arg_type >
     aminoacid_scoring_scheme (std::array< std::array< score_arg_type, 27 >, 27 >) -> aminoacid_scoring_scheme< score_arg_type >
     Deduce the score type from the provided matrix.
     
    \n  aminoacid_scoring_scheme (aminoacid_similarity_matrix) -> aminoacid_scoring_scheme< int8_t >
     Attention: This guide does not actually deduce from the underlying type, but always defaults to int8_t. To use a larger type, specify the template argument manually.
     
    \n \n \n \n+using \n \n \n \n+using \n \n \n \n+using \n \n \n \n+using \n \n \n \n \n+staticconstexprmatrix_size_type \n \n \n

    \n Additional Inherited Members

    \"-\"/ Public Types inherited from seqan3::scoring_scheme_base< derived_t, alphabet_t, score_t >
    \n-using score_type = score_t
    score_type = score_t
     Type of the score values.
     
    \n-using alphabet_type = alphabet_t
    alphabet_type = alphabet_t
     Type of the underlying alphabet.
     
    \n-using matrix_size_type = std::remove_const_t< decltype(alphabet_size< alphabet_t >)>
    matrix_size_type = std::remove_const_t< decltype(alphabet_size< alphabet_t >)>
     Size type that can hold the dimension of the matrix (i.e. size of the alphabet).
     
    \n-using matrix_type = std::array< std::array< score_type, matrix_size >, matrix_size >
    matrix_type = std::array< std::array< score_type, matrix_size >, matrix_size >
     Type of the internal matrix (a two-dimensional array).
     
    \"-\"/ Static Public Attributes inherited from seqan3::scoring_scheme_base< derived_t, alphabet_t, score_t >
    \n-static constexpr matrix_size_type matrix_size = alphabet_size<alphabet_t>
    matrix_size = alphabet_size<alphabet_t>
     Size of the matrix dimensions (i.e. size of the alphabet).
     
    \n

    Detailed Description

    \n
    template<arithmetic score_type = int8_t>
    \n class seqan3::aminoacid_scoring_scheme< score_type >

    A data structure for managing and computing the score of two amino acids.

    \n

    You can use an instance of this class to score two amino acids. The amino acids need not be of the same type. Different scoring behaviour can be set via the member functions.

    \n@@ -284,48 +284,49 @@\n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    seqan3::aminoacid_scoring_scheme scheme{seqan3::aminoacid_similarity_matrix::blosum62};
    \n
    // How to score two letters:
    \n-
    seqan3::debug_stream << "blosum62 score for T and S: " << (int)scheme.score('T'_aa27, 'S'_aa27) << "\\n"; // == 1
    \n+
    seqan3::debug_stream << "blosum62 score for T and S: " << (int)scheme.score('T'_aa27, 'S'_aa27) << "\\n"; // == 1
    \n
    \n
    scheme.set_similarity_matrix(seqan3::aminoacid_similarity_matrix::blosum80);
    \n
    // You can also score aa20 against aa27:
    \n-
    seqan3::debug_stream << "blosum80 score for 'T'_aa27 and 'S'_aa20: " << (int)scheme.score('T'_aa27, 'S'_aa20)
    \n+
    seqan3::debug_stream << "blosum80 score for 'T'_aa27 and 'S'_aa20: " << (int)scheme.score('T'_aa27, 'S'_aa20)
    \n
    << "\\n"; // == 2
    \n
    scheme.set_hamming_distance();
    \n-
    seqan3::debug_stream << "Hamming distance between T and S: " << (int)scheme.score('T'_aa27, 'S'_aa20)
    \n+
    seqan3::debug_stream << "Hamming distance between T and S: " << (int)scheme.score('T'_aa27, 'S'_aa20)
    \n
    << "\\n"; // == -1
    \n-
    seqan3::debug_stream << "Hamming distance between T and T: " << (int)scheme.score('T'_aa27, 'T'_aa20)
    \n+
    seqan3::debug_stream << "Hamming distance between T and T: " << (int)scheme.score('T'_aa27, 'T'_aa20)
    \n
    << "\\n"; // == 0
    \n
    \n-
    seqan3::aminoacid_scoring_scheme scheme2{seqan3::aminoacid_similarity_matrix::blosum80};
    \n+
    seqan3::aminoacid_scoring_scheme scheme2{seqan3::aminoacid_similarity_matrix::blosum80};
    \n
    // You can "edit" a given matrix directly:
    \n-
    seqan3::debug_stream << "blosum80 score between T and S: " << (int)scheme2.score('T'_aa27, 'S'_aa27)
    \n+
    seqan3::debug_stream << "blosum80 score between T and S: " << (int)scheme2.score('T'_aa27, 'S'_aa27)
    \n
    << "\\n"; // == 2
    \n-
    auto & cell = scheme2.score('T'_aa27, 'S'_aa27);
    \n-
    cell = 3;
    \n-
    seqan3::debug_stream << "New score after editing entry: " << (int)scheme2.score('T'_aa27, 'S'_aa27) << "\\n"; // == 3
    \n+
    auto & cell = scheme2.score('T'_aa27, 'S'_aa27);
    \n+
    cell = 3;
    \n+
    seqan3::debug_stream << "New score after editing entry: " << (int)scheme2.score('T'_aa27, 'S'_aa27) << "\\n"; // == 3
    \n
    \n-
    std::vector<seqan3::aa27> one = "ALIGATOR"_aa27;
    \n-
    std::vector<seqan3::aa27> two = "ANIMATOR"_aa27;
    \n+
    std::vector<seqan3::aa27> one = "ALIGATOR"_aa27;
    \n+
    std::vector<seqan3::aa27> two = "ANIMATOR"_aa27;
    \n
    \n-
    seqan3::aminoacid_scoring_scheme scheme3{seqan3::aminoacid_similarity_matrix::blosum62};
    \n+
    seqan3::aminoacid_scoring_scheme scheme3{seqan3::aminoacid_similarity_matrix::blosum62};
    \n
    // You can also score two sequences:
    \n
    int score = 0;
    \n-
    for (auto pair : seqan3::views::zip(one, two))
    \n-
    score += scheme3.score(std::get<0>(pair), std::get<1>(pair));
    \n+
    for (auto pair : seqan3::views::zip(one, two))
    \n+
    score += scheme3.score(std::get<0>(pair), std::get<1>(pair));
    \n
    seqan3::debug_stream << "Score: " << score << "\\n"; // 4 + -3 + 4 + -3 + 4 + 5 + -1 + 5 = 15
    \n
    }
    \n
    aa27.hpp
    Provides seqan3::aa27, container aliases and string literals.
    \n
    all.hpp
    Meta-header for the Alphabet / Aminoacid submodule .
    \n
    aminoacid_scoring_scheme.hpp
    Provides seqan3::aminoacid_scoring_scheme.
    \n
    seqan3::aminoacid_scoring_scheme
    A data structure for managing and computing the score of two amino acids.
    Definition aminoacid_scoring_scheme.hpp:72
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::scoring_scheme_base::score
    constexpr score_t & score(alph1_t const alph1, alph2_t const alph2) noexcept
    Score two letters (either two nucleotids or two amino acids).
    Definition scoring_scheme_base.hpp:214
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::aminoacid_similarity_matrix::blosum80
    @ blosum80
    The blosum80 matrix for closely related proteins.
    \n
    seqan3::aminoacid_similarity_matrix::blosum62
    @ blosum62
    The blosum62 matrix recommended for most use-cases.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::views::zip
    seqan::stl::views::zip zip
    A view adaptor that takes several views and returns tuple-like values from every i-th element of each...
    Definition zip.hpp:24
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n@@ -343,15 +344,15 @@\n
    \n template<arithmetic score_type = int8_t>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme ()
    \n     		\n@@ -374,23 +375,23 @@\n
    \n template<arithmetic score_arg_t>
    \n \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -433,17 +434,17 @@\n
    \n template<arithmetic score_type = int8_t>
    \n
    constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme (match_score< score_arg_t > const match_score< score_arg_t > const ms,
    mismatch_score< score_arg_t > const mismatch_score< score_arg_t > const mms 
    )
    \n \n \n \n@@ -469,17 +470,17 @@\n
    \n template<arithmetic score_type = int8_t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme (matrix_type const & matrix_type const & matrix)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -512,17 +513,17 @@\n
    \n template<arithmetic score_type = int8_t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme constexpr seqan3::aminoacid_scoring_scheme< score_type >::aminoacid_scoring_scheme (aminoacid_similarity_matrix const aminoacid_similarity_matrix const matrix_id)
    \n     		\n inlineconstexpr
    \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser.html", "unified_diff": "@@ -133,77 +133,77 @@\n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr void seqan3::aminoacid_scoring_scheme< score_type >::set_similarity_matrix constexpr void seqan3::aminoacid_scoring_scheme< score_type >::set_similarity_matrix (aminoacid_similarity_matrix const aminoacid_similarity_matrix const matrix_id)
    \n     		\n inlineconstexpr
    \n \n \n \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n \n \n+ \n \n \n \n+ \n \n \n \n+argument_parser & \n \n \n \n+ \n \n \n \n+argument_parser & \n \n \n-\n+\n \n \n \n \n \n \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    \n argument_parser & get_sub_parser ()
     Returns a reference to the sub-parser instance if subcommand parsing was enabled.
     
    template<typename id_type >
    \n-requires std::same_as<id_type, char> || std::constructible_from<std::string, id_type>
    bool is_option_set (id_type const &id) const
    template<typename id_type >
    \n+requires std::same_as<id_type, char> || std::constructible_from<std::string, id_type>
    bool is_option_set (id_type const &id) const
     Checks whether the option identifier (id) was set on the command line by the user.
     
    void parse ()
    void parse ()
     Initiates the actual command line parsing.
     
    Constructors, destructor and assignment
    \n- argument_parser ()=delete
    argument_parser ()=delete
     Deleted.
     
    \n- argument_parser (argument_parser const &)=delete
    argument_parser (argument_parser const &)=delete
     Deleted. Holds std::future.
     
    \n-argument_parser & operator= (argument_parser const &)=delete
    operator= (argument_parser const &)=delete
     Deleted. Holds std::future.
     
    \n- argument_parser (argument_parser &&)=default
    argument_parser (argument_parser &&)=default
     Defaulted.
     
    \n-argument_parser & operator= (argument_parser &&)=default
    operator= (argument_parser &&)=default
     Defaulted.
     
     argument_parser (std::string const app_name, int const argc, char const *const *const argv, update_notifications version_updates=update_notifications::on, std::vector< std::string > subcommands={})
     argument_parser (std::string const app_name, int const argc, char const *const *const argv, update_notifications version_updates=update_notifications::on, std::vector< std::string > subcommands={})
     Initializes an seqan3::argument_parser object from the command line arguments.
     
    \n  ~argument_parser ()
     The destructor.
     
    Adding options

    Add (positional) options and flags to the parser.

    \n
    template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n-requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    void add_option (option_type &value, char const short_id, std::string const &long_id, std::string const &desc, option_spec const spec=option_spec::standard, validator_type option_validator=validator_type{})
    template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n+requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    void add_option (option_type &value, char const short_id, std::string const &long_id, std::string const &desc, option_spec const spec=option_spec::standard, validator_type option_validator=validator_type{})
     Adds an option to the seqan3::argument_parser.
     
    void add_flag (bool &value, char const short_id, std::string const &long_id, std::string const &desc, option_spec const spec=option_spec::standard)
    void add_flag (bool &value, char const short_id, std::string const &long_id, std::string const &desc, option_spec const spec=option_spec::standard)
     Adds a flag to the seqan3::argument_parser.
     
    template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n-requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    void add_positional_option (option_type &value, std::string const &desc, validator_type option_validator=validator_type{})
    template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n+requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    void add_positional_option (option_type &value, std::string const &desc, validator_type option_validator=validator_type{})
     Adds a positional option to the seqan3::argument_parser.
     
    Structuring the Help Page
    void add_section (std::string const &title, option_spec const spec=option_spec::standard)
    void add_section (std::string const &title, option_spec const spec=option_spec::standard)
     Adds an help page section to the seqan3::argument_parser.
     
    void add_subsection (std::string const &title, option_spec const spec=option_spec::standard)
    void add_subsection (std::string const &title, option_spec const spec=option_spec::standard)
     Adds an help page subsection to the seqan3::argument_parser.
     
    void add_line (std::string const &text, bool is_paragraph=false, option_spec const spec=option_spec::standard)
    void add_line (std::string const &text, bool is_paragraph=false, option_spec const spec=option_spec::standard)
     Adds an help page text line to the seqan3::argument_parser.
     
    void add_list_item (std::string const &key, std::string const &desc, option_spec const spec=option_spec::standard)
    void add_list_item (std::string const &key, std::string const &desc, option_spec const spec=option_spec::standard)
     Adds an help page list item (key-value) to the seqan3::argument_parser.
     
    \n \n \n \n@@ -225,17 +225,17 @@\n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/argument_parser/all.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n-
    int main(int argc, char ** argv)
    \n+
    int main(int argc, char ** argv)
    \n
    {
    \n-
    seqan3::argument_parser myparser{"Grade-Average", argc, argv}; // initialize
    \n+
    seqan3::argument_parser myparser{"Grade-Average", argc, argv}; // initialize
    \n
    \n
    std::string name{"Max Muster"}; // define default values directly in the variable.
    \n
    bool bonus{false};
    \n
    std::vector<double> grades{}; // you can also specify a vector that is treated as a list option.
    \n
    \n
    myparser.add_option(name, 'n', "name", "Please specify your name.");
    \n
    myparser.add_flag(bonus, 'b', "bonus", "Please specify if you got the bonus.");
    \n@@ -265,14 +265,15 @@\n
    return 0;
    \n
    }
    \n
    all.hpp
    Meta-header for the Argument Parser module .
    \n \n \n
    seqan3::argument_parser_error
    Argument parser exception that is thrown whenever there is an error while parsing the command line ar...
    Definition exceptions.hpp:37
    \n
    seqan3::argument_parser
    The SeqAn command line parser.
    Definition argument_parser.hpp:145
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n \n
    std::runtime_error::what
    T what(T... args)
    \n

    Now you can call your application via the command line:

    \n
    MaxMuster% ./grade_avg_app -n Peter --bonus 1.0 2.0 1.7
    \n
    Peter has an average grade of 1.425
    \n@@ -320,27 +321,27 @@\n

    \n Public Attributes

    argument_parser_meta_data info
     Aggregates all parser related meta data (see seqan3::argument_parser_meta_data struct).
    \n \n
    \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -393,41 +394,41 @@\n
    \n
    \n
    seqan3::argument_parser::argument_parser (std::string const std::string const app_name,
    int const int const argc,
    char const *const *const char const *const *const argv,
    update_notifications version_updates = update_notifications::on,
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -465,29 +466,29 @@\n
    \n
    \n
    void seqan3::argument_parser::add_flag void seqan3::argument_parser::add_flag (bool & bool & value,
    char const char const short_id,
    std::string const & std::string const & long_id,
    std::string const & std::string const & desc,
    option_spec const option_spec const spec = option_spec::standard 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n- \n+ \n+ \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -518,29 +519,29 @@\n
    \n
    \n
    void seqan3::argument_parser::add_line void seqan3::argument_parser::add_line (std::string const & std::string const & text,
    bool is_paragraph = false, bool is_paragraph = false,
    option_spec const option_spec const spec = option_spec::standard 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -569,55 +570,55 @@\n \n \n

    ◆ add_option()

    \n \n
    \n
    \n
    \n-template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n-requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    \n+template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n+requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    \n
    void seqan3::argument_parser::add_list_item void seqan3::argument_parser::add_list_item (std::string const & std::string const & key,
    std::string const & std::string const & desc,
    option_spec const option_spec const spec = option_spec::standard 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n- \n+ \n+ \n \n \n \n \n \n \n
    void seqan3::argument_parser::add_option void seqan3::argument_parser::add_option (option_type & option_type & value,
    char const char const short_id,
    std::string const & std::string const & long_id,
    std::string const & std::string const & desc,
    option_spec const option_spec const spec = option_spec::standard,
    validator_type option_validator = validator_type{} validator_type option_validator = validator_type{} 
    )
    \n@@ -658,37 +659,37 @@\n \n \n

    ◆ add_positional_option()

    \n \n
    \n
    \n
    \n-template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n-requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    \n+template<typename option_type , validator validator_type = detail::default_validator<option_type>>
    \n+requires (argument_parser_compatible_option<option_type> || argument_parser_compatible_option<std::ranges::range_value_t<option_type>>) && std::invocable<validator_type, option_type>
    \n \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n- \n+ \n+ \n \n \n \n \n \n \n
    void seqan3::argument_parser::add_positional_option void seqan3::argument_parser::add_positional_option (option_type & option_type & value,
    std::string const & std::string const & desc,
    validator_type option_validator = validator_type{} validator_type option_validator = validator_type{} 
    )
    \n@@ -731,23 +732,23 @@\n
    \n
    \n \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -777,23 +778,23 @@\n
    \n
    \n
    void seqan3::argument_parser::add_section void seqan3::argument_parser::add_section (std::string const & std::string const & title,
    option_spec const option_spec const spec = option_spec::standard 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -819,24 +820,24 @@\n \n \n

    ◆ is_option_set()

    \n \n
    \n
    \n
    \n-template<typename id_type >
    \n-requires std::same_as<id_type, char> || std::constructible_from<std::string, id_type>
    \n+template<typename id_type >
    \n+requires std::same_as<id_type, char> || std::constructible_from<std::string, id_type>
    \n
    void seqan3::argument_parser::add_subsection void seqan3::argument_parser::add_subsection (std::string const & std::string const & title,
    option_spec const option_spec const spec = option_spec::standard 
    )
    \n \n \n \n@@ -869,20 +870,20 @@\n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/argument_parser/all.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n-
    int main(int argc, char ** argv)
    \n+
    int main(int argc, char ** argv)
    \n
    {
    \n-
    seqan3::argument_parser myparser{"awesome-app", argc, argv}; // initialize
    \n+
    seqan3::argument_parser myparser{"awesome-app", argc, argv}; // initialize
    \n
    \n
    int a{3};
    \n-
    myparser.add_option(a, 'a', "awesome-parameter", "Please specify an integer.");
    \n+
    myparser.add_option(a, 'a', "awesome-parameter", "Please specify an integer.");
    \n
    \n
    try
    \n
    {
    \n
    myparser.parse();
    \n
    }
    \n
    catch (seqan3::argument_parser_error const & ext) // the user did something wrong
    \n
    {
    \n@@ -897,15 +898,14 @@\n
    seqan3::debug_stream << "The user set option --awesome-parameter on the command line.\\n";
    \n
    \n
    // Asking for an option identifier that was not used before throws an error:
    \n
    // myparser.is_option_set("foo"); // throws seqan3::design_error
    \n
    \n
    return 0;
    \n
    }
    \n-
    seqan3::argument_parser::add_option
    void add_option(option_type &value, char const short_id, std::string const &long_id, std::string const &desc, option_spec const spec=option_spec::standard, validator_type option_validator=validator_type{})
    Adds an option to the seqan3::argument_parser.
    Definition argument_parser.hpp:236
    \n

    Exceptions

    \n

    This function throws a seqan3::design_error if

    \n \n@@ -917,15 +917,15 @@\n
    \n
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::argument_parser::is_option_set bool seqan3::argument_parser::is_option_set (id_type const & id_type const & id) const
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::argument_parser::parse void seqan3::argument_parser::parse ()
    \n     		\n@@ -961,21 +961,21 @@\n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/argument_parser/all.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n-
    int main(int argc, char ** argv)
    \n+
    int main(int argc, char ** argv)
    \n
    {
    \n-
    seqan3::argument_parser myparser{"The-Age-App", argc, argv}; // initialize
    \n+
    seqan3::argument_parser myparser{"The-Age-App", argc, argv}; // initialize
    \n
    \n-
    int age{30}; // define default values directly in the variable
    \n+
    int age{30}; // define default values directly in the variable
    \n
    \n-
    myparser.add_option(age, 'a', "user-age", "Please specify your age.");
    \n+
    myparser.add_option(age, 'a', "user-age", "Please specify your age.");
    \n
    \n
    try
    \n
    {
    \n
    myparser.parse();
    \n
    }
    \n
    catch (seqan3::argument_parser_error const & ext) // the user did something wrong
    \n
    {
    \n@@ -1028,26 +1028,26 @@\n

    You can access the members directly: (see seqan3::argument_parser_meta_data for a list of the info members)

    \n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/argument_parser/all.hpp>
    \n
    \n-
    int main(int argc, char ** argv)
    \n+
    int main(int argc, char ** argv)
    \n
    {
    \n-
    seqan3::argument_parser myparser{"Penguin_Parade", argc, argv}; // initialize
    \n+
    seqan3::argument_parser myparser{"Penguin_Parade", argc, argv}; // initialize
    \n
    \n-
    myparser.info.version = "2.0.0";
    \n-
    myparser.info.date = "12.01.2017";
    \n-
    myparser.info.short_description = "Organize your penguin parade";
    \n-
    myparser.info.description.push_back("First Paragraph.");
    \n-
    myparser.info.description.push_back("Second Paragraph.");
    \n-
    myparser.info.examples.push_back("./penguin_parade Skipper Kowalski Rico Private -d 10 -m 02 -y 2017");
    \n+
    myparser.info.version = "2.0.0";
    \n+
    myparser.info.date = "12.01.2017";
    \n+
    myparser.info.short_description = "Organize your penguin parade";
    \n+
    myparser.info.description.push_back("First Paragraph.");
    \n+
    myparser.info.description.push_back("Second Paragraph.");
    \n+
    myparser.info.examples.push_back("./penguin_parade Skipper Kowalski Rico Private -d 10 -m 02 -y 2017");
    \n
    \n-
    int d{01}; // day
    \n+
    int d{01}; // day
    \n
    int m{01}; // month
    \n
    int y{2050}; // year
    \n
    \n
    myparser.add_option(d, 'd', "day", "Please specify your preferred day.");
    \n
    myparser.add_option(m, 'm', "month", "Please specify your preferred month.");
    \n
    myparser.add_option(y, 'y', "year", "Please specify your preferred year.");
    \n
    \n@@ -1065,17 +1065,14 @@\n
    return -1;
    \n
    }
    \n
    \n
    // organize ...
    \n
    \n
    return 0;
    \n
    }
    \n-
    seqan3::argument_parser::info
    argument_parser_meta_data info
    Aggregates all parser related meta data (see seqan3::argument_parser_meta_data struct).
    Definition argument_parser.hpp:634
    \n-
    std::string::push_back
    T push_back(T... args)
    \n-
    seqan3::argument_parser_meta_data::version
    std::string version
    The version information MAJOR.MINOR.PATH (e.g. 3.1.3)
    Definition auxiliary.hpp:293
    \n

    This will produce a nice help page when the user calls -h or --help:

    \n
    MaxMuster% ./penguin_app --help
    \n
    Penguin_Parade - Organize your penguin parade
    \n
    =============================================
    \n
    \n
    DESCRIPTION
    \n
    First Paragraph.
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1argument__parser__error.html", "unified_diff": "@@ -135,15 +135,15 @@\n
    \n
    \n
    \n
    [legend]
    \n \n \n-\n+\n \n \n \n \n \n

    \n Public Member Functions

     argument_parser_error (std::string const &s)
     argument_parser_error (std::string const &s)
     The constructor.
     
    \"-\"/ Public Member Functions inherited from std::runtime_error
    \n T runtime_error (T... args)
     
    \n@@ -172,15 +172,15 @@\n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1arithmetic__range__validator.html", "unified_diff": "@@ -137,32 +137,32 @@\n
    \n
    \n
    [legend]
    \n
    \n \n \n \n \n- \n+ \n \n \n \n
    seqan3::argument_parser_error::argument_parser_error (std::string const & std::string const & s)
    \n     		\n inline
    \n \n \n+using \n \n \n

    \n Public Types

    \n-using option_value_type = option_value_t
    option_value_type = option_value_t
     The type of value that this validator invoked upon.
     
    \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+requires arithmetic<std::ranges::range_value_t<range_type>>\n+\n \n \n

    \n Public Member Functions

     arithmetic_range_validator (option_value_type const min_, option_value_type const max_)
     arithmetic_range_validator (option_value_type const min_, option_value_type const max_)
     The constructor.
     
    std::string get_help_page_message () const
    std::string get_help_page_message () const
     Returns a message that can be appended to the (positional) options help page info.
     
    void operator() (option_value_type const &cmp) const
    void operator() (option_value_type const &cmp) const
     Tests whether cmp lies inside [min, max].
     
    template<std::ranges::forward_range range_type>
    \n-requires arithmetic<std::ranges::range_value_t<range_type>>
    void operator() (range_type const &range) const
    void operator() (range_type const &range) const
     Tests whether every element in range lies inside [min, max].
     
    \n \n \n \n@@ -185,20 +185,20 @@\n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/argument_parser/all.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n-
    int main(int argc, char const ** argv)
    \n+
    int main(int argc, char const ** argv)
    \n
    {
    \n-
    seqan3::argument_parser myparser{"Test", argc, argv}; // initialize
    \n+
    seqan3::argument_parser myparser{"Test", argc, argv}; // initialize
    \n
    \n-
    int myint;
    \n-
    seqan3::arithmetic_range_validator my_validator{2, 10};
    \n+
    int myint;
    \n+
    seqan3::arithmetic_range_validator my_validator{2, 10};
    \n
    \n
    myparser.add_option(myint, 'i', "integer", "Give me a number.", seqan3::option_spec::standard, my_validator);
    \n
    \n
    // an exception will be thrown if the user specifies an integer
    \n
    // that is not in range [2,10] (e.g. "./test_app -i 15")
    \n
    try
    \n
    {
    \n@@ -214,14 +214,15 @@\n
    return 0;
    \n
    }
    \n
    all.hpp
    Meta-header for the Argument Parser module .
    \n \n
    seqan3::argument_parser_error
    Argument parser exception that is thrown whenever there is an error while parsing the command line ar...
    Definition exceptions.hpp:37
    \n
    seqan3::argument_parser
    The SeqAn command line parser.
    Definition argument_parser.hpp:145
    \n
    seqan3::arithmetic_range_validator
    A validator that checks whether a number is inside a given range.
    Definition validators.hpp:122
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::standard
    @ standard
    The default were no checking or special displaying is happening.
    Definition auxiliary.hpp:248
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    std::runtime_error::what
    T what(T... args)
    \n
    Remarks
    For a complete overview, take a look at Argument Parser
    \n

    Constructor & Destructor Documentation

    \n \n@@ -234,21 +235,21 @@\n

    \n Additional Inherited Members

    \"-\"/ Related Symbols inherited from validator
    using option_value_type
    \n \n
    \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -311,17 +312,17 @@\n
    \n template<arithmetic option_value_t>
    \n
    seqan3::arithmetic_range_validator< option_value_t >::arithmetic_range_validator (option_value_type const option_value_type const min_,
    option_value_type const option_value_type const max_ 
    )
    \n \n \n \n@@ -350,23 +351,23 @@\n \n
    \n
    \n
    \n template<arithmetic option_value_t>
    \n
    \n template<std::ranges::forward_range range_type>
    \n-requires arithmetic<std::ranges::range_value_t<range_type>>
    \n+requires arithmetic<std::ranges::range_value_t<range_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::arithmetic_range_validator< option_value_t >::operator() void seqan3::arithmetic_range_validator< option_value_t >::operator() (option_value_type const & option_value_type const & cmp) const
    \n     		\n inline
    \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index.html", "unified_diff": "@@ -139,93 +139,93 @@\n
    \n
    [legend]
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::arithmetic_range_validator< option_value_t >::operator() void seqan3::arithmetic_range_validator< option_value_t >::operator() (range_type const & range_type const & range) const
    \n     		\n inline
    \n \n \n \n+using \n \n \n \n+using \n \n \n \n \n+using \n \n \n \n+using \n \n \n

    \n Public Types

    Text types
    \n-using alphabet_type = typename fm_index_type::alphabet_type
    alphabet_type = typename fm_index_type::alphabet_type
     The type of the underlying character of the indexed text.
     
    \n-using size_type = typename sdsl_index_type::size_type
    size_type = typename sdsl_index_type::size_type
     Type for representing positions in the indexed text.
     
    Cursor types
    \n-using cursor_type = bi_fm_index_cursor< bi_fm_index >
    cursor_type = bi_fm_index_cursor< bi_fm_index >
     The type of the bidirectional cursor.
     
    \n-using fwd_cursor_type = fm_index_cursor< fm_index_type >
    fwd_cursor_type = fm_index_cursor< fm_index_type >
     The type of the unidirectional cursor on the original text.
     
    \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n \n+ \n \n \n \n+ \n \n \n \n+bi_fm_index & \n \n \n \n+ \n \n \n \n+bi_fm_index & \n \n \n \n+ \n \n \n \n-\n+\n \n \n

    \n Public Member Functions

    cursor_type cursor () const noexcept
    cursor_type cursor () const noexcept
     Returns a seqan3::bi_fm_index_cursor on the index that can be used for searching. .
     
    bool empty () const noexcept
    bool empty () const noexcept
     Checks whether the index is empty.
     
    fwd_cursor_type fwd_cursor () const noexcept
    fwd_cursor_type fwd_cursor () const noexcept
     Returns a unidirectional seqan3::fm_index_cursor on the original text of the bidirectional index that can be used for searching.
     
    bool operator!= (bi_fm_index const &rhs) const noexcept
    bool operator!= (bi_fm_index const &rhs) const noexcept
     Compares two indices.
     
    bool operator== (bi_fm_index const &rhs) const noexcept
    bool operator== (bi_fm_index const &rhs) const noexcept
     Compares two indices.
     
    size_type size () const noexcept
    size_type size () const noexcept
     Returns the length of the indexed text including sentinel characters.
     
    Constructors, destructor and assignment
    \n- bi_fm_index ()=default
    bi_fm_index ()=default
     Defaulted.
     
    \n- bi_fm_index (bi_fm_index const &)=default
    bi_fm_index (bi_fm_index const &)=default
     Defaulted.
     
    \n-bi_fm_index & operator= (bi_fm_index const &)=default
    operator= (bi_fm_index const &)=default
     Defaulted.
     
    \n- bi_fm_index (bi_fm_index &&)=default
    bi_fm_index (bi_fm_index &&)=default
     Defaulted.
     
    \n-bi_fm_index & operator= (bi_fm_index &&)=default
    operator= (bi_fm_index &&)=default
     Defaulted.
     
    \n- ~bi_fm_index ()=default
    ~bi_fm_index ()=default
     Defaulted.
     
    template<std::ranges::range text_t>
     bi_fm_index (text_t &&text)
     bi_fm_index (text_t &&text)
     Constructor that immediately constructs the index given a range. The range cannot be empty.
     
    \n \n \n+staticconstexprtext_layout \n \n \n

    \n Static Public Attributes

    \n-static constexpr text_layout text_layout_mode = text_layout_mode_
    text_layout_mode = text_layout_mode_
     Indicates whether index is built over a collection.
     
    \n \n \n-\n+template<typenamebi_fm_index_t > \n+\n \n

    \n Friends

    \n-template<typename bi_fm_index_t >
    class bi_fm_index_cursor
    class bi_fm_index_cursor
     
    \n

    Detailed Description

    \n
    template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
    \n class seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >

    The SeqAn Bidirectional FM Index.

    \n
    Template Parameters
    \n \n@@ -247,30 +247,29 @@\n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    #include <seqan3/search/fm_index/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n-
    std::vector<seqan3::dna4> genome{"ATCGATCGAAGGCTAGCTAGCTAAGGGA"_dna4};
    \n-
    seqan3::bi_fm_index index{genome}; // build the index
    \n+
    std::vector<seqan3::dna4> genome{"ATCGATCGAAGGCTAGCTAGCTAAGGGA"_dna4};
    \n+
    seqan3::bi_fm_index index{genome}; // build the index
    \n
    \n-
    auto cur = index.cursor(); // create a cursor
    \n-
    cur.extend_right("GG"_dna4); // search the pattern "GG"
    \n-
    cur.extend_left("AA"_dna4); // search the pattern "AAGG"
    \n-
    seqan3::debug_stream << "Number of hits: " << cur.count() << '\\n'; // outputs: 2
    \n+
    auto cur = index.cursor(); // create a cursor
    \n+
    cur.extend_right("GG"_dna4); // search the pattern "GG"
    \n+
    cur.extend_left("AA"_dna4); // search the pattern "AAGG"
    \n+
    seqan3::debug_stream << "Number of hits: " << cur.count() << '\\n'; // outputs: 2
    \n
    seqan3::debug_stream << "Positions in the genome: ";
    \n-
    for (auto && pos : cur.locate()) // outputs: (0, 8), (0, 22)
    \n+
    for (auto && pos : cur.locate()) // outputs: (0, 8), (0, 22)
    \n
    seqan3::debug_stream << pos << ' ';
    \n
    seqan3::debug_stream << '\\n';
    \n
    return 0;
    \n
    }
    \n-
    seqan3::bi_fm_index_cursor::extend_right
    bool extend_right() noexcept
    Tries to extend the query by the smallest possible character to the right such that the query is foun...
    Definition bi_fm_index_cursor.hpp:328
    \n
    seqan3::bi_fm_index
    The SeqAn Bidirectional FM Index.
    Definition bi_fm_index.hpp:58
    \n-
    seqan3::bi_fm_index::cursor
    cursor_type cursor() const noexcept
    Returns a seqan3::bi_fm_index_cursor on the index that can be used for searching. .
    Definition bi_fm_index.hpp:252
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna4.hpp
    Provides seqan3::dna4, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n
    seqan3
    The main SeqAn3 namespace.
    Definition aligned_sequence_concept.hpp:26
    \n
    all.hpp
    Meta-header for the Search / FM Index submodule .
    \n \n@@ -285,28 +284,28 @@\n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    #include <seqan3/search/fm_index/all.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n-
    std::vector<std::vector<seqan3::dna4>> genomes{"ATCTGACGAAGGCTAGCTAGCTAAGGGA"_dna4,
    \n-
    "TAGCTGAAGCCATTGGCATCTGATCGGACT"_dna4,
    \n-
    "ACTGAGCTCGTC"_dna4,
    \n-
    "TGCATGCACCCATCGACTGACTG"_dna4,
    \n-
    "GTACGTACGTTACG"_dna4};
    \n+
    std::vector<std::vector<seqan3::dna4>> genomes{"ATCTGACGAAGGCTAGCTAGCTAAGGGA"_dna4,
    \n+
    "TAGCTGAAGCCATTGGCATCTGATCGGACT"_dna4,
    \n+
    "ACTGAGCTCGTC"_dna4,
    \n+
    "TGCATGCACCCATCGACTGACTG"_dna4,
    \n+
    "GTACGTACGTTACG"_dna4};
    \n
    \n-
    seqan3::bi_fm_index index{genomes}; // build the index
    \n+
    seqan3::bi_fm_index index{genomes}; // build the index
    \n
    \n-
    auto cur = index.cursor(); // create a cursor
    \n-
    cur.extend_right("GA"_dna4); // search the pattern "GA"
    \n-
    cur.extend_left("CT"_dna4); // search the pattern "CTGA"
    \n-
    seqan3::debug_stream << "Number of hits: " << cur.count() << '\\n'; // outputs: 5
    \n+
    auto cur = index.cursor(); // create a cursor
    \n+
    cur.extend_right("GA"_dna4); // search the pattern "GA"
    \n+
    cur.extend_left("CT"_dna4); // search the pattern "CTGA"
    \n+
    seqan3::debug_stream << "Number of hits: " << cur.count() << '\\n'; // outputs: 5
    \n
    seqan3::debug_stream << "Positions in the genomes: ";
    \n-
    for (auto && pos : cur.locate()) // outputs: (3,16) (2,1) (1,3) (0,2) (1,19)
    \n+
    for (auto && pos : cur.locate()) // outputs: (3,16) (2,1) (1,3) (0,2) (1,19)
    \n
    seqan3::debug_stream << pos << ' ';
    \n
    seqan3::debug_stream << '\\n';
    \n
    return 0;
    \n
    }
    \n
    Attention
    When building an index for a text collection over any alphabet, the symbols with rank 254 and 255 are reserved and may not be used in the text.
    \n

    Constructor & Destructor Documentation

    \n \n@@ -319,17 +318,17 @@\n
    \n template<std::ranges::range text_t>
    \n
    \n \n \n \n@@ -364,15 +363,15 @@\n
    \n template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::bi_fm_index seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::bi_fm_index (text_t && text_t && text)
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    cursor_type seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::cursor cursor_type seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::cursor () const
    \n     		\n@@ -398,15 +397,15 @@\n
    \n template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::empty bool seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::empty () const
    \n     		\n@@ -432,15 +431,15 @@\n
    \n template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    fwd_cursor_type seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::fwd_cursor fwd_cursor_type seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::fwd_cursor () const
    \n     		\n@@ -466,17 +465,17 @@\n
    \n template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
    \n \n \n \n \n@@ -501,17 +500,17 @@\n
    \n template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::operator!= bool seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::operator!= (bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ > const & bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ > const & rhs) const
    \n     		\n inlinenoexcept
    \n \n \n \n@@ -536,15 +535,15 @@\n
    \n template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::operator== bool seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::operator== (bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ > const & bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ > const & rhs) const
    \n     		\n inlinenoexcept
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_type seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::size size_type seqan3::bi_fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >::size () const
    \n     		\n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bi__fm__index__cursor.html", "unified_diff": "@@ -136,146 +136,146 @@\n
    \n
    \n
    [legend]
    \n \n \n \n+using \n \n \n \n \n+using \n \n \n \n \n+using \n \n \n

    \n Public Types

    \n-using index_type = index_t
    index_type = index_t
     Type of the index.
     
    Text types
    \n-using size_type = typename index_type::size_type
    size_type = typename index_type::size_type
     Type for representing positions in the indexed text.
     
    Cursor types
    \n-using fwd_cursor = fm_index_cursor< fm_index< typename index_type::alphabet_type, index_type::text_layout_mode, typename index_type::sdsl_index_type > >
    fwd_cursor = fm_index_cursor< fm_index< typename index_type::alphabet_type, index_type::text_layout_mode, typename index_type::sdsl_index_type > >
     Type for the unidirectional cursor on the original text.
     
    \n \n \n-\n+\n \n \n \n+ \n \n \n \n+bi_fm_index_cursor & \n \n \n \n+ \n \n \n \n+bi_fm_index_cursor & \n \n \n \n+ \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n+std::vector< std::pair< size_type, size_type > > \n \n \n-\n+\n \n \n \n+auto \n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
     bi_fm_index_cursor () noexcept=default
     bi_fm_index_cursor () noexcept=default
     Default constructor. Accessing member functions on a default constructed object is undefined behavior.
     
    \n- bi_fm_index_cursor (bi_fm_index_cursor const &) noexcept=default
    bi_fm_index_cursor (bi_fm_index_cursor const &) noexcept=default
     Defaulted.
     
    \n-bi_fm_index_cursor & operator= (bi_fm_index_cursor const &) noexcept=default
    operator= (bi_fm_index_cursor const &) noexcept=default
     Defaulted.
     
    \n- bi_fm_index_cursor (bi_fm_index_cursor &&) noexcept=default
    bi_fm_index_cursor (bi_fm_index_cursor &&) noexcept=default
     Defaulted.
     
    \n-bi_fm_index_cursor & operator= (bi_fm_index_cursor &&) noexcept=default
    operator= (bi_fm_index_cursor &&) noexcept=default
     Defaulted.
     
    \n- ~bi_fm_index_cursor ()=default
    ~bi_fm_index_cursor ()=default
     Defaulted.
     
    \n- bi_fm_index_cursor (index_t const &_index) noexcept
    bi_fm_index_cursor (index_t const &_index) noexcept
     Construct from given index.
     
    bool operator== (bi_fm_index_cursor const &rhs) const noexcept
    bool operator== (bi_fm_index_cursor const &rhs) const noexcept
     Compares two cursors.
     
    bool operator!= (bi_fm_index_cursor const &rhs) const noexcept
    bool operator!= (bi_fm_index_cursor const &rhs) const noexcept
     Compares two cursors.
     
    bool extend_right () noexcept
    bool extend_right () noexcept
     Tries to extend the query by the smallest possible character to the right such that the query is found in the text. .
     
    bool extend_left () noexcept
    bool extend_left () noexcept
     Tries to extend the query by the smallest possible character to the left such that the query is found in the text. .
     
    template<typename char_t >
    \n-requires std::convertible_to<char_t, index_alphabet_type>
    bool extend_right (char_t const c) noexcept
    template<typename char_t >
    \n+requires std::convertible_to<char_t, index_alphabet_type>
    bool extend_right (char_t const c) noexcept
     Tries to extend the query by the character c to the right.
     
    \n-template<typename char_type >
    \n+template<typename char_type >
    \n requires seqan3::detail::is_char_adaptation_v<char_type>
    bool extend_right (char_type const *cstring) noexcept
    bool extend_right (char_type const *cstring) noexcept
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    template<typename char_t >
    \n-requires std::convertible_to<char_t, index_alphabet_type>
    bool extend_left (char_t const c) noexcept
    template<typename char_t >
    \n+requires std::convertible_to<char_t, index_alphabet_type>
    bool extend_left (char_t const c) noexcept
     Tries to extend the query by the character c to the left.
     
    \n-template<typename char_type >
    \n+template<typename char_type >
    \n requires seqan3::detail::is_char_adaptation_v<char_type>
    bool extend_left (char_type const *cstring) noexcept
    bool extend_left (char_type const *cstring) noexcept
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    template<std::ranges::range seq_t>
    bool extend_right (seq_t &&seq) noexcept
    bool extend_right (seq_t &&seq) noexcept
     Tries to extend the query by seq to the right.
     
    template<std::ranges::range seq_t>
    bool extend_left (seq_t &&seq) noexcept
    bool extend_left (seq_t &&seq) noexcept
     Tries to extend the query by seq to the left.
     
    bool cycle_back () noexcept
    bool cycle_back () noexcept
     Tries to replace the rightmost character of the query by the next lexicographically larger character such that the query is found in the text. .
     
    bool cycle_front () noexcept
    bool cycle_front () noexcept
     Tries to replace the leftmost character of the query by the next lexicographically larger character such that the query is found in the text. .
     
    size_type last_rank () noexcept
    size_type last_rank () noexcept
     Outputs the rightmost respectively leftmost rank depending on whether extend_right() or extend_left() has been called last.
     
    size_type query_length () const noexcept
    size_type query_length () const noexcept
     Returns the depth of the cursor node in the implicit suffix tree, i.e. the length of the sequence searched.
     
    fwd_cursor to_fwd_cursor () const noexcept
    fwd_cursor to_fwd_cursor () const noexcept
     Returns a unidirectional seqan3::fm_index_cursor on the original text. path_label() on the returned unidirectional index cursor will be equal to path_label() on the bidirectional index cursor. cycle_back() and last_char() will be undefined behavior if the last extension on the bidirectional FM index has been to the left. The behavior will be well-defined after the first extension to the right on the unidirectional index.
     
    template<std::ranges::range text_t>
    \n requires (index_t::text_layout_mode == text_layout::single)
    auto path_label (text_t &&text) const noexcept
    auto path_label (text_t &&text) const noexcept
     Returns the searched query.
     
    \n template<std::ranges::range text_t>
    \n requires (index_t::text_layout_mode == text_layout::collection)
    auto path_label (text_t &&text) const noexcept
    auto path_label (text_t &&text) const noexcept
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    size_type count () const noexcept
    size_type count () const noexcept
     Counts the number of occurrences of the searched query in the text.
     
    locate_result_type locate () const
    locate_result_type locate () const
     Locates the occurrences of the searched query in the text.
     
    \n-std::vector< std::pair< size_type, size_type > > locate () const
    locate () const
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    auto lazy_locate () const
    auto lazy_locate () const
     Locates the occurrences of the searched query in the text on demand, i.e. a std::ranges::view is returned and every position is located once it is accessed.
     
    \n-auto lazy_locate () const
    lazy_locate () const
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    \n

    Detailed Description

    \n-
    template<typename index_t>
    \n+
    template<typename index_t>
    \n class seqan3::bi_fm_index_cursor< index_t >

    The SeqAn Bidirectional FM Index Cursor.

    \n
    Template Parameters
    \n \n \n
    index_tThe type of the underlying index; This is normally seqan3::bi_fm_index.
    \n
    \n
    \n@@ -284,15 +284,15 @@\n

    Constructor & Destructor Documentation

    \n \n

    ◆ bi_fm_index_cursor()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n \n \n
    \n \n \n \n \n@@ -315,15 +315,15 @@\n

    Member Function Documentation

    \n \n

    ◆ count()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    seqan3::bi_fm_index_cursor< index_t >::bi_fm_index_cursor (
    \n \n
    \n \n \n \n \n@@ -349,21 +349,21 @@\n \n \n

    ◆ cycle_back()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    size_type seqan3::bi_fm_index_cursor< index_t >::count (
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::cycle_back bool seqan3::bi_fm_index_cursor< index_t >::cycle_back ()
    \n     		\n@@ -387,69 +387,70 @@\n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    seqan3::debug_stream << "Example cycle_back() and cycle_front()\\n";
    \n
    \n-
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n-
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n+
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n+
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n
    \n-
    auto cur = index.cursor(); // create a cursor
    \n+
    auto cur = index.cursor(); // create a cursor
    \n
    // cur.cycle_back(); // cycle_back / cycle_front on begin() is undefined behaviour!
    \n-
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 1
    \n+
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 1
    \n
    \n
    // cur.cycle_front(); // undefined behaviour! only cycle_back() is allowed after extend_right()
    \n-
    cur.cycle_back(); // search the sequence "AAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n-
    \n-
    cur.extend_left('G'_dna4); // search the sequence "GAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "GAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 2
    \n+
    cur.cycle_back(); // search the sequence "AAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    \n+
    cur.extend_left('G'_dna4); // search the sequence "GAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "GAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 2
    \n
    \n
    // cur.cycle_back(); // undefined behaviour! only cycle_front() is allowed after extend_left()
    \n-
    cur.cycle_front(); // search the sequence "TAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n-
    \n-
    cur.cycle_front(); // search the sequence "TAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    cur.cycle_front(); // search the sequence "TAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    \n+
    cur.cycle_front(); // search the sequence "TAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n
    }
    \n
    bi_fm_index.hpp
    Provides the bidirectional seqan3::bi_fm_index.
    \n
    seqan3::bi_fm_index
    The SeqAn Bidirectional FM Index.
    Definition bi_fm_index.hpp:58
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna4.hpp
    Provides seqan3::dna4, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n \n

    Complexity

    \n-

    \"$O(\\Sigma)

    \n+

    \"$O(\\Sigma)

    \n

    It scans linearly over the alphabet starting from the rightmost character until it finds the query with a larger rightmost character.

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n \n \n \n

    ◆ cycle_front()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::cycle_front bool seqan3::bi_fm_index_cursor< index_t >::cycle_front ()
    \n     		\n@@ -473,62 +474,62 @@\n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    seqan3::debug_stream << "Example cycle_back() and cycle_front()\\n";
    \n
    \n-
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n-
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n+
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n+
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n
    \n-
    auto cur = index.cursor(); // create a cursor
    \n+
    auto cur = index.cursor(); // create a cursor
    \n
    // cur.cycle_back(); // cycle_back / cycle_front on begin() is undefined behaviour!
    \n-
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 1
    \n+
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 1
    \n
    \n
    // cur.cycle_front(); // undefined behaviour! only cycle_back() is allowed after extend_right()
    \n-
    cur.cycle_back(); // search the sequence "AAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n-
    \n-
    cur.extend_left('G'_dna4); // search the sequence "GAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "GAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 2
    \n+
    cur.cycle_back(); // search the sequence "AAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    \n+
    cur.extend_left('G'_dna4); // search the sequence "GAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "GAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 2
    \n
    \n
    // cur.cycle_back(); // undefined behaviour! only cycle_front() is allowed after extend_left()
    \n-
    cur.cycle_front(); // search the sequence "TAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n-
    \n-
    cur.cycle_front(); // search the sequence "TAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    cur.cycle_front(); // search the sequence "TAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    \n+
    cur.cycle_front(); // search the sequence "TAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n
    }
    \n

    Complexity

    \n-

    \"$O(\\Sigma)

    \n+

    \"$O(\\Sigma)

    \n

    It scans linearly over the alphabet starting from the leftmost character until it finds the query with a larger leftmost character.

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n \n \n \n

    ◆ extend_left() [1/3]

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::extend_left bool seqan3::bi_fm_index_cursor< index_t >::extend_left ()
    \n     		\n@@ -536,39 +537,39 @@\n
    \n
    \n \n

    Tries to extend the query by the smallest possible character to the left such that the query is found in the text. .

    \n
    Returns
    true if the cursor could extend the query successfully.
    \n

    Complexity

    \n-

    \"$O(\\Sigma)

    \n+

    \"$O(\\Sigma)

    \n

    It scans linearly over the alphabet until it finds the smallest character that is represented by an edge.

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n
    \n \n \n

    ◆ extend_left() [2/3]

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    \n-template<typename char_t >
    \n-requires std::convertible_to<char_t, index_alphabet_type>
    \n+template<typename char_t >
    \n+requires std::convertible_to<char_t, index_alphabet_type>
    \n \n \n \n \n@@ -587,37 +588,37 @@\n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::extend_left bool seqan3::bi_fm_index_cursor< index_t >::extend_left (char_t const char_t const c)
    \n     		\n inlinenoexcept
    \n \n
    [in]cCharacter to extend the query with to the left.
    \n \n \n
    Returns
    true if the cursor could extend the query successfully.
    \n

    Complexity

    \n-

    \"$O(T_{BACKWARD\\_SEARCH})$\"

    \n+

    \"$O(T_{BACKWARD\\_SEARCH})$\"

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n \n \n \n

    ◆ extend_left() [3/3]

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    \n template<std::ranges::range seq_t>
    \n \n \n \n \n@@ -653,44 +654,44 @@\n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    seqan3::debug_stream << "Example extend_left(seq)\\n";
    \n
    \n-
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n-
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n+
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n+
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n
    \n-
    auto cur = index.cursor(); // create a cursor
    \n-
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n-
    cur.extend_left("ATG"_dna4); // extend the query to "ATGAAC"
    \n+
    auto cur = index.cursor(); // create a cursor
    \n+
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n+
    cur.extend_left("ATG"_dna4); // extend the query to "ATGAAC"
    \n
    // The rightmost character of "ATG" is extended to the left first.
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "ATGAAC"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "ATGAAC"
    \n
    }
    \n

    Complexity

    \n-

    \"$|seq|

    \n+

    \"$|seq|

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n \n \n \n

    ◆ extend_right() [1/3]

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::extend_left bool seqan3::bi_fm_index_cursor< index_t >::extend_left (seq_t && seq_t && seq)
    \n     		\n inlinenoexcept
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::extend_right bool seqan3::bi_fm_index_cursor< index_t >::extend_right ()
    \n     		\n@@ -698,39 +699,39 @@\n
    \n
    \n \n

    Tries to extend the query by the smallest possible character to the right such that the query is found in the text. .

    \n
    Returns
    true if the cursor could extend the query successfully.
    \n

    Complexity

    \n-

    \"$O(\\Sigma)

    \n+

    \"$O(\\Sigma)

    \n

    It scans linearly over the alphabet until it finds the smallest character that is represented by an edge.

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n
    \n \n \n

    ◆ extend_right() [2/3]

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    \n-template<typename char_t >
    \n-requires std::convertible_to<char_t, index_alphabet_type>
    \n+template<typename char_t >
    \n+requires std::convertible_to<char_t, index_alphabet_type>
    \n \n \n \n \n@@ -749,37 +750,37 @@\n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::extend_right bool seqan3::bi_fm_index_cursor< index_t >::extend_right (char_t const char_t const c)
    \n     		\n inlinenoexcept
    \n \n
    [in]cCharacter to extend the query with to the right.
    \n \n \n
    Returns
    true if the cursor could extend the query successfully.
    \n

    Complexity

    \n-

    \"$O(T_{BACKWARD\\_SEARCH})$\"

    \n+

    \"$O(T_{BACKWARD\\_SEARCH})$\"

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n \n \n \n

    ◆ extend_right() [3/3]

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    \n template<std::ranges::range seq_t>
    \n \n \n \n \n@@ -799,27 +800,27 @@\n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::extend_right bool seqan3::bi_fm_index_cursor< index_t >::extend_right (seq_t && seq_t && seq)
    \n     		\n inlinenoexcept
    [in]seqSequence to extend the query with to the right.
    \n \n \n
    Returns
    true if the cursor could extend the query successfully.
    \n

    If extending fails in the middle of the sequence, all previous computations are rewound to restore the cursor's state before calling this method.

    \n

    Complexity

    \n-

    \"$|seq|

    \n+

    \"$|seq|

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n
    \n \n \n

    ◆ last_rank()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n \n \n
    \n \n \n \n \n@@ -849,61 +850,61 @@\n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    seqan3::debug_stream << "Example cycle_back() and cycle_front()\\n";
    \n
    \n-
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n-
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n+
    seqan3::dna4_vector genome{"GAATTAATGAAC"_dna4};
    \n+
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n
    \n-
    auto cur = index.cursor(); // create a cursor
    \n+
    auto cur = index.cursor(); // create a cursor
    \n
    // cur.cycle_back(); // cycle_back / cycle_front on begin() is undefined behaviour!
    \n-
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 1
    \n+
    cur.extend_right("AAC"_dna4); // search the sequence "AAC"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 1
    \n
    \n
    // cur.cycle_front(); // undefined behaviour! only cycle_back() is allowed after extend_right()
    \n-
    cur.cycle_back(); // search the sequence "AAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n-
    \n-
    cur.extend_left('G'_dna4); // search the sequence "GAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "GAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 2
    \n+
    cur.cycle_back(); // search the sequence "AAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    \n+
    cur.extend_left('G'_dna4); // search the sequence "GAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "GAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 2
    \n
    \n
    // cur.cycle_back(); // undefined behaviour! only cycle_front() is allowed after extend_left()
    \n-
    cur.cycle_front(); // search the sequence "TAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n-
    \n-
    cur.cycle_front(); // search the sequence "TAAT"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n-
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    cur.cycle_front(); // search the sequence "TAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n+
    \n+
    cur.cycle_front(); // search the sequence "TAAT"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "TAAT"
    \n+
    seqan3::debug_stream << cur.last_rank() << '\\n'; // outputs 3
    \n
    }
    \n

    Complexity

    \n

    Constant.

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n \n \n \n

    ◆ lazy_locate()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    size_type seqan3::bi_fm_index_cursor< index_t >::last_rank (
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    auto seqan3::bi_fm_index_cursor< index_t >::lazy_locate auto seqan3::bi_fm_index_cursor< index_t >::lazy_locate () const
    \n     		\n@@ -911,27 +912,27 @@\n
    \n
    \n \n

    Locates the occurrences of the searched query in the text on demand, i.e. a std::ranges::view is returned and every position is located once it is accessed.

    \n
    Returns
    Positions in the text.
    \n

    Complexity

    \n-

    \"$count()

    \n+

    \"$count()

    \n

    Exceptions

    \n

    Strong exception guarantee (no data is modified in case an exception is thrown).

    \n \n
    \n \n \n

    ◆ locate()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n \n \n
    \n \n \n \n \n@@ -945,35 +946,35 @@\n \n
    locate_result_type seqan3::bi_fm_index_cursor< index_t >::locate (
    \n
    \n \n

    Locates the occurrences of the searched query in the text.

    \n
    Returns
    Positions in the text.
    \n

    Complexity

    \n-

    \"$count()

    \n+

    \"$count()

    \n

    Exceptions

    \n

    Strong exception guarantee (no data is modified in case an exception is thrown).

    \n \n
    \n \n \n

    ◆ operator!=()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n \n \n \n \n@@ -998,23 +999,23 @@\n \n \n

    ◆ operator==()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::operator!= bool seqan3::bi_fm_index_cursor< index_t >::operator!= (bi_fm_index_cursor< index_t > const & bi_fm_index_cursor< index_t > const & rhs) const
    \n     		\n inlinenoexcept
    \n \n \n \n@@ -1039,26 +1040,26 @@\n \n \n

    ◆ path_label()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    \n template<std::ranges::range text_t>
    \n requires (index_t::text_layout_mode == text_layout::single)
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bi_fm_index_cursor< index_t >::operator== bool seqan3::bi_fm_index_cursor< index_t >::operator== (bi_fm_index_cursor< index_t > const & bi_fm_index_cursor< index_t > const & rhs) const
    \n     		\n inlinenoexcept
    \n \n \n \n@@ -1076,27 +1077,27 @@\n
    Parameters
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    auto seqan3::bi_fm_index_cursor< index_t >::path_label auto seqan3::bi_fm_index_cursor< index_t >::path_label (text_t && text_t && text) const
    \n     		\n inlinenoexcept
    \n \n
    [in]textText that was used to build the index.
    \n \n \n

    Complexity

    \n-

    \"$O(SAMPLING\\_RATE

    \n+

    \"$O(SAMPLING\\_RATE

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n
    \n \n \n

    ◆ query_length()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n \n \n
    \n \n \n \n \n@@ -1122,15 +1123,15 @@\n \n \n

    ◆ to_fwd_cursor()

    \n \n
    \n
    \n
    \n-template<typename index_t >
    \n+template<typename index_t >
    \n
    size_type seqan3::bi_fm_index_cursor< index_t >::query_length (
    \n \n
    \n \n \n \n \n@@ -1160,31 +1161,31 @@\n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    seqan3::debug_stream << "Example to_fwd_cursor()\\n";
    \n
    \n-
    seqan3::dna4_vector genome{"GAATTAACGAAC"_dna4};
    \n-
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n+
    seqan3::dna4_vector genome{"GAATTAACGAAC"_dna4};
    \n+
    seqan3::bi_fm_index index{genome}; // build the bidirectional index
    \n
    \n-
    auto cur = index.cursor(); // create a cursor
    \n-
    cur.extend_left("AAC"_dna4); // search the sequence "AAC"
    \n-
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n-
    auto uni_it = cur.to_fwd_cursor(); // unidirectional cursor on the text "GAATTAACGAAC"
    \n-
    seqan3::debug_stream << uni_it.path_label(genome) << '\\n'; // outputs "AAC"
    \n+
    auto cur = index.cursor(); // create a cursor
    \n+
    cur.extend_left("AAC"_dna4); // search the sequence "AAC"
    \n+
    seqan3::debug_stream << cur.path_label(genome) << '\\n'; // outputs "AAC"
    \n+
    auto uni_it = cur.to_fwd_cursor(); // unidirectional cursor on the text "GAATTAACGAAC"
    \n+
    seqan3::debug_stream << uni_it.path_label(genome) << '\\n'; // outputs "AAC"
    \n
    // Undefined behaviour! Cannot be called on the forward cursor if the last extension on the bidirectional
    \n
    // cursor was to the left:
    \n
    // cur.cycle_back();
    \n
    // seqan3::debug_stream << cur.last_rank() << '\\n';
    \n
    \n-
    uni_it.extend_right('G'_dna4); // search the sequence "AACG"
    \n-
    seqan3::debug_stream << uni_it.path_label(genome) << '\\n'; // outputs "AACG"
    \n-
    seqan3::debug_stream << uni_it.last_rank() << '\\n'; // outputs 2
    \n-
    uni_it.cycle_back(); // returns false since there is no sequence "AACT" in the text.
    \n+
    uni_it.extend_right('G'_dna4); // search the sequence "AACG"
    \n+
    seqan3::debug_stream << uni_it.path_label(genome) << '\\n'; // outputs "AACG"
    \n+
    seqan3::debug_stream << uni_it.last_rank() << '\\n'; // outputs 2
    \n+
    uni_it.cycle_back(); // returns false since there is no sequence "AACT" in the text.
    \n
    }
    \n

    Complexity

    \n

    Constant.

    \n

    Exceptions

    \n

    No-throw guarantee.

    \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bitpacked__sequence.html", "unified_diff": "@@ -136,234 +136,234 @@\n
    \n
    \n
    [legend]
    \n
    fwd_cursor seqan3::bi_fm_index_cursor< index_t >::to_fwd_cursor (
    \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Types

    Associated types
    using value_type = alphabet_type
    using value_type = alphabet_type
     Equals the alphabet_type.
     
    using reference = reference_proxy_type
    using reference = reference_proxy_type
     A proxy type (models seqan3::writable_semialphabet) that enables assignment, think of it as value_type &.
     
    using const_reference = alphabet_type
    using const_reference = alphabet_type
     Equals the alphabet_type / value_type.
     
    using iterator = detail::random_access_iterator< bitpacked_sequence >
    using iterator = detail::random_access_iterator< bitpacked_sequence >
     The iterator type of this container (a random access iterator).
     
    using const_iterator = detail::random_access_iterator< bitpacked_sequence const >
    using const_iterator = detail::random_access_iterator< bitpacked_sequence const >
     The const_iterator type of this container (a random access iterator).
     
    using difference_type = std::ranges::range_difference_t< data_type >
    using difference_type = std::ranges::range_difference_t< data_type >
     A signed integer type (usually std::ptrdiff_t)
     
    using size_type = std::ranges::range_size_t< data_type >
    using size_type = std::ranges::range_size_t< data_type >
     An unsigned integer type (usually std::size_t)
     
    \n \n \n \n+ \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprbitpacked_sequence & \n \n \n \n+constexprbitpacked_sequence & \n \n \n \n+ \n \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+requires std::common_reference_with<std::ranges::range_value_t<other_range_t>, value_type>\n+\n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n- bitpacked_sequence ()=default
    bitpacked_sequence ()=default
     Defaulted.
     
    \n-constexpr bitpacked_sequence (bitpacked_sequence const &)=default
    bitpacked_sequence (bitpacked_sequence const &)=default
     Defaulted.
     
    \n-constexpr bitpacked_sequence (bitpacked_sequence &&)=default
    bitpacked_sequence (bitpacked_sequence &&)=default
     Defaulted.
     
    \n-constexpr bitpacked_sequence & operator= (bitpacked_sequence const &)=default
    operator= (bitpacked_sequence const &)=default
     Defaulted.
     
    \n-constexpr bitpacked_sequence & operator= (bitpacked_sequence &&)=default
    operator= (bitpacked_sequence &&)=default
     Defaulted.
     
    \n- ~bitpacked_sequence ()=default
    ~bitpacked_sequence ()=default
     Defaulted.
     
    template<typename other_range_t >
    \n-requires (!std::same_as<bitpacked_sequence, std::remove_cvref_t<other_range_t>>) && std::ranges::input_range<other_range_t> && has_same_value_type_v<other_range_t>
     bitpacked_sequence (other_range_t &&range)
    template<typename other_range_t >
    \n+requires (!std::same_as<bitpacked_sequence, std::remove_cvref_t<other_range_t>>) && std::ranges::input_range<other_range_t> && has_same_value_type_v<other_range_t>
     bitpacked_sequence (other_range_t &&range)
     Construct from a different range.
     
     bitpacked_sequence (size_type const count, value_type const value)
     bitpacked_sequence (size_type const count, value_type const value)
     Construct with count times value.
     
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
     bitpacked_sequence (begin_iterator_type begin_it, end_iterator_type end_it)
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
     bitpacked_sequence (begin_iterator_type begin_it, end_iterator_type end_it)
     Construct from pair of iterators.
     
     bitpacked_sequence (std::initializer_list< value_type > ilist)
     bitpacked_sequence (std::initializer_list< value_type > ilist)
     Construct from std::initializer_list.
     
    bitpacked_sequence & operator= (std::initializer_list< value_type > ilist)
    bitpacked_sequence & operator= (std::initializer_list< value_type > ilist)
     Assign from std::initializer_list.
     
    template<std::ranges::input_range other_range_t>
    \n-requires std::common_reference_with<std::ranges::range_value_t<other_range_t>, value_type>
    void assign (other_range_t &&range)
    void assign (other_range_t &&range)
     Assign from a different range.
     
    void assign (size_type const count, value_type const value)
    void assign (size_type const count, value_type const value)
     Assign with count times value.
     
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    void assign (begin_iterator_type begin_it, end_iterator_type end_it)
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    void assign (begin_iterator_type begin_it, end_iterator_type end_it)
     Assign from pair of iterators.
     
    void assign (std::initializer_list< value_type > ilist)
    void assign (std::initializer_list< value_type > ilist)
     Assign from std::initializer_list.
     
    Iterators
    iterator begin () noexcept
    iterator begin () noexcept
     Returns an iterator to the first element of the container.
     
    const_iterator begin () const noexcept
    const_iterator begin () const noexcept
     Returns an iterator to the first element of the container.
     
    const_iterator cbegin () const noexcept
    const_iterator cbegin () const noexcept
     Returns an iterator to the first element of the container.
     
    iterator end () noexcept
    iterator end () noexcept
     Returns an iterator to the element following the last element of the container.
     
    const_iterator end () const noexcept
    const_iterator end () const noexcept
     Returns an iterator to the element following the last element of the container.
     
    const_iterator cend () const noexcept
    const_iterator cend () const noexcept
     Returns an iterator to the element following the last element of the container.
     
    Element access
    reference at (size_type const i)
    reference at (size_type const i)
     Return the i-th element.
     
    const_reference at (size_type const i) const
    const_reference at (size_type const i) const
     Return the i-th element.
     
    reference operator[] (size_type const i) noexcept
    reference operator[] (size_type const i) noexcept
     Return the i-th element.
     
    const_reference operator[] (size_type const i) const noexcept
    const_reference operator[] (size_type const i) const noexcept
     Return the i-th element.
     
    reference front () noexcept
    reference front () noexcept
     Return the first element. Calling front on an empty container is undefined.
     
    const_reference front () const noexcept
    const_reference front () const noexcept
     Return the first element. Calling front on an empty container is undefined.
     
    reference back () noexcept
    reference back () noexcept
     Return the last element.
     
    const_reference back () const noexcept
    const_reference back () const noexcept
     Return the last element.
     
    constexpr data_type & raw_data () noexcept
    constexpr data_type & raw_data () noexcept
     Provides direct, unsafe access to underlying data structures.
     
    constexpr data_type const & raw_data () const noexcept
    constexpr data_type const & raw_data () const noexcept
     Provides direct, unsafe access to underlying data structures.
     
    Capacity
    bool empty () const noexcept
    bool empty () const noexcept
     Checks whether the container is empty.
     
    size_type size () const noexcept
    size_type size () const noexcept
     Returns the number of elements in the container, i.e. std::distance(begin(), end()).
     
    size_type max_size () const noexcept
    size_type max_size () const noexcept
     Returns the maximum number of elements the container is able to hold due to system or library implementation limitations, i.e. std::distance(begin(), end()) for the largest container.
     
    size_type capacity () const noexcept
    size_type capacity () const noexcept
     Returns the number of elements that the container has currently allocated space for.
     
    void reserve (size_type const new_cap)
    void reserve (size_type const new_cap)
     Increase the capacity to a value that's greater or equal to new_cap.
     
    void shrink_to_fit ()
    void shrink_to_fit ()
     Requests the removal of unused capacity.
     
    Comparison operators
    constexpr bool operator== (bitpacked_sequence const &rhs) const noexcept
    constexpr bool operator== (bitpacked_sequence const &rhs) const noexcept
     Checks whether *this is equal to rhs.
     
    constexpr bool operator!= (bitpacked_sequence const &rhs) const noexcept
    constexpr bool operator!= (bitpacked_sequence const &rhs) const noexcept
     Checks whether *this is not equal to rhs.
     
    constexpr bool operator< (bitpacked_sequence const &rhs) const noexcept
    constexpr bool operator< (bitpacked_sequence const &rhs) const noexcept
     Checks whether *this is less than rhs.
     
    constexpr bool operator> (bitpacked_sequence const &rhs) const noexcept
    constexpr bool operator> (bitpacked_sequence const &rhs) const noexcept
     Checks whether *this is greater than rhs.
     
    constexpr bool operator<= (bitpacked_sequence const &rhs) const noexcept
    constexpr bool operator<= (bitpacked_sequence const &rhs) const noexcept
     Checks whether *this is less than or equal to rhs.
     
    constexpr bool operator>= (bitpacked_sequence const &rhs) const noexcept
    constexpr bool operator>= (bitpacked_sequence const &rhs) const noexcept
     Checks whether *this is greater than or equal to rhs.
     
    \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n \n \n \n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n+constexprvoid \n \n \n

    Modifiers

    void clear () noexcept
    void clear () noexcept
     Removes all elements from the container.
     
    iterator insert (const_iterator pos, value_type const value)
    iterator insert (const_iterator pos, value_type const value)
     Inserts value before position in the container.
     
    iterator insert (const_iterator pos, size_type const count, value_type const value)
    iterator insert (const_iterator pos, size_type const count, value_type const value)
     Inserts count copies of value before position in the container.
     
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    iterator insert (const_iterator pos, begin_iterator_type begin_it, end_iterator_type end_it)
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    iterator insert (const_iterator pos, begin_iterator_type begin_it, end_iterator_type end_it)
     Inserts elements from range [begin_it, end_it) before position in the container.
     
    iterator insert (const_iterator pos, std::initializer_list< value_type > const &ilist)
    iterator insert (const_iterator pos, std::initializer_list< value_type > const &ilist)
     Inserts elements from initializer list before position in the container.
     
    iterator erase (const_iterator begin_it, const_iterator end_it)
     Removes specified elements from the container.
     
    iterator erase (const_iterator pos)
     Removes specified elements from the container.
     
    void push_back (value_type const value)
    void push_back (value_type const value)
     Appends the given element value to the end of the container.
     
    void pop_back ()
    void pop_back ()
     Removes the last element of the container.
     
    void resize (size_type const count)
    void resize (size_type const count)
     Resizes the container to contain count elements.
     
    void resize (size_type const count, value_type const value)
    void resize (size_type const count, value_type const value)
     Resizes the container to contain count elements.
     
    constexpr void swap (bitpacked_sequence &rhs) noexcept
    constexpr void swap (bitpacked_sequence &rhs) noexcept
     Swap contents with another instance.
     
    constexpr void swap (bitpacked_sequence &&rhs) noexcept
    constexpr void swap (bitpacked_sequence &&rhs) noexcept
     Swap contents with another instance.
     
    constexpr void swap (bitpacked_sequence &lhs, bitpacked_sequence &rhs) noexcept
    constexpr void swap (bitpacked_sequence &lhs, bitpacked_sequence &rhs) noexcept
     Swap contents with another instance.
     
    \n-constexpr void swap (bitpacked_sequence &&lhs, bitpacked_sequence &&rhs) noexcept
    swap (bitpacked_sequence &&lhs, bitpacked_sequence &&rhs) noexcept
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    \n

    Detailed Description

    \n
    template<writable_semialphabet alphabet_type>
    \n requires std::regular<alphabet_type>
    \n class seqan3::bitpacked_sequence< alphabet_type >

    A space-optimised version of std::vector that compresses multiple letters into a single byte.

    \n@@ -385,19 +385,19 @@\n
    #include <seqan3/alphabet/container/bitpacked_sequence.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    std::vector<seqan3::dna4> v0{"ACGT"_dna4}; // data occupies 4 bytes in memory
    \n-
    seqan3::bitpacked_sequence<seqan3::dna4> v1{"ACGT"_dna4}; // data occupies 1 byte in memory
    \n+
    std::vector<seqan3::dna4> v0{"ACGT"_dna4}; // data occupies 4 bytes in memory
    \n+
    seqan3::bitpacked_sequence<seqan3::dna4> v1{"ACGT"_dna4}; // data occupies 1 byte in memory
    \n
    }
    \n
    bitpacked_sequence.hpp
    Provides seqan3::bitpacked_sequence.
    \n-
    seqan3::bitpacked_sequence
    A space-optimised version of std::vector that compresses multiple letters into a single byte.
    Definition bitpacked_sequence.hpp:63
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    dna4.hpp
    Provides seqan3::dna4, container aliases and string literals.
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n \n

    Thread safety

    \n

    This container provides no thread-safety beyond the promise given also by the STL that all calls to const member function are safe from multiple threads (as long as no thread calls a non-const member function at the same time).

    \n

    An important difference to std::vector is that calling vec[i] = value; and vec[j] = value2; from two different threads at the same time is not safe and will lead to corruption if both values are stored in the same 64bit-block, i.e. if the distance between i and j is smaller than 64 / alphabet_size.

    \n

    This entity is stable. Since version 3.1.

    \n@@ -407,15 +407,15 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n- \n+ \n \n
    using seqan3::bitpacked_sequence< alphabet_type >::const_iterator = detail::random_access_iterator<bitpacked_sequence const>using seqan3::bitpacked_sequence< alphabet_type >::const_iterator = detail::random_access_iterator<bitpacked_sequence const>
    \n
    \n \n

    The const_iterator type of this container (a random access iterator).

    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -426,15 +426,15 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n- \n+ \n \n
    using seqan3::bitpacked_sequence< alphabet_type >::const_reference = alphabet_typeusing seqan3::bitpacked_sequence< alphabet_type >::const_reference = alphabet_type
    \n
    \n \n

    Equals the alphabet_type / value_type.

    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -445,15 +445,15 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n- \n+ \n \n
    using seqan3::bitpacked_sequence< alphabet_type >::difference_type = std::ranges::range_difference_t<data_type>using seqan3::bitpacked_sequence< alphabet_type >::difference_type = std::ranges::range_difference_t<data_type>
    \n
    \n \n

    A signed integer type (usually std::ptrdiff_t)

    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -464,15 +464,15 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n- \n+ \n \n
    using seqan3::bitpacked_sequence< alphabet_type >::iterator = detail::random_access_iterator<bitpacked_sequence>using seqan3::bitpacked_sequence< alphabet_type >::iterator = detail::random_access_iterator<bitpacked_sequence>
    \n
    \n \n

    The iterator type of this container (a random access iterator).

    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -483,15 +483,15 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n- \n+ \n \n
    using seqan3::bitpacked_sequence< alphabet_type >::reference = reference_proxy_typeusing seqan3::bitpacked_sequence< alphabet_type >::reference = reference_proxy_type
    \n
    \n \n

    A proxy type (models seqan3::writable_semialphabet) that enables assignment, think of it as value_type &.

    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -502,15 +502,15 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n- \n+ \n \n
    using seqan3::bitpacked_sequence< alphabet_type >::size_type = std::ranges::range_size_t<data_type>using seqan3::bitpacked_sequence< alphabet_type >::size_type = std::ranges::range_size_t<data_type>
    \n
    \n \n

    An unsigned integer type (usually std::size_t)

    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -521,15 +521,15 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n- \n+ \n \n
    using seqan3::bitpacked_sequence< alphabet_type >::value_type = alphabet_typeusing seqan3::bitpacked_sequence< alphabet_type >::value_type = alphabet_type
    \n
    \n \n

    Equals the alphabet_type.

    \n

    This entity is stable. Since version 3.1.

    \n \n@@ -540,24 +540,24 @@\n

    ◆ bitpacked_sequence() [1/4]

    \n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n-template<typename other_range_t >
    \n-requires (!std::same_as<bitpacked_sequence, std::remove_cvref_t<other_range_t>>) && std::ranges::input_range<other_range_t> && has_same_value_type_v<other_range_t>
    \n+template<typename other_range_t >
    \n+requires (!std::same_as<bitpacked_sequence, std::remove_cvref_t<other_range_t>>) && std::ranges::input_range<other_range_t> && has_same_value_type_v<other_range_t>
    \n \n \n \n \n@@ -596,21 +596,21 @@\n
    \n \n \n \n \n- \n+ \n \n \n \n
    seqan3::bitpacked_sequence< alphabet_type >::bitpacked_sequence (other_range_t && other_range_t && range)
    \n     		\n inlineexplicit
    \n \n
    \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -627,45 +627,45 @@\n
    seqan3::bitpacked_sequence< alphabet_type >::bitpacked_sequence (size_type const size_type const count,
    value_type const value_type const value 
    )
    \n \n \n
    [in]countNumber of elements.
    [in]valueThe initial value to be assigned.
    \n \n \n

    Complexity

    \n-

    In \"$O(count)$\".

    \n+

    In \"$O(count)$\".

    \n

    Exceptions

    \n

    Strong exception guarantee (no data is modified in case an exception is thrown).

    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n \n

    ◆ bitpacked_sequence() [3/4]

    \n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n-template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    \n+template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    \n \n \n
    \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -746,30 +746,30 @@\n

    ◆ assign() [1/4]

    \n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n-template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    \n+template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    \n
    seqan3::bitpacked_sequence< alphabet_type >::bitpacked_sequence (begin_iterator_type begin_iterator_type begin_it,
    end_iterator_type end_iterator_type end_it 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -809,23 +809,23 @@\n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n template<std::ranges::input_range other_range_t>
    \n-requires std::common_reference_with<std::ranges::range_value_t<other_range_t>, value_type>
    \n+requires std::common_reference_with<std::ranges::range_value_t<other_range_t>, value_type>
    \n
    void seqan3::bitpacked_sequence< alphabet_type >::assign void seqan3::bitpacked_sequence< alphabet_type >::assign (begin_iterator_type begin_iterator_type begin_it,
    end_iterator_type end_iterator_type end_it 
    )
    \n \n \n \n@@ -862,23 +862,23 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::assign void seqan3::bitpacked_sequence< alphabet_type >::assign (other_range_t && other_range_t && range)
    \n     		\n inline
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -895,15 +895,15 @@\n
    void seqan3::bitpacked_sequence< alphabet_type >::assign void seqan3::bitpacked_sequence< alphabet_type >::assign (size_type const size_type const count,
    value_type const value_type const value 
    )
    \n \n \n
    [in]countNumber of elements.
    [in]valueThe initial value to be assigned.
    \n \n \n

    Complexity

    \n-

    In \"$O(count)$\".

    \n+

    In \"$O(count)$\".

    \n

    Exceptions

    \n

    Strong exception guarantee (no data is modified in case an exception is thrown).

    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n \n@@ -914,15 +914,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n \n@@ -957,15 +957,15 @@\n
    \n \n \n- \n+ \n \n \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::assign void seqan3::bitpacked_sequence< alphabet_type >::assign (std::initializer_list< value_type > ilist)
    \n
    \n \n \n \n@@ -1005,15 +1005,15 @@\n
    \n \n \n \n \n- \n+ \n \n \n \n
    reference seqan3::bitpacked_sequence< alphabet_type >::at (size_type const size_type const i)
    \n     		\n inline
    \n \n \n \n@@ -1302,15 +1302,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n \n \n- \n+ \n \n \n \n
    const_reference seqan3::bitpacked_sequence< alphabet_type >::at (size_type const size_type const i) const
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::clear void seqan3::bitpacked_sequence< alphabet_type >::clear ()
    \n     		\n@@ -1336,15 +1336,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::bitpacked_sequence< alphabet_type >::empty bool seqan3::bitpacked_sequence< alphabet_type >::empty () const
    \n     		\n@@ -1610,36 +1610,36 @@\n

    ◆ insert() [1/4]

    \n \n
    \n
    \n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n-template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    \n+template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sentinel_for<end_iterator_type, begin_iterator_type> && std::common_reference_with<std::iter_value_t<begin_iterator_type>, value_type>
    \n \n \n
    \n \n \n \n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1694,21 +1694,21 @@\n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1755,15 +1755,15 @@\n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1809,15 +1809,15 @@\n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1890,17 +1890,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    iterator seqan3::bitpacked_sequence< alphabet_type >::insert (const_iterator pos,
    begin_iterator_type begin_iterator_type begin_it,
    end_iterator_type end_iterator_type end_it 
    )
    (const_iterator pos,
    size_type const size_type const count,
    value_type const value_type const value 
    )
    (const_iterator pos,
    std::initializer_list< value_type > const & std::initializer_list< value_type > const & ilist 
    )
    (const_iterator pos,
    value_type const value_type const value 
    )
    \n \n \n \n@@ -1921,17 +1921,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator!= constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator!= (bitpacked_sequence< alphabet_type > const & bitpacked_sequence< alphabet_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -1952,17 +1952,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator< constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator< (bitpacked_sequence< alphabet_type > const & bitpacked_sequence< alphabet_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2024,17 +2024,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator<= constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator<= (bitpacked_sequence< alphabet_type > const & bitpacked_sequence< alphabet_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2055,17 +2055,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator== constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator== (bitpacked_sequence< alphabet_type > const & bitpacked_sequence< alphabet_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2086,17 +2086,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator> constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator> (bitpacked_sequence< alphabet_type > const & bitpacked_sequence< alphabet_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2119,15 +2119,15 @@\n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator>= constexpr bool seqan3::bitpacked_sequence< alphabet_type >::operator>= (bitpacked_sequence< alphabet_type > const & bitpacked_sequence< alphabet_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2162,15 +2162,15 @@\n
    \n \n \n \n \n- \n+ \n \n \n \n
    const_reference seqan3::bitpacked_sequence< alphabet_type >::operator[] (size_type const size_type const i) const
    \n     		\n inlinenoexcept
    \n \n \n \n@@ -2203,15 +2203,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n \n \n- \n+ \n \n \n \n
    reference seqan3::bitpacked_sequence< alphabet_type >::operator[] (size_type const size_type const i)
    \n     		\n inlinenoexcept
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::pop_back void seqan3::bitpacked_sequence< alphabet_type >::pop_back ()
    \n     		\n@@ -2240,17 +2240,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n \n \n@@ -2282,15 +2282,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::push_back void seqan3::bitpacked_sequence< alphabet_type >::push_back (value_type const value_type const value)
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr data_type const & seqan3::bitpacked_sequence< alphabet_type >::raw_data constexpr data_type const & seqan3::bitpacked_sequence< alphabet_type >::raw_data () const
    \n     		\n@@ -2314,15 +2314,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr data_type & seqan3::bitpacked_sequence< alphabet_type >::raw_data constexpr data_type & seqan3::bitpacked_sequence< alphabet_type >::raw_data ()
    \n     		\n@@ -2346,17 +2346,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n \n \n@@ -2395,17 +2395,17 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::reserve void seqan3::bitpacked_sequence< alphabet_type >::reserve (size_type const size_type const new_cap)
    \n     		\n inline
    \n \n \n \n@@ -2447,23 +2447,23 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::resize void seqan3::bitpacked_sequence< alphabet_type >::resize (size_type const size_type const count)
    \n     		\n inline
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -2510,15 +2510,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    void seqan3::bitpacked_sequence< alphabet_type >::resize void seqan3::bitpacked_sequence< alphabet_type >::resize (size_type const size_type const count,
    value_type const value_type const value 
    )
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::bitpacked_sequence< alphabet_type >::shrink_to_fit void seqan3::bitpacked_sequence< alphabet_type >::shrink_to_fit ()
    \n     		\n@@ -2580,15 +2580,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n \n \n \n@@ -2621,15 +2621,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n \n \n \n \n
    constexpr void seqan3::bitpacked_sequence< alphabet_type >::swap constexpr void seqan3::bitpacked_sequence< alphabet_type >::swap (bitpacked_sequence< alphabet_type > && rhs)
    \n
    \n \n \n@@ -2663,15 +2663,15 @@\n
    \n template<writable_semialphabet alphabet_type>
    \n
    \n \n \n- \n+ \n \n \n \n \n \n
    constexpr void seqan3::bitpacked_sequence< alphabet_type >::swap constexpr void seqan3::bitpacked_sequence< alphabet_type >::swap (bitpacked_sequence< alphabet_type > & rhs)
    \n
    \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1bloom__filter.html", "unified_diff": "@@ -137,88 +137,88 @@\n
    \n
    [legend]
    \n
    constexpr void swap constexpr void swap (bitpacked_sequence< alphabet_type > & lhs,
    \n \n \n \n+ \n \n \n \n+ \n \n \n \n+bloom_filter & \n \n \n \n+ \n \n \n \n+bloom_filter & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n- bloom_filter ()=default
    bloom_filter ()=default
     Defaulted.
     
    \n- bloom_filter (bloom_filter const &)=default
    bloom_filter (bloom_filter const &)=default
     Defaulted.
     
    \n-bloom_filter & operator= (bloom_filter const &)=default
    operator= (bloom_filter const &)=default
     Defaulted.
     
    \n- bloom_filter (bloom_filter &&)=default
    bloom_filter (bloom_filter &&)=default
     Defaulted.
     
    \n-bloom_filter & operator= (bloom_filter &&)=default
    operator= (bloom_filter &&)=default
     Defaulted.
     
    \n- ~bloom_filter ()=default
    ~bloom_filter ()=default
     Defaulted.
     
     bloom_filter (seqan3::bin_size size, seqan3::hash_function_count funs=seqan3::hash_function_count{2u})
     bloom_filter (seqan3::bin_size size, seqan3::hash_function_count funs=seqan3::hash_function_count{2u})
     Construct an uncompressed Bloom Filter.
     
     bloom_filter (bloom_filter< data_layout::uncompressed > const &bf)
     bloom_filter (bloom_filter< data_layout::uncompressed > const &bf)
     Construct a compressed Bloom Filter.
     
    Modifiers
    void emplace (size_t const value) noexcept
    void emplace (size_t const value) noexcept
     Inserts a value into the Bloom Filter.
     
    void reset () noexcept
    void reset () noexcept
     Remove all values from the Bloom Filter by setting all bits to 0.
     
    Lookup
    bool contains (size_t const value) const noexcept
    bool contains (size_t const value) const noexcept
     Check whether a value is present in the Bloom Filter.
     
    Counting
    template<std::ranges::range value_range_t>
    size_t count (value_range_t &&values) const noexcept
    size_t count (value_range_t &&values) const noexcept
     Counts the occurrences for all values in a range.
     
    Capacity
    size_t hash_function_count () const noexcept
    size_t hash_function_count () const noexcept
     Returns the number of hash functions used in the Bloom Filter.
     
    size_t bit_size () const noexcept
    size_t bit_size () const noexcept
     Returns the size of the underlying bitvector.
     
    Access
    constexpr data_type & raw_data () noexcept
    constexpr data_type & raw_data () noexcept
     Provides direct, unsafe access to the underlying data structure.
     
    constexpr data_type const & raw_data () const noexcept
    constexpr data_type const & raw_data () const noexcept
     Provides direct, unsafe access to the underlying data structure.
     
    \n \n \n+staticconstexprdata_layout \n \n \n

    \n Static Public Attributes

    \n-static constexpr data_layout data_layout_mode = data_layout_mode_
    data_layout_mode = data_layout_mode_
     Indicates whether the Bloom Filter is compressed.
     
    \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Friends

    Comparison operators
    bool operator== (bloom_filter const &lhs, bloom_filter const &rhs) noexcept
    bool operator== (bloom_filter const &lhs, bloom_filter const &rhs) noexcept
     Test for equality.
     
    bool operator!= (bloom_filter const &lhs, bloom_filter const &rhs) noexcept
    bool operator!= (bloom_filter const &lhs, bloom_filter const &rhs) noexcept
     Test for inequality.
     
    \n

    Detailed Description

    \n
    template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n class seqan3::bloom_filter< data_layout_mode_ >

    The Bloom Filter. A data structure that efficiently answers set-membership queries.

    \n
    Template Parameters
    \n@@ -249,15 +249,15 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -292,22 +292,23 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/utility/bloom_filter/bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Construct a Bloom Filter that contains 8192 bits and 3 hash functions.
    \n-
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}, seqan3::hash_function_count{3}};
    \n+
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}, seqan3::hash_function_count{3}};
    \n
    \n
    // Construct a Bloom Filter that contains 256 KiBits and the default of 2
    \n
    // hash functions.
    \n
    seqan3::bloom_filter bf2{seqan3::bin_size{1ULL << 20}};
    \n
    }
    \n
    bloom_filter.hpp
    Provides seqan3::bloom_filter.
    \n
    seqan3::bloom_filter
    The Bloom Filter. A data structure that efficiently answers set-membership queries.
    Definition bloom_filter.hpp:82
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::bin_size
    A strong type that represents the number of bits for each bin in the seqan3::interleaved_bloom_filter...
    Definition interleaved_bloom_filter.hpp:40
    \n
    seqan3::hash_function_count
    A strong type that represents the number of hash functions for the seqan3::interleaved_bloom_filter.
    Definition interleaved_bloom_filter.hpp:47
    \n \n \n \n \n

    ◆ bloom_filter() [2/2]

    \n@@ -317,17 +318,17 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n
    seqan3::bloom_filter< data_layout_mode_ >::bloom_filter seqan3::bloom_filter< data_layout_mode_ >::bloom_filter (seqan3::bin_size size,
    \n \n \n \n@@ -349,20 +350,20 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/utility/bloom_filter/bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    // Construct an uncompressed Bloom Filter.
    \n-
    seqan3::bloom_filter bf{seqan3::bin_size{128u}, seqan3::hash_function_count{3}};
    \n+
    seqan3::bloom_filter bf{seqan3::bin_size{128u}, seqan3::hash_function_count{3}};
    \n
    \n
    // Fill `bf` with data.
    \n
    \n
    // Construct an immutable, compressed Bloom Filter.
    \n-
    seqan3::bloom_filter<seqan3::data_layout::compressed> bf2{bf};
    \n+
    seqan3::bloom_filter<seqan3::data_layout::compressed> bf2{bf};
    \n
    }
    \n \n \n \n

    Member Function Documentation

    \n \n

    ◆ bit_size()

    \n@@ -372,15 +373,15 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    seqan3::bloom_filter< data_layout_mode_ >::bloom_filter seqan3::bloom_filter< data_layout_mode_ >::bloom_filter (bloom_filter< data_layout::uncompressed > const & bloom_filter< data_layout::uncompressed > const & bf)
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_t seqan3::bloom_filter< data_layout_mode_ >::bit_size size_t seqan3::bloom_filter< data_layout_mode_ >::bit_size () const
    \n     		\n@@ -402,17 +403,17 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n \n \n \n \n@@ -434,15 +435,15 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    #include <seqan3/utility/bloom_filter/bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    seqan3::bloom_filter bf{seqan3::bin_size{1024u}};
    \n+
    seqan3::bloom_filter bf{seqan3::bin_size{1024u}};
    \n
    bf.emplace(126);
    \n
    bf.emplace(712);
    \n
    bf.emplace(237);
    \n
    \n
    // Query the Bloom Filter.
    \n
    // A return of `false` guarantees the query not being present in the Bloom Filter.
    \n
    // A return of `true` indicates the (probable) presence of the query in the Bloom Filter.
    \n@@ -465,17 +466,17 @@\n
    \n template<std::ranges::range value_range_t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    bool seqan3::bloom_filter< data_layout_mode_ >::contains bool seqan3::bloom_filter< data_layout_mode_ >::contains (size_t const size_t const value) const
    \n     		\n inlinenoexcept
    \n \n \n \n@@ -506,31 +507,31 @@\n
    #include <seqan3/search/views/kmer_hash.hpp>
    \n
    #include <seqan3/utility/bloom_filter/bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}, seqan3::hash_function_count{2u}};
    \n+
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}, seqan3::hash_function_count{2u}};
    \n
    \n-
    auto const sequence1 = "ACTGACTGACTGATC"_dna4;
    \n-
    auto const sequence2 = "GTGACTGACTGACTCG"_dna4;
    \n-
    auto const sequence3 = "AAAAAAACGATCGACA"_dna4;
    \n-
    auto kmers = seqan3::views::kmer_hash(seqan3::ungapped{5u});
    \n+
    auto const sequence1 = "ACTGACTGACTGATC"_dna4;
    \n+
    auto const sequence2 = "GTGACTGACTGACTCG"_dna4;
    \n+
    auto const sequence3 = "AAAAAAACGATCGACA"_dna4;
    \n+
    auto kmers = seqan3::views::kmer_hash(seqan3::ungapped{5u});
    \n
    \n
    // Insert all 5-mers of sequence1
    \n-
    for (auto && value : sequence1 | kmers)
    \n-
    bf.emplace(value);
    \n+
    for (auto && value : sequence1 | kmers)
    \n+
    bf.emplace(value);
    \n
    \n
    // Insert all 5-mers of sequence3
    \n-
    for (auto && value : sequence3 | kmers)
    \n-
    bf.emplace(value);
    \n+
    for (auto && value : sequence3 | kmers)
    \n+
    bf.emplace(value);
    \n
    \n
    // Count all 5-mers of sequence2
    \n-
    seqan3::debug_stream << bf.count(sequence2 | kmers) << '\\n'; // 9
    \n+
    seqan3::debug_stream << bf.count(sequence2 | kmers) << '\\n'; // 9
    \n
    }
    \n
    seqan3::bloom_filter::emplace
    void emplace(size_t const value) noexcept
    Inserts a value into the Bloom Filter.
    Definition bloom_filter.hpp:204
    \n
    dna4.hpp
    Provides seqan3::dna4, container aliases and string literals.
    \n
    seqan3::views::kmer_hash
    constexpr auto kmer_hash
    Computes hash values for each position of a range via a given shape.
    Definition kmer_hash.hpp:766
    \n
    kmer_hash.hpp
    Provides seqan3::views::kmer_hash.
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n
    seqan3::ungapped
    A strong type of underlying type uint8_t that represents the ungapped shape size.
    Definition shape.hpp:22
    \n@@ -547,17 +548,17 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    size_t seqan3::bloom_filter< data_layout_mode_ >::count size_t seqan3::bloom_filter< data_layout_mode_ >::count (value_range_t && value_range_t && values) const
    \n     		\n inlinenoexcept
    \n \n \n \n@@ -578,15 +579,15 @@\n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/utility/bloom_filter/bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}};
    \n+
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}};
    \n
    \n
    // Insert the values `126`, `712` and `237` into the Bloom Filter.
    \n
    bf.emplace(126);
    \n
    bf.emplace(712);
    \n
    bf.emplace(237);
    \n
    }
    \n \n@@ -600,15 +601,15 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::bloom_filter< data_layout_mode_ >::emplace void seqan3::bloom_filter< data_layout_mode_ >::emplace (size_t const size_t const value)
    \n     		\n inlinenoexcept
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_t seqan3::bloom_filter< data_layout_mode_ >::hash_function_count size_t seqan3::bloom_filter< data_layout_mode_ >::hash_function_count () const
    \n     		\n@@ -630,15 +631,15 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr data_type const & seqan3::bloom_filter< data_layout_mode_ >::raw_data constexpr data_type const & seqan3::bloom_filter< data_layout_mode_ >::raw_data () const
    \n     		\n@@ -661,15 +662,15 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr data_type & seqan3::bloom_filter< data_layout_mode_ >::raw_data constexpr data_type & seqan3::bloom_filter< data_layout_mode_ >::raw_data ()
    \n     		\n@@ -692,15 +693,15 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::bloom_filter< data_layout_mode_ >::reset void seqan3::bloom_filter< data_layout_mode_ >::reset ()
    \n     		\n@@ -722,37 +723,37 @@\n
    #include <seqan3/search/views/kmer_hash.hpp>
    \n
    #include <seqan3/utility/bloom_filter/bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}, seqan3::hash_function_count{2u}};
    \n+
    seqan3::bloom_filter bf{seqan3::bin_size{8192u}, seqan3::hash_function_count{2u}};
    \n
    \n-
    auto const sequence1 = "ACTGACTGACTGATC"_dna4;
    \n-
    auto const sequence2 = "GTGACTGACTGACTCG"_dna4;
    \n-
    auto const sequence3 = "AAAAAAACGATCGACA"_dna4;
    \n-
    auto kmers = seqan3::views::kmer_hash(seqan3::ungapped{5u});
    \n+
    auto const sequence1 = "ACTGACTGACTGATC"_dna4;
    \n+
    auto const sequence2 = "GTGACTGACTGACTCG"_dna4;
    \n+
    auto const sequence3 = "AAAAAAACGATCGACA"_dna4;
    \n+
    auto kmers = seqan3::views::kmer_hash(seqan3::ungapped{5u});
    \n
    \n
    // Insert all 5-mers of sequence1
    \n-
    for (auto && value : sequence1 | kmers)
    \n-
    bf.emplace(value);
    \n+
    for (auto && value : sequence1 | kmers)
    \n+
    bf.emplace(value);
    \n
    \n
    // Insert all 5-mers of sequence3
    \n-
    for (auto && value : sequence3 | kmers)
    \n-
    bf.emplace(value);
    \n+
    for (auto && value : sequence3 | kmers)
    \n+
    bf.emplace(value);
    \n
    \n
    // Count all 5-mers of sequence2
    \n-
    seqan3::debug_stream << bf.count(sequence2 | kmers) << '\\n'; // 9
    \n+
    seqan3::debug_stream << bf.count(sequence2 | kmers) << '\\n'; // 9
    \n
    \n
    // Reset the Bloom Filter
    \n-
    bf.reset();
    \n+
    bf.reset();
    \n
    \n
    // After reset, no 5-mers are found
    \n-
    seqan3::debug_stream << bf.count(sequence2 | kmers) << '\\n'; // 0
    \n+
    seqan3::debug_stream << bf.count(sequence2 | kmers) << '\\n'; // 0
    \n
    }
    \n \n \n \n

    Friends And Related Symbol Documentation

    \n \n

    ◆ operator!=

    \n@@ -762,23 +763,23 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -810,23 +811,23 @@\n
    \n template<data_layout data_layout_mode_ = data_layout::uncompressed>
    \n
    bool operator!= bool operator!= (bloom_filter< data_layout_mode_ > const & bloom_filter< data_layout_mode_ > const & lhs,
    bloom_filter< data_layout_mode_ > const & bloom_filter< data_layout_mode_ > const & rhs 
    )
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1cigar.html", "unified_diff": "@@ -135,151 +135,151 @@\n \n
    \n
    \n
    [legend]
    \n
    bool operator== bool operator== (bloom_filter< data_layout_mode_ > const & bloom_filter< data_layout_mode_ > const & lhs,
    bloom_filter< data_layout_mode_ > const & bloom_filter< data_layout_mode_ > const & rhs 
    )
    \n \n-\n+\n \n \n

    \n Public Types

    using operation = exposition_only::cigar_operation
    using operation = exposition_only::cigar_operation
     The (extended) cigar operation alphabet of M,D,I,H,N,P,S,X,=.
     
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprcigar & \n \n \n \n+constexprcigar & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr cigar () noexcept=default
    cigar () noexcept=default
     Defaulted.
     
    \n-constexpr cigar (cigar const &) noexcept=default
    cigar (cigar const &) noexcept=default
     Defaulted.
     
    \n-constexpr cigar (cigar &&) noexcept=default
    cigar (cigar &&) noexcept=default
     Defaulted.
     
    \n-constexpr cigar & operator= (cigar const &) noexcept=default
    operator= (cigar const &) noexcept=default
     Defaulted.
     
    \n-constexpr cigar & operator= (cigar &&) noexcept=default
    operator= (cigar &&) noexcept=default
     Defaulted.
     
    \n- ~cigar () noexcept=default
    ~cigar () noexcept=default
     Defaulted.
     
    constexpr cigar (component_type const alph) noexcept
    constexpr cigar (component_type const alph) noexcept
     Construction via a value of one of the components.
     
    constexpr cigar & operator= (component_type const alph) noexcept
    constexpr cigar & operator= (component_type const alph) noexcept
     Assignment via a value of one of the components.
     
    Read functions
    small_string< 11 > to_string () const noexcept
    small_string< 11 > to_string () const noexcept
     Return the string representation.
     
    Write functions
    cigar & assign_string (std::string_view const input) noexcept
    cigar & assign_string (std::string_view const input) noexcept
     Assign from a std::string_view.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_tuple_base< cigar, uint32_t, exposition_only::cigar_operation >
    \n-constexpr alphabet_tuple_base (component_types... components) noexcept
    alphabet_tuple_base (component_types... components) noexcept
     Construction from initialiser-list.
     
    constexpr alphabet_tuple_base (component_type const alph) noexcept
    constexpr alphabet_tuple_base (component_type const alph) noexcept
     Construction via a value of one of the components.
     
    constexpr alphabet_tuple_base (indirect_component_type const alph) noexcept
    constexpr alphabet_tuple_base (indirect_component_type const alph) noexcept
     Construction via a value of a subtype that is assignable to one of the components.
     
    constexpr cigar & operator= (component_type const alph) noexcept
    constexpr cigar & operator= (component_type const alph) noexcept
     Assignment via a value of one of the components.
     
    constexpr cigar & operator= (indirect_component_type const alph) noexcept
    constexpr cigar & operator= (indirect_component_type const alph) noexcept
     Assignment via a value of a subtype that is assignable to one of the components.
     
    constexpr operator type () const noexcept
    constexpr operator type () const noexcept
     Implicit cast to a single letter. Works only if the type is unique in the type list.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n \n \n

    \n Friends

    Get functions
    template<size_t index>
    constexpr auto get (cigar &l) noexcept
    constexpr auto get (cigar &l) noexcept
     Tuple-like access to the contained components.
     
    template<typename type >
    constexpr auto get (cigar &l) noexcept
    template<typename type >
    constexpr auto get (cigar &l) noexcept
     Tuple-like access to the contained components.
     
    \"-\"/ Friends inherited from seqan3::alphabet_tuple_base< cigar, uint32_t, exposition_only::cigar_operation >
    Comparison operators
    \n \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    Other literals
    constexpr cigar::operation operator""_cigar_operation (char const c) noexcept
    constexpr cigar::operation operator""_cigar_operation (char const c) noexcept
     The seqan3::cigar::operation char literal.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The seqan3::cigar semialphabet pairs a counter with a seqan3::cigar::operation letter.

    \n

    This semialphabet represents a unit in a CIGAR string, typically found in the SAM and BAM formats. It consists of a number and a seqan3::cigar::operation symbol.

    \n

    It has a \"visual representation\", but since this is a string and not a char, the type only models seqan3::writable_semialphabet and not seqan3::writable_alphabet. Members for reading/writing the string are provided.

    \n@@ -315,38 +315,38 @@\n
    #include <seqan3/alphabet/cigar/cigar.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::cigar letter{12, 'M'_cigar_operation};
    \n+
    seqan3::cigar letter{12, 'M'_cigar_operation};
    \n
    \n-
    letter.assign_string("10D");
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "10D"
    \n+
    letter.assign_string("10D");
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "10D"
    \n
    \n-
    letter.assign_string("20Z"); // Unknown strings are implicitly converted to 0P.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "0P"
    \n+
    letter.assign_string("20Z"); // Unknown strings are implicitly converted to 0P.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "0P"
    \n
    }
    \n
    cigar.hpp
    Provides the seqan3::cigar alphabet.
    \n
    seqan3::cigar
    The seqan3::cigar semialphabet pairs a counter with a seqan3::cigar::operation letter.
    Definition alphabet/cigar/cigar.hpp:57
    \n-
    seqan3::cigar::assign_string
    cigar & assign_string(std::string_view const input) noexcept
    Assign from a std::string_view.
    Definition alphabet/cigar/cigar.hpp:167
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n
    See also
    https://samtools.github.io/hts-specs/SAMv1.pdf#page=8
    \n

    Member Typedef Documentation

    \n \n

    ◆ operation

    \n \n
    \n
    \n \n \n- \n+ \n \n
    using seqan3::cigar::operation = exposition_only::cigar_operationusing seqan3::cigar::operation = exposition_only::cigar_operation
    \n
    \n \n

    The (extended) cigar operation alphabet of M,D,I,H,N,P,S,X,=.

    \n

    The CIGAR string can be either basic or extended. The only difference in the extended cigar alphabet is that aligned bases are classified as an actual match ('=') or mismatch ('X'). In contrast, the basic cigar alphabet only indicated the aligned status with an 'M', without further information if the bases are actually equal or not.

    \n

    The main purpose of the seqan3::cigar::operation alphabet is to be used in the seqan3::cigar composition, where a cigar operation is paired with a count value.

    \n@@ -380,23 +380,22 @@\n
    #include <seqan3/alphabet/cigar/cigar.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::cigar::operation letter{'M'_cigar_operation};
    \n+
    seqan3::cigar::operation letter{'M'_cigar_operation};
    \n
    \n-
    letter.assign_char('D');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "D"
    \n+
    letter.assign_char('D');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "D"
    \n
    \n-
    letter.assign_char('Z'); // Unknown characters are implicitly converted to M.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "M"
    \n+
    letter.assign_char('Z'); // Unknown characters are implicitly converted to M.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "M"
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n
    seqan3::exposition_only::cigar_operation
    The actual implementation of seqan3::cigar::operation for documentation purposes only.
    Definition cigar_operation.hpp:45
    \n
    Note
    Usually you do not want to manipulate cigar elements and vectors on your own but convert an alignment to a cigar and back. See seqan3::cigar_from_alignment for how to convert two aligned sequences into a cigar_vector.
    \n
    See also
    https://samtools.github.io/hts-specs/SAMv1.pdf#page=8
    \n

    This entity is stable. Since version 3.1.

    \n \n
    \n \n@@ -407,17 +406,17 @@\n
    \n
    \n \n \n \n \n@@ -446,24 +445,24 @@\n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    // creates 10M, as the cigar_op field is not provided.
    \n-
    seqan3::cigar letter1{10};
    \n-
    seqan3::debug_stream << "letter1: " << letter1 << '\\n'; // 10M
    \n+
    seqan3::cigar letter1{10};
    \n+
    seqan3::debug_stream << "letter1: " << letter1 << '\\n'; // 10M
    \n
    \n
    // creates 0I, as the integer field is not provided.
    \n-
    seqan3::cigar letter2{'I'_cigar_operation};
    \n-
    seqan3::debug_stream << "letter2: " << letter2 << '\\n'; // 0I
    \n+
    seqan3::cigar letter2{'I'_cigar_operation};
    \n+
    seqan3::debug_stream << "letter2: " << letter2 << '\\n'; // 0I
    \n
    \n
    // creates 10I, as both fields are explicitly given.
    \n-
    seqan3::cigar letter3{10, 'I'_cigar_operation};
    \n-
    seqan3::debug_stream << "letter3: " << letter3 << '\\n'; // 10I
    \n+
    seqan3::cigar letter3{10, 'I'_cigar_operation};
    \n+
    seqan3::debug_stream << "letter3: " << letter3 << '\\n'; // 10I
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n

    Member Function Documentation

    \n \n@@ -474,15 +473,15 @@\n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::cigar::cigar constexpr seqan3::cigar::cigar (component_type const component_type const alph)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -497,17 +496,17 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/alphabet/cigar/cigar.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    std::string cigar_str{"4S134M"}; // input
    \n+
    std::string cigar_str{"4S134M"}; // input
    \n
    \n-
    seqan3::cigar letter1{};
    \n+
    seqan3::cigar letter1{};
    \n
    seqan3::cigar letter2{};
    \n
    \n
    // Assign from string
    \n
    // convenient but creates an unnecessary string copy "4S"
    \n
    letter1.assign_string(cigar_str.substr(0, 2));
    \n
    letter2.assign_string(cigar_str.substr(2, 4));
    \n
    seqan3::debug_stream << letter1 << '\\n'; // prints 4S
    \n@@ -531,14 +530,15 @@\n
    \n
    // Assign from seqan3::small_string
    \n
    letter2.assign_string(letter1.to_string());
    \n
    seqan3::debug_stream << letter2 << '\\n'; // prints 4S
    \n
    }
    \n \n \n+
    seqan3::cigar::assign_string
    cigar & assign_string(std::string_view const input) noexcept
    Assign from a std::string_view.
    Definition alphabet/cigar/cigar.hpp:167
    \n
    std::string_view::substr
    T substr(T... args)
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.2.

    \n \n \n \n \n

    ◆ operator=()

    \n@@ -546,17 +546,17 @@\n
    \n
    \n
    \n \n \n \n \n- \n+ \n \n \n \n
    cigar & seqan3::cigar::assign_string (std::string_view const std::string_view const input)
    \n     		\n inlinenoexcept
    \n \n \n \n@@ -584,22 +584,22 @@\n
    #include <seqan3/alphabet/cigar/cigar.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::cigar letter{10, 'I'_cigar_operation};
    \n-
    seqan3::debug_stream << "letter: " << letter << '\\n'; // 10I
    \n+
    seqan3::cigar letter{10, 'I'_cigar_operation};
    \n+
    seqan3::debug_stream << "letter: " << letter << '\\n'; // 10I
    \n
    \n-
    letter = 'D'_cigar_operation;
    \n-
    seqan3::debug_stream << "letter: " << letter << '\\n'; // 10D
    \n+
    letter = 'D'_cigar_operation;
    \n+
    seqan3::debug_stream << "letter: " << letter << '\\n'; // 10D
    \n
    \n-
    letter = 20;
    \n-
    seqan3::debug_stream << "letter: " << letter << '\\n'; // 20D
    \n+
    letter = 20;
    \n+
    seqan3::debug_stream << "letter: " << letter << '\\n'; // 20D
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n \n

    ◆ to_string()

    \n@@ -638,15 +638,15 @@\n
    \n template<size_t index>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr cigar & seqan3::cigar::operator= constexpr cigar & seqan3::cigar::operator= (component_type const component_type const alph)
    \n     		\n inlineconstexprnoexcept
    \n \n \n@@ -673,44 +673,44 @@\n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using seqan3::get;
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::cigar letter{10, 'M'_cigar_operation};
    \n+
    seqan3::cigar letter{10, 'M'_cigar_operation};
    \n
    \n
    // Note that this is equivalent to get<uint32_t>(letter)
    \n-
    uint32_t size{get<0>(letter)};
    \n+
    uint32_t size{get<0>(letter)};
    \n
    \n
    // Note that this is equivalent to get<seqan3::cigar::operation>(letter)
    \n-
    seqan3::cigar::operation cigar_char{get<1>(letter)};
    \n+
    seqan3::cigar::operation cigar_char{get<1>(letter)};
    \n
    \n
    seqan3::debug_stream << "Size is " << size << '\\n';
    \n-
    seqan3::debug_stream << "Cigar char is " << cigar_char << '\\n'; // seqan3::debug_stream converts to char on the fly.
    \n+
    seqan3::debug_stream << "Cigar char is " << cigar_char << '\\n'; // seqan3::debug_stream converts to char on the fly.
    \n
    }
    \n
    seqan3::pack_traits::size
    constexpr size_t size
    The size of a type pack.
    Definition type_pack/traits.hpp:143
    \n
    seqan3::get
    constexpr auto const & get(configuration< configs_t... > const &config) noexcept
    This is an overloaded member function, provided for convenience. It differs from the above function o...
    Definition configuration.hpp:412
    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n \n

    ◆ get [2/2]

    \n \n
    \n
    \n
    \n-template<typename type >
    \n+template<typename type >
    \n
    \n \n \n- \n+ \n \n \n \n \n \n
    constexpr auto get constexpr auto get (cigar & l)
    \n
    \n \n \n@@ -736,24 +736,24 @@\n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using seqan3::get;
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::cigar letter{10, 'M'_cigar_operation};
    \n+
    seqan3::cigar letter{10, 'M'_cigar_operation};
    \n
    \n
    // Note that this is equivalent to get<0>(letter)
    \n-
    uint32_t size{get<uint32_t>(letter)};
    \n+
    uint32_t size{get<uint32_t>(letter)};
    \n
    \n
    // Note that this is equivalent to get<1>(letter)
    \n-
    seqan3::cigar::operation cigar_char{get<seqan3::cigar::operation>(letter)};
    \n+
    seqan3::cigar::operation cigar_char{get<seqan3::cigar::operation>(letter)};
    \n
    \n
    seqan3::debug_stream << "Size is " << size << '\\n';
    \n-
    seqan3::debug_stream << "Cigar char is " << cigar_char << '\\n'; // seqan3::debug_stream converts to char on the fly.
    \n+
    seqan3::debug_stream << "Cigar char is " << cigar_char << '\\n'; // seqan3::debug_stream converts to char on the fly.
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n \n

    ◆ operator""_cigar_operation()

    \n@@ -761,17 +761,17 @@\n
    \n
    \n
    \n \n \n- \n+ \n \n \n \n \n \n
    constexpr auto get constexpr auto get (cigar & l)
    \n
    \n \n \n \n@@ -787,16 +787,16 @@\n
    \n
    #include <seqan3/alphabet/cigar/cigar.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::cigar::operation letter1{'M'_cigar_operation};
    \n-
    auto letter2 = 'M'_cigar_operation;
    \n+
    seqan3::cigar::operation letter1{'M'_cigar_operation};
    \n+
    auto letter2 = 'M'_cigar_operation;
    \n
    }
    \n

    This entity is stable. Since version 3.1.

    \n \n \n \n
    The documentation for this class was generated from the following file:
      \n
    • alphabet/cigar/cigar.hpp
      • \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1concatenated__sequences.html", "unified_diff": "@@ -135,297 +135,297 @@\n
      \n
      \n
      [legend]
      \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr cigar::operation operator""_cigar_operation constexpr cigar::operation operator""_cigar_operation (char const char const c)
    \n     		\n related
    \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Types

    Member types
    using value_type = decltype(std::declval< std::decay_t< underlying_container_type > & >()|views::slice(0, 1))
    using value_type = decltype(std::declval< std::decay_t< underlying_container_type > & >()|views::slice(0, 1))
     A views::slice that represents \"one element\", typically a std::span.
     
    using reference = value_type
    using reference = value_type
     A views::slice that represents \"one element\", typically a std::span.
     
    using const_reference = decltype(std::declval< std::decay_t< underlying_container_type > const & >()|views::slice(0, 1))
    using const_reference = decltype(std::declval< std::decay_t< underlying_container_type > const & >()|views::slice(0, 1))
     An immutable views::slice that represents \"one element\", typically a std::span or std::string_view.
     
    using iterator = detail::random_access_iterator< concatenated_sequences >
    using iterator = detail::random_access_iterator< concatenated_sequences >
     The iterator type of this container (a random access iterator).
     
    using const_iterator = detail::random_access_iterator< concatenated_sequences const >
    using const_iterator = detail::random_access_iterator< concatenated_sequences const >
     The const iterator type of this container (a random access iterator).
     
    using difference_type = std::ranges::range_difference_t< data_delimiters_type >
    using difference_type = std::ranges::range_difference_t< data_delimiters_type >
     A signed integer type (usually std::ptrdiff_t)
     
    using size_type = std::ranges::range_size_t< data_delimiters_type >
    using size_type = std::ranges::range_size_t< data_delimiters_type >
     An unsigned integer type (usually std::size_t)
     
    \n \n \n \n+ \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprconcatenated_sequences & \n \n \n \n+constexprconcatenated_sequences & \n \n \n \n+ \n \n \n \n-\n+requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>\n+\n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+requires is_compatible_with_value_type<value_type_t>\n+\n \n \n \n-\n+requires is_compatible_with_value_type<value_type_t>\n+\n \n \n \n-\n+requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>\n+\n \n \n \n-\n+requires (is_compatible_with_value_type<rng_type>)\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n \n \n-\n+\n \n \n \n \n \n-\n+\n \n \n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n \n \n \n \n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+requires is_compatible_with_value_type<rng_type>\n+\n \n \n-\n+\n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n- concatenated_sequences ()=default
    concatenated_sequences ()=default
     Default constructors.
     
    \n-constexpr concatenated_sequences (concatenated_sequences const &)=default
    concatenated_sequences (concatenated_sequences const &)=default
     Default constructors.
     
    \n-constexpr concatenated_sequences (concatenated_sequences &&)=default
    concatenated_sequences (concatenated_sequences &&)=default
     Default constructors.
     
    \n-constexpr concatenated_sequences & operator= (concatenated_sequences const &)=default
    operator= (concatenated_sequences const &)=default
     Default constructors.
     
    \n-constexpr concatenated_sequences & operator= (concatenated_sequences &&)=default
    operator= (concatenated_sequences &&)=default
     Default constructors.
     
    \n- ~concatenated_sequences ()=default
    ~concatenated_sequences ()=default
     Default constructors.
     
    template<std::ranges::input_range rng_of_rng_type>
    \n-requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>
     concatenated_sequences (rng_of_rng_type &&rng_of_rng)
     concatenated_sequences (rng_of_rng_type &&rng_of_rng)
     Construct/assign from a different range.
     
    template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
     concatenated_sequences (size_type const count, rng_type &&value)
     concatenated_sequences (size_type const count, rng_type &&value)
     Construct/assign with count times value.
     
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sized_sentinel_for<end_iterator_type, begin_iterator_type> && iter_value_t_is_compatible_with_value_type<begin_iterator_type>
     concatenated_sequences (begin_iterator_type begin_it, end_iterator_type end_it)
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sized_sentinel_for<end_iterator_type, begin_iterator_type> && iter_value_t_is_compatible_with_value_type<begin_iterator_type>
     concatenated_sequences (begin_iterator_type begin_it, end_iterator_type end_it)
     Construct/assign from pair of iterators.
     
    template<std::ranges::forward_range value_type_t = value_type>
    \n-requires is_compatible_with_value_type<value_type_t>
     concatenated_sequences (std::initializer_list< value_type_t > ilist)
     concatenated_sequences (std::initializer_list< value_type_t > ilist)
     Construct/assign from std::initializer_list.
     
    template<std::ranges::forward_range value_type_t>
    \n-requires is_compatible_with_value_type<value_type_t>
    concatenated_sequences & operator= (std::initializer_list< value_type_t > ilist)
    concatenated_sequences & operator= (std::initializer_list< value_type_t > ilist)
     Construct/assign from std::initializer_list.
     
    template<std::ranges::input_range rng_of_rng_type>
    \n-requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>
    void assign (rng_of_rng_type &&rng_of_rng)
    void assign (rng_of_rng_type &&rng_of_rng)
     Construct/assign from a different range.
     
    template<std::ranges::forward_range rng_type>
    \n-requires (is_compatible_with_value_type<rng_type>)
    void assign (size_type const count, rng_type &&value)
    void assign (size_type const count, rng_type &&value)
     Construct/assign with count times value.
     
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    void assign (begin_iterator_type begin_it, end_iterator_type end_it)
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    void assign (begin_iterator_type begin_it, end_iterator_type end_it)
     Construct/assign from pair of iterators.
     
    template<std::ranges::forward_range rng_type = value_type>
    \n-requires is_compatible_with_value_type<rng_type>
    void assign (std::initializer_list< rng_type > ilist)
    void assign (std::initializer_list< rng_type > ilist)
     Construct/assign from std::initializer_list.
     
    Iterators
    iterator begin () noexcept
    iterator begin () noexcept
     Returns an iterator to the first element of the container.
     
    const_iterator begin () const noexcept
    const_iterator begin () const noexcept
     Returns an iterator to the first element of the container.
     
    const_iterator cbegin () const noexcept
    const_iterator cbegin () const noexcept
     Returns an iterator to the first element of the container.
     
    iterator end () noexcept
    iterator end () noexcept
     Returns an iterator to the element following the last element of the container.
     
    const_iterator end () const noexcept
    const_iterator end () const noexcept
     Returns an iterator to the element following the last element of the container.
     
    const_iterator cend () const noexcept
    const_iterator cend () const noexcept
     Returns an iterator to the element following the last element of the container.
     
    Element access
    reference at (size_type const i)
    reference at (size_type const i)
     Return the i-th element as a view.
     
    const_reference at (size_type const i) const
    const_reference at (size_type const i) const
     Return the i-th element as a view.
     
    reference operator[] (size_type const i)
    reference operator[] (size_type const i)
     Return the i-th element as a view.
     
    const_reference operator[] (size_type const i) const
    const_reference operator[] (size_type const i) const
     Return the i-th element as a view.
     
    reference front ()
     Return the first element as a view. Calling front on an empty container is undefined.
     
    const_reference front () const
    const_reference front () const
     Return the first element as a view. Calling front on an empty container is undefined.
     
    reference back ()
     Return the last element as a view.
     
    const_reference back () const
    const_reference back () const
     Return the last element as a view.
     
    reference concat ()
     Return the concatenation of all members.
     
    const_reference concat () const
    const_reference concat () const
     Return the concatenation of all members.
     
    std::pair< decltype(data_values) &, decltype(data_delimiters) & > raw_data ()
    std::pair< decltype(data_values) &, decltype(data_delimiters) & > raw_data ()
     Provides direct, unsafe access to underlying data structures.
     
    std::pair< decltype(data_values) const &, decltype(data_delimiters) const & > raw_data () const
    std::pair< decltype(data_values) const &, decltype(data_delimiters) const & > raw_data () const
     Provides direct, unsafe access to underlying data structures.
     
    Capacity
    bool empty () const noexcept
    bool empty () const noexcept
     Checks whether the container is empty.
     
    size_type size () const noexcept
    size_type size () const noexcept
     Returns the number of elements in the container, i.e. std::distance(begin(), end()).
     
    size_type max_size () const noexcept
    size_type max_size () const noexcept
     Returns the maximum number of elements the container is able to hold due to system or library implementation limitations, i.e. std::distance(begin(), end()) for the largest container.
     
    size_type capacity () const noexcept
    size_type capacity () const noexcept
     Returns the number of elements that the container has currently allocated space for.
     
    void reserve (size_type const new_cap)
    void reserve (size_type const new_cap)
     Increase the capacity to a value that's greater or equal to new_cap.
     
    void shrink_to_fit ()
    void shrink_to_fit ()
     Requests the removal of unused capacity.
     
    Capacity (concat)
    size_type concat_size () const noexcept
    size_type concat_size () const noexcept
     Returns the cumulative size of all elements in the container.
     
    size_type concat_capacity () const noexcept
    size_type concat_capacity () const noexcept
     Returns the concatenated size the container has currently allocated space for.
     
    void concat_reserve (size_type const new_cap)
    void concat_reserve (size_type const new_cap)
     Increase the concat_capacity() to a value that's greater or equal to new_cap.
     
    Modifiers
    void clear () noexcept
    void clear () noexcept
     Removes all elements from the container.
     
    template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    iterator insert (const_iterator pos, rng_type &&value)
    iterator insert (const_iterator pos, rng_type &&value)
     Inserts value before position in the container.
     
    template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    iterator insert (const_iterator pos, size_type const count, rng_type &&value)
    iterator insert (const_iterator pos, size_type const count, rng_type &&value)
     Inserts count copies of value before position in the container.
     
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    iterator insert (const_iterator pos, begin_iterator_type first, end_iterator_type last)
    template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    iterator insert (const_iterator pos, begin_iterator_type first, end_iterator_type last)
     Inserts elements from range [first, last) before position in the container.
     
    template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    iterator insert (const_iterator pos, std::initializer_list< rng_type > const &ilist)
    iterator insert (const_iterator pos, std::initializer_list< rng_type > const &ilist)
     Inserts elements from initializer list before position in the container.
     
    iterator erase (const_iterator first, const_iterator last)
     Removes specified elements from the container.
     
    iterator erase (const_iterator pos)
     Removes specified elements from the container.
     
    template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    void push_back (rng_type &&value)
    void push_back (rng_type &&value)
     Appends the given element value to the end of the container.
     
    void push_back ()
    void push_back ()
     Appends an empty element to the end of the container.
     
    void last_push_back (std::ranges::range_value_t< underlying_container_type > const value)
    void last_push_back (std::ranges::range_value_t< underlying_container_type > const value)
     Appends the given element-of-element value to the end of the underlying container.
     
    template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    void last_append (rng_type &&value)
    void last_append (rng_type &&value)
     Appends the given elements to the end of the underlying container (increases size of last element by n).
     
    void pop_back ()
    void pop_back ()
     Removes the last element of the container.
     
    void resize (size_type const count)
    void resize (size_type const count)
     Resizes the container to contain count elements.
     
    template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    void resize (size_type const count, rng_type &&value)
    void resize (size_type const count, rng_type &&value)
     Resizes the container to contain count elements.
     
    constexpr void swap (concatenated_sequences &rhs) noexcept
    constexpr void swap (concatenated_sequences &rhs) noexcept
     Swap contents with another instance.
     
    constexpr void swap (concatenated_sequences &&rhs) noexcept
    constexpr void swap (concatenated_sequences &&rhs) noexcept
     Swap contents with another instance.
     
    Comparison operators
    constexpr bool operator== (concatenated_sequences const &rhs) const noexcept
    constexpr bool operator== (concatenated_sequences const &rhs) const noexcept
     Checks whether *this is equal to rhs.
     
    constexpr bool operator!= (concatenated_sequences const &rhs) const noexcept
    constexpr bool operator!= (concatenated_sequences const &rhs) const noexcept
     Checks whether *this is not equal to rhs.
     
    constexpr bool operator< (concatenated_sequences const &rhs) const noexcept
    constexpr bool operator< (concatenated_sequences const &rhs) const noexcept
     Checks whether *this is less than rhs.
     
    constexpr bool operator> (concatenated_sequences const &rhs) const noexcept
    constexpr bool operator> (concatenated_sequences const &rhs) const noexcept
     Checks whether *this is greater than rhs.
     
    constexpr bool operator<= (concatenated_sequences const &rhs) const noexcept
    constexpr bool operator<= (concatenated_sequences const &rhs) const noexcept
     Checks whether *this is less than or equal to rhs.
     
    constexpr bool operator>= (concatenated_sequences const &rhs) const noexcept
    constexpr bool operator>= (concatenated_sequences const &rhs) const noexcept
     Checks whether *this is greater than or equal to rhs.
     
    \n \n \n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+\n \n \n

    \n Static Protected Attributes

    Compatibility

    Static constexpr variables that emulate whether the ranges are compatible (which doesn't work for types during their definition).

    \n
    template<std::ranges::range t>
    static constexpr bool is_compatible_with_value_type
    static constexpr bool is_compatible_with_value_type
     Whether a type is compatible with this class's value_type or reference type.
     
    template<typename t >
    static constexpr bool iter_value_t_is_compatible_with_value_type
    template<typename t >
    static constexpr bool iter_value_t_is_compatible_with_value_type
     Whether a type is compatible with this class.
     
    template<std::ranges::range t>
    static constexpr bool range_value_t_is_compatible_with_value_type
    static constexpr bool range_value_t_is_compatible_with_value_type
     Whether a type is compatible with this class.
     
    \n

    Detailed Description

    \n-
    template<typename underlying_container_type, typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n-requires reservible_container<std::remove_reference_t<underlying_container_type>> && reservible_container<std::remove_reference_t<data_delimiters_type>> && std::is_same_v<std::ranges::range_size_t<underlying_container_type>, std::ranges::range_value_t<data_delimiters_type>>
    \n+
    template<typename underlying_container_type, typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+requires reservible_container<std::remove_reference_t<underlying_container_type>> && reservible_container<std::remove_reference_t<data_delimiters_type>> && std::is_same_v<std::ranges::range_size_t<underlying_container_type>, std::ranges::range_value_t<data_delimiters_type>>
    \n class seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >

    Container that stores sequences concatenated internally.

    \n
    Template Parameters
    \n \n \n \n
    underlying_container_typeType of the underlying container. Must satisfy seqan3::reservible_container.
    data_delimiters_typeA container that stores the begin/end positions in the underlying_container_type. Must satifsy seqan3::reservible_container and have underlying_container_type's size_type as value_type.
    \n
    \n@@ -456,60 +456,59 @@\n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::concatenated_sequences<seqan3::dna4_vector> concat1{"ACGT"_dna4, "GAGGA"_dna4};
    \n-
    seqan3::debug_stream << concat1[0] << '\\n'; // "ACGT"
    \n+
    seqan3::concatenated_sequences<seqan3::dna4_vector> concat1{"ACGT"_dna4, "GAGGA"_dna4};
    \n+
    seqan3::debug_stream << concat1[0] << '\\n'; // "ACGT"
    \n
    \n-
    std::vector<seqan3::dna4_vector> concat2{"ACTA"_dna4, "AGGA"_dna4};
    \n+
    std::vector<seqan3::dna4_vector> concat2{"ACTA"_dna4, "AGGA"_dna4};
    \n
    \n-
    concat1 = concat2; // you can assign from other ranges
    \n+
    concat1 = concat2; // you can assign from other ranges
    \n
    \n-
    concat2[0] = "ATTA"_dna4; // this works for vector of vector
    \n-
    concat1[0][1] = 'T'_dna4; // and this works for concatenated_sequences
    \n-
    seqan3::debug_stream << concat1[0] << '\\n'; // "ATTA"
    \n+
    concat2[0] = "ATTA"_dna4; // this works for vector of vector
    \n+
    concat1[0][1] = 'T'_dna4; // and this works for concatenated_sequences
    \n+
    seqan3::debug_stream << concat1[0] << '\\n'; // "ATTA"
    \n
    \n
    // if you know that you will be adding ten vectors of length ten:
    \n-
    std::vector<seqan3::dna4> vector_of_length10{"ACGTACGTAC"_dna4};
    \n+
    std::vector<seqan3::dna4> vector_of_length10{"ACGTACGTAC"_dna4};
    \n
    \n-
    concat1.reserve(10);
    \n-
    concat1.concat_reserve(10 * vector_of_length10.size());
    \n-
    while (concat1.size() < 10)
    \n+
    concat1.reserve(10);
    \n+
    concat1.concat_reserve(10 * vector_of_length10.size());
    \n+
    while (concat1.size() < 10)
    \n
    {
    \n
    // ...
    \n-
    concat1.push_back(vector_of_length10);
    \n+
    concat1.push_back(vector_of_length10);
    \n
    }
    \n
    }
    \n-
    seqan3::concatenated_sequences
    Container that stores sequences concatenated internally.
    Definition concatenated_sequences.hpp:86
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    concatenated_sequences.hpp
    Provides seqan3::concatenated_sequences.
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna4.hpp
    Provides seqan3::dna4, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n-
    std::vector::reserve
    T reserve(T... args)
    \n \n

    Exceptions

    \n

    Whenever a strong exception guarantee is given for this class, it presumes that std::is_nothrow_move_constructible<typename underlying_container_type::value_type> otherwise only basic exception safety can be assumed.

    \n

    Thread safety

    \n

    This container provides no thread-safety beyond the promise given also by the STL that all calls to const member function are safe from multiple threads (as long as no thread calls a non-const member function at the same time).

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n

    Member Typedef Documentation

    \n \n

    ◆ const_iterator

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n- \n+ \n \n
    using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::const_iterator = detail::random_access_iterator<concatenated_sequences const>using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::const_iterator = detail::random_access_iterator<concatenated_sequences const>
    \n
    \n \n

    The const iterator type of this container (a random access iterator).

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n@@ -517,18 +516,18 @@\n
    \n \n

    ◆ const_reference

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n- \n+ \n \n
    using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::const_reference = decltype(std::declval<std::decay_t<underlying_container_type> const &>() | views::slice(0, 1))using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::const_reference = decltype(std::declval<std::decay_t<underlying_container_type> const &>() | views::slice(0, 1))
    \n
    \n \n

    An immutable views::slice that represents \"one element\", typically a std::span or std::string_view.

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n@@ -536,18 +535,18 @@\n
    \n \n

    ◆ difference_type

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n- \n+ \n \n
    using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::difference_type = std::ranges::range_difference_t<data_delimiters_type>using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::difference_type = std::ranges::range_difference_t<data_delimiters_type>
    \n
    \n \n

    A signed integer type (usually std::ptrdiff_t)

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n@@ -555,18 +554,18 @@\n
    \n \n

    ◆ iterator

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n- \n+ \n \n
    using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::iterator = detail::random_access_iterator<concatenated_sequences>using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::iterator = detail::random_access_iterator<concatenated_sequences>
    \n
    \n \n

    The iterator type of this container (a random access iterator).

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n@@ -574,18 +573,18 @@\n
    \n \n

    ◆ reference

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n- \n+ \n \n
    using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::reference = value_typeusing seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::reference = value_type
    \n
    \n \n

    A views::slice that represents \"one element\", typically a std::span.

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n@@ -593,18 +592,18 @@\n
    \n \n

    ◆ size_type

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n- \n+ \n \n
    using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::size_type = std::ranges::range_size_t<data_delimiters_type>using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::size_type = std::ranges::range_size_t<data_delimiters_type>
    \n
    \n \n

    An unsigned integer type (usually std::size_t)

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n@@ -612,18 +611,18 @@\n
    \n \n

    ◆ value_type

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n- \n+ \n \n
    using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::value_type = decltype(std::declval<std::decay_t<underlying_container_type> &>() | views::slice(0, 1))using seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::value_type = decltype(std::declval<std::decay_t<underlying_container_type> &>() | views::slice(0, 1))
    \n
    \n \n

    A views::slice that represents \"one element\", typically a std::span.

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n@@ -632,26 +631,26 @@\n

    Constructor & Destructor Documentation

    \n \n

    ◆ concatenated_sequences() [1/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::input_range rng_of_rng_type>
    \n-requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>
    \n+requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>
    \n \n \n \n \n@@ -682,32 +681,32 @@\n \n \n

    ◆ concatenated_sequences() [2/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences (rng_of_rng_type && rng_of_rng_type && rng_of_rng)
    \n     		\n inline
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -730,45 +729,45 @@\n
    seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences (size_type const size_type const count,
    rng_type && rng_type && value 
    )
    \n \n \n
    countNumber of elements.
    valueThe initial value to be assigned.
    \n \n \n

    Complexity

    \n-

    In \"$O(count*value)$\".

    \n+

    In \"$O(count*value)$\".

    \n

    Exceptions

    \n

    Strong exception guarantee (no data is modified in case an exception is thrown).

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n \n \n \n

    ◆ concatenated_sequences() [3/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n-template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires std::sized_sentinel_for<end_iterator_type, begin_iterator_type> && iter_value_t_is_compatible_with_value_type<begin_iterator_type>
    \n+template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires std::sized_sentinel_for<end_iterator_type, begin_iterator_type> && iter_value_t_is_compatible_with_value_type<begin_iterator_type>
    \n \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -805,26 +804,26 @@\n \n \n

    ◆ concatenated_sequences() [4/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range value_type_t = value_type>
    \n-requires is_compatible_with_value_type<value_type_t>
    \n+requires is_compatible_with_value_type<value_type_t>
    \n
    seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences (begin_iterator_type begin_iterator_type begin_it,
    end_iterator_type end_iterator_type end_it 
    )
    \n \n \n \n@@ -856,32 +855,32 @@\n

    Member Function Documentation

    \n \n

    ◆ assign() [1/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n-template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    \n+template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concatenated_sequences (std::initializer_list< value_type_t > std::initializer_list< value_type_t > ilist)
    \n     		\n inline
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -918,26 +917,26 @@\n \n \n

    ◆ assign() [2/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::input_range rng_of_rng_type>
    \n-requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>
    \n+requires range_value_t_is_compatible_with_value_type<rng_of_rng_type>
    \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign (begin_iterator_type begin_iterator_type begin_it,
    end_iterator_type end_iterator_type end_it 
    )
    \n \n \n \n@@ -968,32 +967,32 @@\n \n \n

    ◆ assign() [3/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires (is_compatible_with_value_type<rng_type>)
    \n+requires (is_compatible_with_value_type<rng_type>)
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign (rng_of_rng_type && rng_of_rng_type && rng_of_rng)
    \n     		\n inline
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1016,39 +1015,39 @@\n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign (size_type const size_type const count,
    rng_type && rng_type && value 
    )
    \n \n \n
    countNumber of elements.
    valueThe initial value to be assigned.
    \n \n \n

    Complexity

    \n-

    In \"$O(count*value)$\".

    \n+

    In \"$O(count*value)$\".

    \n

    Exceptions

    \n

    Strong exception guarantee (no data is modified in case an exception is thrown).

    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n \n \n \n

    ◆ assign() [4/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type = value_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n \n \n \n \n@@ -1079,23 +1078,23 @@\n \n \n

    ◆ at() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::assign (std::initializer_list< rng_type > std::initializer_list< rng_type > ilist)
    \n     		\n inline
    \n \n \n \n@@ -1127,23 +1126,23 @@\n \n \n

    ◆ at() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::at reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::at (size_type const size_type const i)
    \n     		\n inline
    \n \n \n \n@@ -1175,21 +1174,21 @@\n \n \n

    ◆ back() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::at const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::at (size_type const size_type const i) const
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::back reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::back ()
    \n     		\n@@ -1210,21 +1209,21 @@\n \n \n

    ◆ back() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::back const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::back () const
    \n     		\n@@ -1245,21 +1244,21 @@\n \n \n

    ◆ begin() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::begin const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::begin () const
    \n     		\n@@ -1281,21 +1280,21 @@\n \n \n

    ◆ begin() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::begin iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::begin ()
    \n     		\n@@ -1317,21 +1316,21 @@\n \n \n

    ◆ capacity()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::capacity size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::capacity () const
    \n     		\n@@ -1354,21 +1353,21 @@\n \n \n

    ◆ cbegin()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::cbegin const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::cbegin () const
    \n     		\n@@ -1390,21 +1389,21 @@\n \n \n

    ◆ cend()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::cend const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::cend () const
    \n     		\n@@ -1426,21 +1425,21 @@\n \n \n

    ◆ clear()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::clear void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::clear ()
    \n     		\n@@ -1460,21 +1459,21 @@\n \n \n

    ◆ concat() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat ()
    \n     		\n@@ -1496,21 +1495,21 @@\n \n \n

    ◆ concat() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat () const
    \n     		\n@@ -1532,21 +1531,21 @@\n \n \n

    ◆ concat_capacity()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat_capacity size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat_capacity () const
    \n     		\n@@ -1567,23 +1566,23 @@\n \n \n

    ◆ concat_reserve()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n \n@@ -1616,21 +1615,21 @@\n \n \n

    ◆ concat_size()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat_reserve void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat_reserve (size_type const size_type const new_cap)
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat_size size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::concat_size () const
    \n     		\n@@ -1651,21 +1650,21 @@\n \n \n

    ◆ empty()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::empty bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::empty () const
    \n     		\n@@ -1686,21 +1685,21 @@\n \n \n

    ◆ end() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::end const_iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::end () const
    \n     		\n@@ -1722,21 +1721,21 @@\n \n \n

    ◆ end() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::end iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::end ()
    \n     		\n@@ -1758,21 +1757,21 @@\n \n \n

    ◆ erase() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1813,21 +1812,21 @@\n \n \n

    ◆ erase() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::erase iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::erase (const_iterator first,
    \n \n \n@@ -1857,21 +1856,21 @@\n \n \n

    ◆ front() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n \n \n \n \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::erase iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::erase (const_iterator pos)
    \n
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::front reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::front ()
    \n     		\n@@ -1892,21 +1891,21 @@\n \n \n

    ◆ front() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::front const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::front () const
    \n     		\n@@ -1927,38 +1926,38 @@\n \n \n

    ◆ insert() [1/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n-template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n-requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    \n+template<std::forward_iterator begin_iterator_type, typename end_iterator_type >
    \n+requires iter_value_t_is_compatible_with_value_type<begin_iterator_type> && std::sized_sentinel_for<end_iterator_type, begin_iterator_type>
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -1999,32 +1998,32 @@\n \n \n

    ◆ insert() [2/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert (const_iterator pos,
    begin_iterator_type begin_iterator_type first,
    end_iterator_type end_iterator_type last 
    )
    \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -2065,54 +2064,52 @@\n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::concatenated_sequences<seqan3::dna4_vector> foobar;
    \n-
    foobar.insert(foobar.end(), "ACGT"_dna4);
    \n-
    seqan3::debug_stream << foobar[0] << '\\n'; // "ACGT"
    \n+
    seqan3::concatenated_sequences<seqan3::dna4_vector> foobar;
    \n+
    foobar.insert(foobar.end(), "ACGT"_dna4);
    \n+
    seqan3::debug_stream << foobar[0] << '\\n'; // "ACGT"
    \n
    }
    \n-
    seqan3::concatenated_sequences::end
    iterator end() noexcept
    Returns an iterator to the element following the last element of the container.
    Definition concatenated_sequences.hpp:487
    \n-
    seqan3::concatenated_sequences::insert
    iterator insert(const_iterator pos, rng_type &&value)
    Inserts value before position in the container.
    Definition concatenated_sequences.hpp:921
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n \n \n \n

    ◆ insert() [3/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert (const_iterator pos,
    rng_type && rng_type && value 
    )
    \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -2154,47 +2151,47 @@\n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::concatenated_sequences<seqan3::dna4_vector> foobar;
    \n-
    foobar.insert(foobar.end(), 2, "ACGT"_dna4);
    \n-
    seqan3::debug_stream << foobar[0] << '\\n'; // "ACGT"
    \n-
    seqan3::debug_stream << foobar[1] << '\\n'; // "ACGT"
    \n+
    seqan3::concatenated_sequences<seqan3::dna4_vector> foobar;
    \n+
    foobar.insert(foobar.end(), 2, "ACGT"_dna4);
    \n+
    seqan3::debug_stream << foobar[0] << '\\n'; // "ACGT"
    \n+
    seqan3::debug_stream << foobar[1] << '\\n'; // "ACGT"
    \n
    }
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n \n \n \n \n

    ◆ insert() [4/4]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert (const_iterator pos,
    size_type const size_type const count,
    rng_type && rng_type && value 
    )
    \n \n
    \n \n \n- \n+ \n \n \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -2232,26 +2229,26 @@\n \n \n

    ◆ last_append()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n
    iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert iterator seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::insert (const_iterator pos,
    std::initializer_list< rng_type > const & std::initializer_list< rng_type > const & ilist 
    )
    \n \n \n \n@@ -2284,23 +2281,23 @@\n \n \n

    ◆ last_push_back()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::last_append void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::last_append (rng_type && rng_type && value)
    \n     		\n inline
    \n \n \n \n@@ -2327,21 +2324,21 @@\n \n \n

    ◆ max_size()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::last_push_back void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::last_push_back (std::ranges::range_value_t< underlying_container_type > const std::ranges::range_value_t< underlying_container_type > const value)
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::max_size size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::max_size () const
    \n     		\n@@ -2362,23 +2359,23 @@\n \n \n

    ◆ operator!=()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n \n@@ -2393,23 +2390,23 @@\n \n \n

    ◆ operator<()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator!= constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator!= (concatenated_sequences< underlying_container_type, data_delimiters_type > const & concatenated_sequences< underlying_container_type, data_delimiters_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2424,23 +2421,23 @@\n \n \n

    ◆ operator<=()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator< constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator< (concatenated_sequences< underlying_container_type, data_delimiters_type > const & concatenated_sequences< underlying_container_type, data_delimiters_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2455,26 +2452,26 @@\n \n \n

    ◆ operator=()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range value_type_t>
    \n-requires is_compatible_with_value_type<value_type_t>
    \n+requires is_compatible_with_value_type<value_type_t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator<= constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator<= (concatenated_sequences< underlying_container_type, data_delimiters_type > const & concatenated_sequences< underlying_container_type, data_delimiters_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2505,23 +2502,23 @@\n \n \n

    ◆ operator==()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    concatenated_sequences & seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator= concatenated_sequences & seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator= (std::initializer_list< value_type_t > std::initializer_list< value_type_t > ilist)
    \n     		\n inline
    \n \n \n \n@@ -2536,23 +2533,23 @@\n \n \n

    ◆ operator>()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator== constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator== (concatenated_sequences< underlying_container_type, data_delimiters_type > const & concatenated_sequences< underlying_container_type, data_delimiters_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2567,23 +2564,23 @@\n \n \n

    ◆ operator>=()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator> constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator> (concatenated_sequences< underlying_container_type, data_delimiters_type > const & concatenated_sequences< underlying_container_type, data_delimiters_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2598,23 +2595,23 @@\n \n \n

    ◆ operator[]() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator>= constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator>= (concatenated_sequences< underlying_container_type, data_delimiters_type > const & concatenated_sequences< underlying_container_type, data_delimiters_type > const & rhs) const
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -2640,23 +2637,23 @@\n \n \n

    ◆ operator[]() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator[] reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator[] (size_type const size_type const i)
    \n     		\n inline
    \n \n \n \n@@ -2682,21 +2679,21 @@\n \n \n

    ◆ pop_back()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator[] const_reference seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::operator[] (size_type const size_type const i) const
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::pop_back void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::pop_back ()
    \n     		\n@@ -2719,21 +2716,21 @@\n \n \n

    ◆ push_back() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::push_back void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::push_back ()
    \n     		\n@@ -2755,26 +2752,26 @@\n \n \n

    ◆ push_back() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n \n \n \n \n@@ -2807,21 +2804,21 @@\n \n \n

    ◆ raw_data() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::push_back void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::push_back (rng_type && rng_type && value)
    \n     		\n inline
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    std::pair< decltype(data_values) &, decltype(data_delimiters) & > seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::raw_data std::pair< decltype(data_values) &, decltype(data_delimiters) & > seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::raw_data ()
    \n     		\n@@ -2838,21 +2835,21 @@\n \n \n

    ◆ raw_data() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    std::pair< decltype(data_values) const &, decltype(data_delimiters) const & > seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::raw_data std::pair< decltype(data_values) const &, decltype(data_delimiters) const & > seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::raw_data () const
    \n     		\n@@ -2869,23 +2866,23 @@\n \n \n

    ◆ reserve()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n \n@@ -2919,23 +2916,23 @@\n \n \n

    ◆ resize() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::reserve void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::reserve (size_type const size_type const new_cap)
    \n     		\n inline
    \n \n \n \n@@ -2971,32 +2968,32 @@\n \n \n

    ◆ resize() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::forward_range rng_type>
    \n-requires is_compatible_with_value_type<rng_type>
    \n+requires is_compatible_with_value_type<rng_type>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::resize void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::resize (size_type const size_type const count)
    \n     		\n inline
    \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n@@ -3043,21 +3040,21 @@\n \n \n

    ◆ shrink_to_fit()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::resize void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::resize (size_type const size_type const count,
    rng_type && rng_type && value 
    )
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::shrink_to_fit void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::shrink_to_fit ()
    \n     		\n@@ -3079,21 +3076,21 @@\n \n \n

    ◆ size()

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::size size_type seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::size () const
    \n     		\n@@ -3114,23 +3111,23 @@\n \n \n

    ◆ swap() [1/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n \n \n \n \n@@ -3155,23 +3152,23 @@\n \n \n

    ◆ swap() [2/2]

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::swap constexpr void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::swap (concatenated_sequences< underlying_container_type, data_delimiters_type > && concatenated_sequences< underlying_container_type, data_delimiters_type > && rhs)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n@@ -3197,23 +3194,23 @@\n

    Member Data Documentation

    \n \n

    ◆ is_compatible_with_value_type

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::range t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::swap constexpr void seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::swap (concatenated_sequences< underlying_container_type, data_delimiters_type > & concatenated_sequences< underlying_container_type, data_delimiters_type > & rhs)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n \n
    \n \n \n- \n+ \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::is_compatible_with_value_typeconstexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::is_compatible_with_value_type
    \n     		\n staticconstexprprotected
    \n@@ -3226,23 +3223,23 @@\n
    \n \n

    ◆ iter_value_t_is_compatible_with_value_type

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n-template<typename t >
    \n+template<typename t >
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::iter_value_t_is_compatible_with_value_typeconstexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::iter_value_t_is_compatible_with_value_type
    \n     		\n staticconstexprprotected
    \n@@ -3255,23 +3252,23 @@\n \n \n

    ◆ range_value_t_is_compatible_with_value_type

    \n \n
    \n
    \n
    \n-template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n+template<typename underlying_container_type , typename data_delimiters_type = std::vector<typename underlying_container_type::size_type>>
    \n
    \n template<std::ranges::range t>
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    constexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::range_value_t_is_compatible_with_value_typeconstexpr bool seqan3::concatenated_sequences< underlying_container_type, data_delimiters_type >::range_value_t_is_compatible_with_value_type
    \n     		\n staticconstexprprotected
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1configuration.html", "unified_diff": "@@ -138,45 +138,45 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprconfiguration & \n \n \n \n+constexprconfiguration & \n \n \n \n+ \n \n \n-\n-\n+\n+\n \n \n \n \n+constexpr size_t \n \n \n \n \n \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment
    \n-constexpr configuration ()=default
    configuration ()=default
     Defaulted.
     
    \n-constexpr configuration (configuration const &)=default
    configuration (configuration const &)=default
     Defaulted.
     
    \n-constexpr configuration (configuration &&)=default
    configuration (configuration &&)=default
     Defaulted.
     
    \n-constexpr configuration & operator= (configuration const &)=default
    operator= (configuration const &)=default
     Defaulted.
     
    \n-constexpr configuration & operator= (configuration &&)=default
    operator= (configuration &&)=default
     Defaulted.
     
    \n- ~configuration ()=default
    ~configuration ()=default
     Defaulted.
     
    template<typename config_element_t >
    \n-requires (!std::same_as<std::remove_cvref_t<config_element_t>, configuration>) && detail::config_element<std::remove_cvref_t<config_element_t>>
    constexpr configuration (config_element_t &&config_element)
    template<typename config_element_t >
    \n+requires (!std::same_as<std::remove_cvref_t<config_element_t>, configuration>) && detail::config_element<std::remove_cvref_t<config_element_t>>
    constexpr configuration (config_element_t &&config_element)
     Constructs a configuration from a single configuration element.
     
    Capacity
    \n-constexpr size_t size () const noexcept
    size () const noexcept
     Returns the number of contained config elements.
     
    \"-\"/ Public Member Functions inherited from std::tuple< configs_t... >
    \n T operator= (T... args)
     
    \n@@ -186,86 +186,86 @@\n T tuple (T... args)
     
    \n \n \n-\n+\n \n \n

    \n Friends

    \n template<detail::config_element... _configs_t>
    class configuration
    class configuration
     Friend declaration for other instances of the configuration.
     
    \n \n \n-\n-\n+\n+\n \n \n \n \n-\n+\n \n \n \n-\n-\n+\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    template<typename lhs_config_t , typename rhs_config_t >
    constexpr auto operator| (lhs_config_t &&lhs, rhs_config_t &&rhs)
    template<typename lhs_config_t , typename rhs_config_t >
    constexpr auto operator| (lhs_config_t &&lhs, rhs_config_t &&rhs)
     Combines two configurations and/or configuration elements forming a new seqan3::configuration.
     
    Type deduction guides
    \n template<detail::config_element config_t>
     configuration (config_t) -> configuration< config_t >
     configuration (config_t) -> configuration< config_t >
     Deduces the correct configuration element type from the passed seqan3::pipeable_config_element.
     
    Tuple interface
    template<template< typename... > class query_t, typename... configs_t>
    constexpr auto & get (configuration< configs_t... > &config) noexcept
    template<template< typename... > class query_t, typename... configs_t>
    constexpr auto & get (configuration< configs_t... > &config) noexcept
     Returns the stored element.
     
    \n \n-\n-\n+\n+\n \n \n \n-\n+template<typenamealternative_t > \n+\n \n \n \n-\n+template<typenamealternative_t > \n+\n \n \n \n-\n+template<typenamealternative_t > \n+\n \n \n \n-\n+template<typenamequery_t > \n+\n \n \n \n-\n+template<template< typename... > typename query_t> \n+\n \n \n

    Observers

    template<typename alternative_t >
    constexpr decltype(auto) get_or (alternative_t &&alternative) &noexcept
    template<typename alternative_t >
    constexpr decltype(auto) get_or (alternative_t &&alternative) &noexcept
     Returns the stored configuration element if present otherwise the given alternative.
     
    \n-template<typename alternative_t >
    constexpr decltype(auto) get_or (alternative_t &&alternative) const &noexcept
    constexpr decltype(auto) get_or (alternative_t &&alternative) const &noexcept
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    \n-template<typename alternative_t >
    constexpr decltype(auto) get_or (alternative_t &&alternative) &&noexcept
    constexpr decltype(auto) get_or (alternative_t &&alternative) &&noexcept
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    \n-template<typename alternative_t >
    constexpr decltype(auto) get_or (alternative_t &&alternative) const &&noexcept
    constexpr decltype(auto) get_or (alternative_t &&alternative) const &&noexcept
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    \n-template<typename query_t >
    static constexpr bool exists () noexcept
    static constexpr bool exists () noexcept
     Checks if the given type exists in the tuple.
     
    \n-template<template< typename... > typename query_t>
    static constexpr bool exists () noexcept
    static constexpr bool exists () noexcept
     Checks if the given type exists in the tuple.
     
    \n \n \n-\n-\n+\n+\n \n \n-\n-\n+\n+\n \n \n \n-\n+template<template< typename... > typename query_t>
    \n+requires (exists<query_t>())\n+\n \n \n

    Modifiers

    Note that modifications return new configurations and do not modify this.

    \n
    template<typename other_configuration_t >
    \n-requires (is_config_element_combineable_v<configs_t, std::remove_cvref_t<other_configuration_t>> && ...)
    constexpr auto append (other_configuration_t &&other_config) const
    template<typename other_configuration_t >
    \n+requires (is_config_element_combineable_v<configs_t, std::remove_cvref_t<other_configuration_t>> && ...)
    constexpr auto append (other_configuration_t &&other_config) const
     Returns a new configuration by appending the given configuration to the current one.
     
    template<typename query_t >
    \n-requires (exists<query_t>())
    constexpr auto remove () const
    template<typename query_t >
    \n+requires (exists<query_t>())
    constexpr auto remove () const
     Remove a config element from the configuration.
     
    \n-template<template< typename... > typename query_t>
    \n-requires (exists<query_t>())
    constexpr auto remove () const
    constexpr auto remove () const
     This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
     
    \n

    Detailed Description

    \n
    template<detail::config_element... configs_t>
    \n class seqan3::configuration< configs_t >

    Collection of elements to configure an algorithm.

    \n
    Template Parameters
    \n@@ -280,24 +280,24 @@\n

    ◆ configuration()

    \n \n
    \n
    \n
    \n template<detail::config_element... configs_t>
    \n
    \n-template<typename config_element_t >
    \n-requires (!std::same_as<std::remove_cvref_t<config_element_t>, configuration>) && detail::config_element<std::remove_cvref_t<config_element_t>>
    \n+template<typename config_element_t >
    \n+requires (!std::same_as<std::remove_cvref_t<config_element_t>, configuration>) && detail::config_element<std::remove_cvref_t<config_element_t>>
    \n \n \n \n \n@@ -326,24 +326,24 @@\n

    ◆ append()

    \n \n
    \n
    \n
    \n template<detail::config_element... configs_t>
    \n
    \n-template<typename other_configuration_t >
    \n-requires (is_config_element_combineable_v<configs_t, std::remove_cvref_t<other_configuration_t>> && ...)
    \n+template<typename other_configuration_t >
    \n+requires (is_config_element_combineable_v<configs_t, std::remove_cvref_t<other_configuration_t>> && ...)
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::configuration< configs_t >::configuration constexpr seqan3::configuration< configs_t >::configuration (config_element_t && config_element_t && config_element)
    \n     		\n inlineconstexpr
    \n \n \n \n@@ -373,23 +373,23 @@\n

    ◆ get_or()

    \n \n
    \n
    \n
    \n template<detail::config_element... configs_t>
    \n
    \n-template<typename alternative_t >
    \n+template<typename alternative_t >
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr auto seqan3::configuration< configs_t >::append constexpr auto seqan3::configuration< configs_t >::append (other_configuration_t && other_configuration_t && other_config) const
    \n     		\n inlineconstexpr
    \n \n \n \n@@ -418,21 +418,21 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/core/configuration/configuration.hpp>
    \n
    #include <seqan3/core/configuration/pipeable_config_element.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    // Initial setup used in the actual example:
    \n-
    enum struct my_id : int
    \n+
    enum struct my_id : int
    \n
    {
    \n-
    bar_id,
    \n-
    foo_id
    \n+
    bar_id,
    \n+
    foo_id
    \n
    };
    \n
    \n-
    struct bar : private seqan3::pipeable_config_element
    \n+
    struct bar : private seqan3::pipeable_config_element
    \n
    {
    \n
    public:
    \n
    float value{};
    \n
    \n
    bar() = default;
    \n
    bar(bar const &) = default;
    \n
    bar(bar &&) = default;
    \n@@ -472,14 +472,15 @@\n
    {
    \n
    seqan3::configuration my_cfg{foo{1}}; // Only foo<int> is present.
    \n
    seqan3::debug_stream << my_cfg.get_or(foo{std::string{"hello"}}).value << '\\n'; // finds foo<int> -> prints: 1
    \n
    seqan3::debug_stream << my_cfg.get_or(bar{2.4}).value << '\\n'; // bar not present -> prints: 2.4
    \n
    }
    \n \n
    seqan3::configuration
    Collection of elements to configure an algorithm.
    Definition configuration.hpp:42
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    configuration.hpp
    Provides seqan3::configuration and utility functions.
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    std
    SeqAn specific customisations in the standard namespace.
    \n
    pipeable_config_element.hpp
    Provides seqan3::pipeable_config_element.
    \n
    seqan3::pipeable_config_element
    Adds pipe interface to configuration elements.
    Definition pipeable_config_element.hpp:29
    \n

    Exception

    \n@@ -493,22 +494,22 @@\n

    ◆ remove()

    \n \n
    \n
    \n
    \n template<detail::config_element... configs_t>
    \n
    \n-template<typename query_t >
    \n-requires (exists<query_t>())
    \n+template<typename query_t >
    \n+requires (exists<query_t>())
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr decltype(auto) seqan3::configuration< configs_t >::get_or constexpr decltype(auto) seqan3::configuration< configs_t >::get_or (alternative_t && alternative_t && alternative) &
    \n     		\n inlineconstexprnoexcept
    \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr auto seqan3::configuration< configs_t >::remove constexpr auto seqan3::configuration< configs_t >::remove () const
    \n     		\n@@ -531,29 +532,29 @@\n

    Friends And Related Symbol Documentation

    \n \n

    ◆ operator|()

    \n \n
    \n
    \n
    \n-template<typename lhs_config_t , typename rhs_config_t >
    \n+template<typename lhs_config_t , typename rhs_config_t >
    \n \n \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n \n \n- \n+ \n \n \n \n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1counting__vector.html", "unified_diff": "@@ -135,53 +135,53 @@\n \n
    \n
    \n
    [legend]
    \n
    constexpr auto operator| constexpr auto operator| (lhs_config_t && lhs_config_t && lhs,
    rhs_config_t && rhs_config_t && rhs 
    )
    \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n-\n-\n+\n+\n \n \n-\n+\n \n \n \n \n+ \n \n \n \n+ \n \n \n \n+counting_vector & \n \n \n \n+ \n \n \n \n+counting_vector & \n \n \n \n+ \n \n \n \n \n \n

    \n Public Member Functions

    template<typename binning_bitvector_t >
    \n-requires is_binning_bitvector<binning_bitvector_t>
    counting_vector & operator+= (binning_bitvector_t const &binning_bitvector)
    template<typename binning_bitvector_t >
    \n+requires is_binning_bitvector<binning_bitvector_t>
    counting_vector & operator+= (binning_bitvector_t const &binning_bitvector)
     Bin-wise adds the bits of a seqan3::interleaved_bloom_filter::membership_agent_type::binning_bitvector.
     
    counting_vector & operator+= (counting_vector const &rhs)
    counting_vector & operator+= (counting_vector const &rhs)
     Bin-wise addition of two seqan3::counting_vectors.
     
    template<typename binning_bitvector_t >
    \n-requires is_binning_bitvector<binning_bitvector_t>
    counting_vector & operator-= (binning_bitvector_t const &binning_bitvector)
    template<typename binning_bitvector_t >
    \n+requires is_binning_bitvector<binning_bitvector_t>
    counting_vector & operator-= (binning_bitvector_t const &binning_bitvector)
     Bin-wise subtracts the bits of a seqan3::interleaved_bloom_filter::membership_agent_type::binning_bitvector.
     
    counting_vector & operator-= (counting_vector const &rhs)
    counting_vector & operator-= (counting_vector const &rhs)
     Bin-wise substraction of two seqan3::counting_vectors.
     
    Constructors, destructor and assignment
    \n- counting_vector ()=default
    counting_vector ()=default
     Defaulted.
     
    \n- counting_vector (counting_vector const &)=default
    counting_vector (counting_vector const &)=default
     Defaulted.
     
    \n-counting_vector & operator= (counting_vector const &)=default
    operator= (counting_vector const &)=default
     Defaulted.
     
    \n- counting_vector (counting_vector &&)=default
    counting_vector (counting_vector &&)=default
     Defaulted.
     
    \n-counting_vector & operator= (counting_vector &&)=default
    operator= (counting_vector &&)=default
     Defaulted.
     
    \n- ~counting_vector ()=default
    ~counting_vector ()=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from std::vector< value_t >
    \n T assign (T... args)
     
    \n@@ -299,23 +299,23 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    #include <seqan3/search/dream_index/interleaved_bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    seqan3::interleaved_bloom_filter ibf{seqan3::bin_count{12u}, seqan3::bin_size{8192u}};
    \n+
    seqan3::interleaved_bloom_filter ibf{seqan3::bin_count{12u}, seqan3::bin_size{8192u}};
    \n
    ibf.emplace(126, seqan3::bin_index{0u});
    \n
    ibf.emplace(126, seqan3::bin_index{3u});
    \n
    ibf.emplace(126, seqan3::bin_index{9u});
    \n
    ibf.emplace(712, seqan3::bin_index{3u});
    \n
    ibf.emplace(237, seqan3::bin_index{9u});
    \n
    \n
    // The counting_vector must be at least as big as there are bins.
    \n-
    seqan3::counting_vector<uint8_t> counts(12, 0);
    \n+
    seqan3::counting_vector<uint8_t> counts(12, 0);
    \n
    \n
    auto agent = ibf.membership_agent();
    \n
    \n
    counts += agent.bulk_contains(712); // `counts` contains the number of occurrences of 712 in each bin.
    \n
    seqan3::debug_stream << counts << '\\n'; // prints [0,0,0,1,0,0,0,0,0,0,0,0]
    \n
    \n
    counts += agent.bulk_contains(237); // `counts` contains the number of occurrences of 712 and 237 in each bin.
    \n@@ -323,15 +323,15 @@\n
    \n
    counts += agent.bulk_contains(126); // `counts` contains the number of occurrences of 712, 237 and 126 in each bin.
    \n
    seqan3::debug_stream << counts << '\\n'; // prints [1,0,0,2,0,0,0,0,0,2,0,0]
    \n
    \n
    counts += counts; // multiple counts can also be added together
    \n
    seqan3::debug_stream << counts << '\\n'; // prints [2,0,0,4,0,0,0,0,0,4,0,0]
    \n
    }
    \n-
    seqan3::counting_vector
    A data structure that behaves like a std::vector and can be used to consolidate the results of multip...
    Definition interleaved_bloom_filter.hpp:809
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::interleaved_bloom_filter
    The IBF binning directory. A data structure that efficiently answers set-membership queries for multi...
    Definition interleaved_bloom_filter.hpp:131
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    interleaved_bloom_filter.hpp
    Provides seqan3::interleaved_bloom_filter.
    \n
    seqan3::bin_count
    A strong type that represents the number of bins for the seqan3::interleaved_bloom_filter.
    Definition interleaved_bloom_filter.hpp:33
    \n
    seqan3::bin_index
    A strong type that represents the bin index for the seqan3::interleaved_bloom_filter.
    Definition interleaved_bloom_filter.hpp:54
    \n
    seqan3::bin_size
    A strong type that represents the number of bits for each bin in the seqan3::interleaved_bloom_filter...
    Definition interleaved_bloom_filter.hpp:40
    \n@@ -340,24 +340,24 @@\n

    ◆ operator+=() [1/2]

    \n \n
    \n
    \n
    \n template<std::integral value_t>
    \n
    \n-template<typename binning_bitvector_t >
    \n-requires is_binning_bitvector<binning_bitvector_t>
    \n+template<typename binning_bitvector_t >
    \n+requires is_binning_bitvector<binning_bitvector_t>
    \n \n \n \n \n@@ -385,23 +385,23 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    #include <seqan3/search/dream_index/interleaved_bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    seqan3::interleaved_bloom_filter ibf{seqan3::bin_count{12u}, seqan3::bin_size{8192u}};
    \n+
    seqan3::interleaved_bloom_filter ibf{seqan3::bin_count{12u}, seqan3::bin_size{8192u}};
    \n
    ibf.emplace(126, seqan3::bin_index{0u});
    \n
    ibf.emplace(126, seqan3::bin_index{3u});
    \n
    ibf.emplace(126, seqan3::bin_index{9u});
    \n
    ibf.emplace(712, seqan3::bin_index{3u});
    \n
    ibf.emplace(237, seqan3::bin_index{9u});
    \n
    \n
    // The counting_vector must be at least as big as there are bins.
    \n-
    seqan3::counting_vector<uint8_t> counts(12, 0);
    \n+
    seqan3::counting_vector<uint8_t> counts(12, 0);
    \n
    \n
    auto agent = ibf.membership_agent();
    \n
    \n
    counts += agent.bulk_contains(712); // `counts` contains the number of occurrences of 712 in each bin.
    \n
    seqan3::debug_stream << counts << '\\n'; // prints [0,0,0,1,0,0,0,0,0,0,0,0]
    \n
    \n
    counts += agent.bulk_contains(237); // `counts` contains the number of occurrences of 712 and 237 in each bin.
    \n@@ -424,17 +424,17 @@\n
    \n template<std::integral value_t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    counting_vector & seqan3::counting_vector< value_t >::operator+= counting_vector & seqan3::counting_vector< value_t >::operator+= (binning_bitvector_t const & binning_bitvector_t const & binning_bitvector)
    \n     		\n inline
    \n \n \n \n@@ -456,23 +456,23 @@\n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    #include <seqan3/search/dream_index/interleaved_bloom_filter.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    seqan3::interleaved_bloom_filter ibf{seqan3::bin_count{12u}, seqan3::bin_size{8192u}};
    \n+
    seqan3::interleaved_bloom_filter ibf{seqan3::bin_count{12u}, seqan3::bin_size{8192u}};
    \n
    ibf.emplace(126, seqan3::bin_index{0u});
    \n
    ibf.emplace(126, seqan3::bin_index{3u});
    \n
    ibf.emplace(126, seqan3::bin_index{9u});
    \n
    ibf.emplace(712, seqan3::bin_index{3u});
    \n
    ibf.emplace(237, seqan3::bin_index{9u});
    \n
    \n
    // The counting_vector must be at least as big as there are bins.
    \n-
    seqan3::counting_vector<uint8_t> counts(12, 0);
    \n+
    seqan3::counting_vector<uint8_t> counts(12, 0);
    \n
    \n
    auto agent = ibf.membership_agent();
    \n
    \n
    counts += agent.bulk_contains(712); // `counts` contains the number of occurrences of 712 in each bin.
    \n
    seqan3::debug_stream << counts << '\\n'; // prints [0,0,0,1,0,0,0,0,0,0,0,0]
    \n
    \n
    counts += agent.bulk_contains(237); // `counts` contains the number of occurrences of 712 and 237 in each bin.
    \n@@ -491,24 +491,24 @@\n

    ◆ operator-=() [1/2]

    \n \n
    \n
    \n
    \n template<std::integral value_t>
    \n
    \n-template<typename binning_bitvector_t >
    \n-requires is_binning_bitvector<binning_bitvector_t>
    \n+template<typename binning_bitvector_t >
    \n+requires is_binning_bitvector<binning_bitvector_t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    counting_vector & seqan3::counting_vector< value_t >::operator+= counting_vector & seqan3::counting_vector< value_t >::operator+= (counting_vector< value_t > const & counting_vector< value_t > const & rhs)
    \n     		\n inline
    \n \n \n \n@@ -541,17 +541,17 @@\n
    \n template<std::integral value_t>
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    counting_vector & seqan3::counting_vector< value_t >::operator-= counting_vector & seqan3::counting_vector< value_t >::operator-= (binning_bitvector_t const & binning_bitvector_t const & binning_bitvector)
    \n     		\n inline
    \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1debug__stream__type.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1debug__stream__type.html", "unified_diff": "@@ -130,122 +130,122 @@\n More...

    \n \n

    #include <seqan3/core/debug_stream/debug_stream_type.hpp>

    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    counting_vector & seqan3::counting_vector< value_t >::operator-= counting_vector & seqan3::counting_vector< value_t >::operator-= (counting_vector< value_t > const & counting_vector< value_t > const & rhs)
    \n     		\n inline
    \n \n \n+using \n \n \n

    \n Public Types

    \n-using fmtflags = typename std::basic_ostream< char_t >::fmtflags
    fmtflags = typename std::basic_ostream< char_t >::fmtflags
     This type is std::ios_base::fmtflags.
     
    \n \n \n \n \n+ \n \n \n \n+ \n \n \n \n+ \n \n \n \n+debug_stream_type & \n \n \n \n+debug_stream_type & \n \n \n \n+ \n \n \n \n+constexpr \n \n \n \n-\n+\n \n \n \n+std::basic_ostream< char_t > & \n \n \n \n \n \n+fmtflags \n \n \n \n+fmtflags \n \n \n \n+void \n \n \n \n+void \n \n \n \n \n \n+fmtflags2 \n \n \n \n+fmtflags2 \n \n \n \n+void \n \n \n \n+void \n \n \n

    \n Public Member Functions

    Constructor, destructor and assignment.

    The standard functions are explicitly set to default.

    \n
    \n- debug_stream_type ()=default
    debug_stream_type ()=default
     Defaulted.
     
    \n- debug_stream_type (debug_stream_type const &)=default
    debug_stream_type (debug_stream_type const &)=default
     Defaulted.
     
    \n- debug_stream_type (debug_stream_type &&)=default
    debug_stream_type (debug_stream_type &&)=default
     Defaulted.
     
    \n-debug_stream_type & operator= (debug_stream_type const &)=default
    operator= (debug_stream_type const &)=default
     Defaulted.
     
    \n-debug_stream_type & operator= (debug_stream_type &&)=default
    operator= (debug_stream_type &&)=default
     Defaulted.
     
    \n- ~debug_stream_type ()=default
    ~debug_stream_type ()=default
     Defaulted.
     
    \n-constexpr debug_stream_type (std::basic_ostream< char_t > &out)
    debug_stream_type (std::basic_ostream< char_t > &out)
     Construction from an output stream.
     
    Miscelleneous
    void set_underlying_stream (std::basic_ostream< char_t > &out)
    void set_underlying_stream (std::basic_ostream< char_t > &out)
     Change the underlying output stream.
     
    \n-std::basic_ostream< char_t > & get_underlying_stream () const noexcept
    get_underlying_stream () const noexcept
     Retrieve the underlying stream.
     
    Format flags (std::ios_base::fmtflags)

    std::ios_base::fmtflags that modify the stream's behaviour.

    \n
    \n-fmtflags flags () const
    flags () const
     Retrieve the format flags from the stream.
     
    \n-fmtflags flags (fmtflags const flgs)
    flags (fmtflags const flgs)
     Replace the current flags on the stream with the given argument.
     
    \n-void setf (fmtflags const flag)
    setf (fmtflags const flag)
     Set the format flag(s) on the stream (current flags are ORed with the argument).
     
    \n-void unsetf (fmtflags const flag)
    unsetf (fmtflags const flag)
     Unset the format flag(s) on the stream.
     
    Format flags (seqan3::fmtflags2)

    SeqAn specific debug flags for the debug stream.

    \n
    \n-fmtflags2 flags2 () const
    flags2 () const
     Retrieve the format flags from the stream.
     
    \n-fmtflags2 flags2 (fmtflags2 flgs)
    flags2 (fmtflags2 flgs)
     Replace the current flags on the stream with the given argument.
     
    \n-void setf (fmtflags2 const flag)
    setf (fmtflags2 const flag)
     Set the format flag(s) on the stream (current flags are ORed with the argument).
     
    \n-void unsetf (fmtflags2 const flag)
    unsetf (fmtflags2 const flag)
     Unset the format flag(s) on the stream.
     
    \n \n \n-\n+template<typenameT > \n+\n \n \n-\n+template<typenameT > \n+\n \n

    \n Friends

    \n-template<typename T >
    struct debug_stream_printer
    struct debug_stream_printer
     
    \n-template<typename T >
    struct std_printer
    struct std_printer
     
    \n \n \n-\n+template<typenameother_char_t , typename t > \n+\n \n \n \n+debug_stream_type & \n \n \n

    Formatted output

    \n-template<typename other_char_t , typename t >
    debug_stream_type< other_char_t > & operator<< (debug_stream_type< other_char_t > &s, t &&v)
    debug_stream_type< other_char_t > & operator<< (debug_stream_type< other_char_t > &s, t &&v)
     Forwards to the underlying stream object.
     
    \n-debug_stream_type & operator<< (std::ostream &(*fp)(std::ostream &))
    operator<< (std::ostream &(*fp)(std::ostream &))
     This overloads enables forwarding std::endl and other manipulators.
     
    \n

    Detailed Description

    \n-
    template<typename char_t = char>
    \n+
    template<typename char_t = char>
    \n class seqan3::debug_stream_type< char_t >

    A \"pretty printer\" for most SeqAn data structures and related types.

    \n

    A global instance of this type exists as seqan3::debug_stream. You can stream to it as you would to std::cout or std::cerr, but the debug stream has special overloads that make certain types streamable (that are not streamable to std::cout). Additionally some data structures are visualised more elaborately via the debug stream and there are extra flags to configure it (seqan3::fmtflags2).

    \n
    See also
    Debug Stream
    \n

    \n Example

    \n

    Simple usage:

    \n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n@@ -259,26 +259,27 @@\n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    // The alphabet normally needs to be converted to char explicitly:
    \n-
    std::cout << seqan3::to_char('C'_dna5) << '\\n'; // prints 'C'
    \n+
    std::cout << seqan3::to_char('C'_dna5) << '\\n'; // prints 'C'
    \n
    \n
    // The debug_stream, on the other hand, does this automatically:
    \n-
    seqan3::debug_stream << 'C'_dna5 << '\\n'; // prints 'C'
    \n+
    seqan3::debug_stream << 'C'_dna5 << '\\n'; // prints 'C'
    \n
    \n
    // The debug_stream can also print all types that model std::ranges::input_range:
    \n-
    std::vector<seqan3::dna5> vec{"ACGT"_dna5};
    \n-
    seqan3::debug_stream << vec << '\\n'; // prints "ACGT"
    \n+
    std::vector<seqan3::dna5> vec{"ACGT"_dna5};
    \n+
    seqan3::debug_stream << vec << '\\n'; // prints "ACGT"
    \n
    \n
    // ranges of non-alphabets are printed comma-separated:
    \n-
    seqan3::debug_stream << (vec | seqan3::views::to_rank) << '\\n'; // prints "[0,1,2,3]"
    \n+
    seqan3::debug_stream << (vec | seqan3::views::to_rank) << '\\n'; // prints "[0,1,2,3]"
    \n
    }
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna5.hpp
    Provides seqan3::dna5, container aliases and string literals.
    \n
    seqan3::views::to_rank
    auto const to_rank
    A view that calls seqan3::to_rank() on each element in the input range.
    Definition to_rank.hpp:63
    \n
    seqan3::to_char
    constexpr auto to_char
    Return the char representation of an alphabet object.
    Definition alphabet/concept.hpp:381
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n \n@@ -290,42 +291,42 @@\n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n-
    uint8_t i = 71;
    \n-
    seqan3::debug_stream << '\\'' << i << "'\\n"; // prints '71' (because flag is set by default)
    \n+
    uint8_t i = 71;
    \n+
    seqan3::debug_stream << '\\'' << i << "'\\n"; // prints '71' (because flag is set by default)
    \n
    seqan3::debug_stream.unsetf(seqan3::fmtflags2::small_int_as_number); // unsets the flag
    \n-
    seqan3::debug_stream << '\\'' << i << "'\\n"; // prints 'G'
    \n-
    seqan3::debug_stream << seqan3::fmtflags2::small_int_as_number << '\\'' << i << "'\\n"; // prints '71' again
    \n+
    seqan3::debug_stream << '\\'' << i << "'\\n"; // prints 'G'
    \n+
    seqan3::debug_stream << seqan3::fmtflags2::small_int_as_number << '\\'' << i << "'\\n"; // prints '71' again
    \n
    // instead of formatting the stream "inline", one can also call .setf()
    \n
    }
    \n
    seqan3::debug_stream_type::unsetf
    void unsetf(fmtflags const flag)
    Unset the format flag(s) on the stream.
    Definition debug_stream_type.hpp:190
    \n
    seqan3::fmtflags2::small_int_as_number
    @ small_int_as_number
    \n

    See seqan3::fmtflags2 for more details.

    \n
    Attention
    This class does not yet model seqan3::output_stream_over fully,
    \n
    Todo:
    implement.
    \n

    Member Function Documentation

    \n \n

    ◆ set_underlying_stream()

    \n \n
    \n
    \n
    \n-template<typename char_t = char>
    \n+template<typename char_t = char>
    \n \n \n \n \n@@ -350,50 +351,48 @@\n
    #include <seqan3/alphabet/nucleotide/dna5.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    std::ostringstream o;
    \n-
    seqan3::debug_stream.set_underlying_stream(o);
    \n+
    std::ostringstream o;
    \n+
    seqan3::debug_stream.set_underlying_stream(o);
    \n
    \n-
    seqan3::debug_stream << "ACGT"_dna5;
    \n+
    seqan3::debug_stream << "ACGT"_dna5;
    \n
    \n-
    o.flush();
    \n-
    seqan3::debug_stream << o.str(); // prints the string stream's buffer: "ACGT"
    \n+
    o.flush();
    \n+
    seqan3::debug_stream << o.str(); // prints the string stream's buffer: "ACGT"
    \n
    }
    \n \n+
    seqan3::debug_stream_type::debug_stream_type
    debug_stream_type()=default
    Defaulted.
    \n
    seqan3::debug_stream_type::set_underlying_stream
    void set_underlying_stream(std::basic_ostream< char_t > &out)
    Change the underlying output stream.
    Definition debug_stream_type.hpp:117
    \n-
    std::ostringstream::flush
    T flush(T... args)
    \n \n-
    std::ostringstream::str
    T str(T... args)
    \n

    In the case where you wish to print to some stream object locally, instead create you own debug stream:

    \n
    // SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universit\u00e4t Berlin
    \n
    // SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI f\u00fcr molekulare Genetik
    \n
    // SPDX-License-Identifier: CC0-1.0
    \n
    \n
    #include <sstream>
    \n
    \n
    #include <seqan3/alphabet/nucleotide/dna5.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    std::ostringstream o;
    \n-
    seqan3::debug_stream_type my_stream{o};
    \n+
    std::ostringstream o;
    \n+
    seqan3::debug_stream_type my_stream{o};
    \n
    \n-
    my_stream << "ACGT"_dna5;
    \n+
    my_stream << "ACGT"_dna5;
    \n
    \n-
    o.flush();
    \n-
    seqan3::debug_stream << o.str() << '\\n'; // prints the string stream's buffer: "ACGT"
    \n+
    o.flush();
    \n+
    seqan3::debug_stream << o.str() << '\\n'; // prints the string stream's buffer: "ACGT"
    \n
    }
    \n-
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    \n \n \n
    The documentation for this class was generated from the following file:\n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1design__error.html", "unified_diff": "@@ -135,19 +135,19 @@\n \n
    \n
    \n
    [legend]
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    void seqan3::debug_stream_type< char_t >::set_underlying_stream void seqan3::debug_stream_type< char_t >::set_underlying_stream (std::basic_ostream< char_t > & std::basic_ostream< char_t > & out)
    \n     		\n inline
    \n \n-\n+\n \n \n \n-\n+\n \n \n \n \n \n

    \n Public Member Functions

     design_error (std::string const &s)
     design_error (std::string const &s)
     The constructor.
     
    \"-\"/ Public Member Functions inherited from seqan3::argument_parser_error
     argument_parser_error (std::string const &s)
     argument_parser_error (std::string const &s)
     The constructor.
     
    \"-\"/ Public Member Functions inherited from std::runtime_error
    \n T runtime_error (T... args)
     
    \n@@ -170,15 +170,15 @@\n \n \n \n \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna15.html", "unified_diff": "@@ -137,109 +137,109 @@\n
    \n
    [legend]
    \n
    \n \n \n \n \n- \n+ \n \n \n \n
    seqan3::design_error::design_error (std::string const & std::string const & s)
    \n     		\n inline
    \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprdna15 & \n \n \n \n+constexprdna15 & \n \n \n \n+ \n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr dna15 () noexcept=default
    dna15 () noexcept=default
     Defaulted.
     
    \n-constexpr dna15 (dna15 const &) noexcept=default
    dna15 (dna15 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna15 (dna15 &&) noexcept=default
    dna15 (dna15 &&) noexcept=default
     Defaulted.
     
    \n-constexpr dna15 & operator= (dna15 const &) noexcept=default
    operator= (dna15 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna15 & operator= (dna15 &&) noexcept=default
    operator= (dna15 &&) noexcept=default
     Defaulted.
     
    \n- ~dna15 () noexcept=default
    ~dna15 () noexcept=default
     Defaulted.
     
    template<std::same_as< rna15 > t>
    constexpr dna15 (t const &r) noexcept
    constexpr dna15 (t const &r) noexcept
     Allow implicit construction from seqan3::rna15 of the same size.
     
    \"-\"/ Public Member Functions inherited from seqan3::nucleotide_base< dna15, 15 >
    constexpr dna15 complement () const noexcept
    constexpr dna15 complement () const noexcept
     Return the complement of the letter.
     
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
     Allow explicit construction from any other nucleotide type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using dna15_vector = std::vector< dna15 >
    using dna15_vector = std::vector< dna15 >
     Alias for a std::vector of seqan3::dna15.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::nucleotide_base< dna15, 15 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The 15 letter DNA alphabet, containing all IUPAC smybols minus the gap.

    \n

    Note that you can assign 'U' as a character to dna15 and it will silently be converted to 'T'.

    \n

    Like most alphabets, this alphabet cannot be initialised directly from its character representation. Instead initialise/assign from the character literal 'A'_dna15 or use the function seqan3::dna15::assign_char().

    \n@@ -250,23 +250,23 @@\n
    #include <seqan3/alphabet/nucleotide/dna15.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna15 letter{'A'_dna15};
    \n+
    seqan3::dna15 letter{'A'_dna15};
    \n
    \n-
    letter.assign_char('C');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n+
    letter.assign_char('C');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n
    \n-
    letter.assign_char('F'); // Unknown characters are implicitly converted to N.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "N"
    \n+
    letter.assign_char('F'); // Unknown characters are implicitly converted to N.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "N"
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dna15
    The 15 letter DNA alphabet, containing all IUPAC smybols minus the gap.
    Definition dna15.hpp:48
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna15.hpp
    Provides seqan3::dna15, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is stable. Since version 3.1.

    \n

    Constructor & Destructor Documentation

    \n@@ -278,17 +278,17 @@\n
    \n template<std::same_as< rna15 > t>
    \n \n \n \n \n@@ -301,38 +301,38 @@\n

    #include <seqan3/alphabet/nucleotide/dna15.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna15.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna15 letter1 = 'C'_rna15; // implicitly converted
    \n-
    seqan3::dna15 letter2{};
    \n-
    letter2 = 'C'_rna15; // implicitly converted
    \n+
    seqan3::dna15 letter1 = 'C'_rna15; // implicitly converted
    \n+
    seqan3::dna15 letter2{};
    \n+
    letter2 = 'C'_rna15; // implicitly converted
    \n
    }
    \n
    rna15.hpp
    Provides seqan3::rna15, container aliases and string literals.
    \n

    \n seqan3::sequences (e.g. seqan3::dna15_vector) in general are not implicitly convertible and must be explicitly copied to be converted:
    \n

    #include <vector>
    \n
    \n
    #include <seqan3/alphabet/nucleotide/dna15.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna15.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna15_vector vector{'A'_rna15, 'C'_rna15, 'G'_rna15}; // (element-wise) implicit conversion
    \n+
    seqan3::dna15_vector vector{'A'_rna15, 'C'_rna15, 'G'_rna15}; // (element-wise) implicit conversion
    \n
    \n
    // but this won't work:
    \n
    // seqan3::dna15_vector dna15_vector{"ACGT"_rna15};
    \n
    \n
    // as a workaround you can use:
    \n
    // side note: this would also work without the implicit conversion.
    \n-
    seqan3::rna15_vector rna15_vector = "ACGT"_rna15;
    \n+
    seqan3::rna15_vector rna15_vector = "ACGT"_rna15;
    \n
    seqan3::dna15_vector dna15_vector{rna15_vector.begin(), rna15_vector.end()};
    \n
    }
    \n
    seqan3::dna15::dna15_vector
    std::vector< dna15 > dna15_vector
    Alias for a std::vector of seqan3::dna15.
    Definition dna15.hpp:163
    \n \n

    \n You can avoid this copy by using std::ranges::views:
    \n

    #include <vector>
    \n@@ -341,36 +341,36 @@\n
    #include <seqan3/alphabet/nucleotide/rna15.hpp>
    \n
    #include <seqan3/utility/views/convert.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna15_vector vector = "ACG"_dna15;
    \n+
    seqan3::dna15_vector vector = "ACG"_dna15;
    \n
    \n-
    auto rna15_view = vector | seqan3::views::convert<seqan3::rna15>;
    \n+
    auto rna15_view = vector | seqan3::views::convert<seqan3::rna15>;
    \n
    \n-
    for (auto && chr : rna15_view) // converts lazily on-the-fly
    \n+
    for (auto && chr : rna15_view) // converts lazily on-the-fly
    \n
    {
    \n-
    static_assert(std::same_as<decltype(chr), seqan3::rna15 &&>);
    \n+
    static_assert(std::same_as<decltype(chr), seqan3::rna15 &&>);
    \n
    }
    \n
    }
    \n
    seqan3::rna15
    The 15 letter RNA alphabet, containing all IUPAC smybols minus the gap.
    Definition rna15.hpp:48
    \n
    convert.hpp
    Provides seqan3::views::convert.
    \n

    \n This conversion constructor only allows converting seqan3::rna15 to seqan3::dna15. Other alphabets that inherit from seqan3::rna15 will not be implicitly convertible to seqan3::dna15.
    \n

    #include <seqan3/alphabet/nucleotide/dna15.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna15.hpp>
    \n
    \n-
    struct my_dna15 : public seqan3::dna15
    \n+
    struct my_dna15 : public seqan3::dna15
    \n
    {
    \n
    // using seqan3::dna15::dna15; // uncomment to import implicit conversion shown by letter1
    \n
    };
    \n
    \n-
    struct my_rna15 : public seqan3::rna15
    \n+
    struct my_rna15 : public seqan3::rna15
    \n
    {};
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    // my_dna15 letter1 = 'C'_rna15; // NO automatic implicit conversion!
    \n@@ -388,15 +388,15 @@\n
    \n
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::dna15::dna15 constexpr seqan3::dna15::dna15 (t const & t const & r)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using dna15_vector = std::vector<dna15>using dna15_vector = std::vector<dna15>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna16sam.html", "unified_diff": "@@ -137,105 +137,105 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprdna16sam & \n \n \n \n+constexprdna16sam & \n \n \n \n+ \n \n \n \n-\n+\n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr dna16sam () noexcept=default
    dna16sam () noexcept=default
     Defaulted.
     
    \n-constexpr dna16sam (dna16sam const &) noexcept=default
    dna16sam (dna16sam const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna16sam (dna16sam &&) noexcept=default
    dna16sam (dna16sam &&) noexcept=default
     Defaulted.
     
    \n-constexpr dna16sam & operator= (dna16sam const &) noexcept=default
    operator= (dna16sam const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna16sam & operator= (dna16sam &&) noexcept=default
    operator= (dna16sam &&) noexcept=default
     Defaulted.
     
    \n- ~dna16sam () noexcept=default
    ~dna16sam () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::nucleotide_base< dna16sam, 16 >
    constexpr dna16sam complement () const noexcept
    constexpr dna16sam complement () const noexcept
     Return the complement of the letter.
     
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
     Allow explicit construction from any other nucleotide type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using dna16sam_vector = std::vector< dna16sam >
    using dna16sam_vector = std::vector< dna16sam >
     Alias for a std::vector of seqan3::dna16sam.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::nucleotide_base< dna16sam, 16 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    A 16 letter DNA alphabet, containing all IUPAC symbols minus the gap and plus an equality sign ('=').

    \n

    The seqan3::dna16sam alphabet is the nucleotide alphabet used inside the SAM, BAM and CRAM formats. It has all the letters of the seqan3::dna15 alphabet and the extra alphabet character '=' which denotes a nucleotide character identical to the reference. Without the context of this reference sequence, no assumptions can be made about the actual value of '=' letter.

    \n

    Note that you can assign 'U' as a character to dna16sam and it will silently be converted to 'T'. Lower case letters are accepted when assigning from char (just like seqan3::dna15) and unknown characters are silently converted to 'N'.

    \n@@ -247,23 +247,23 @@\n
    #include <seqan3/alphabet/nucleotide/dna16sam.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna16sam letter{'A'_dna16sam};
    \n+
    seqan3::dna16sam letter{'A'_dna16sam};
    \n
    \n-
    letter.assign_char('=');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "="
    \n+
    letter.assign_char('=');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "="
    \n
    \n-
    letter.assign_char('F'); // Unknown characters are implicitly converted to N.
    \n-
    seqan3::debug_stream << letter << '\\n'; // "N";
    \n+
    letter.assign_char('F'); // Unknown characters are implicitly converted to N.
    \n+
    seqan3::debug_stream << letter << '\\n'; // "N";
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dna16sam
    A 16 letter DNA alphabet, containing all IUPAC symbols minus the gap and plus an equality sign ('=').
    Definition dna16sam.hpp:45
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna16sam.hpp
    Provides seqan3::dna16sam.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is stable. Since version 3.1.

    \n

    Friends And Related Symbol Documentation

    \n@@ -273,15 +273,15 @@\n
    \n
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using dna16sam_vector = std::vector<dna16sam>using dna16sam_vector = std::vector<dna16sam>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna3bs.html", "unified_diff": "@@ -137,105 +137,105 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprdna3bs & \n \n \n \n+constexprdna3bs & \n \n \n \n+ \n \n \n \n-\n+\n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr dna3bs () noexcept=default
    dna3bs () noexcept=default
     Defaulted.
     
    \n-constexpr dna3bs (dna3bs const &) noexcept=default
    dna3bs (dna3bs const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna3bs (dna3bs &&) noexcept=default
    dna3bs (dna3bs &&) noexcept=default
     Defaulted.
     
    \n-constexpr dna3bs & operator= (dna3bs const &) noexcept=default
    operator= (dna3bs const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna3bs & operator= (dna3bs &&) noexcept=default
    operator= (dna3bs &&) noexcept=default
     Defaulted.
     
    \n- ~dna3bs () noexcept=default
    ~dna3bs () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::nucleotide_base< dna3bs, 3 >
    constexpr dna3bs complement () const noexcept
    constexpr dna3bs complement () const noexcept
     Return the complement of the letter.
     
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
     Allow explicit construction from any other nucleotide type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using dna3bs_vector = std::vector< dna3bs >
    using dna3bs_vector = std::vector< dna3bs >
     Alias for a std::vector of seqan3::dna3bs.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::nucleotide_base< dna3bs, 3 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The three letter reduced DNA alphabet for bisulfite sequencing mode (A,G,T(=C)).

    \n

    This alphabet represents a reduced version that can be used when dealing with bisulfite-converted data. All 'C's are converted to a 'T' in order to allow comparison of normal sequences with bisulfite-converted sequences. For completeness, this nucleotide alphabet has a complement table, however, it is not recommended to use it when dealing with bisulfite data because the complement of T is ambiguous in reads from bisulfite sequencing. A 'T' can represent a true thymidine or an unmethylated 'C' that was converted into a 'T'. Therefore, complementing a seqan3::dna3bs sequence will further reduce the alphabet to only 'T' and 'A', thereby losing all information about 'G'. When working with bisulfite data, we recommend to create the reverse complement of the seqan3::dna4 / seqan3::dna5 / seqan3::dna15 range first and convert to seqan3::dna3bs later. This avoids simplifying the data by automatically setting 'A' as the complement of 'C'. As an example: The sequence 'ACGTGC' in seqan3::dna4 would be 'ATGTGT' in seqan3::dna3bs. The complement of this seqan3::dna3bs sequence would be 'TATATA', however when complementing the seqan3::dna4 sequence first and afterwards transforming it into seqan3::dna3bs, it would be 'TGTATG' which preserves more information from the original sequence.

    \n

    Like most alphabets, this alphabet cannot be initialised directly from its character representation. Instead initialise/assign from the character literal 'A'_dna3bs or use the function seqan3::dna3bs::assign_char().

    \n@@ -246,23 +246,23 @@\n
    #include <seqan3/alphabet/nucleotide/dna3bs.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna3bs letter{'A'_dna3bs};
    \n+
    seqan3::dna3bs letter{'A'_dna3bs};
    \n
    \n-
    letter.assign_char('C'); // All C will be converted to T.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "T"
    \n+
    letter.assign_char('C'); // All C will be converted to T.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "T"
    \n
    \n-
    letter.assign_char('F'); // Unknown characters are implicitly converted to A.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n+
    letter.assign_char('F'); // Unknown characters are implicitly converted to A.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dna3bs
    The three letter reduced DNA alphabet for bisulfite sequencing mode (A,G,T(=C)).
    Definition dna3bs.hpp:58
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna3bs.hpp
    Provides seqan3::dna3bs, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n
    See also
    https://en.wikipedia.org/wiki/Bisulfite_sequencing
    \n

    This entity is stable. Since version 3.1.

    \n@@ -273,15 +273,15 @@\n
    \n
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using dna3bs_vector = std::vector<dna3bs>using dna3bs_vector = std::vector<dna3bs>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna4.html", "unified_diff": "@@ -137,114 +137,114 @@\n
    \n
    \n
    [legend]
    \n \n \n \n+constexprdna4 \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprdna4 & \n \n \n \n+constexprdna4 & \n \n \n \n+ \n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    \n-constexpr dna4 complement () const noexcept
    complement () const noexcept
     Returns the complement of the current nucleotide.
     
    Constructors, destructor and assignment
    \n-constexpr dna4 () noexcept=default
    dna4 () noexcept=default
     Defaulted.
     
    \n-constexpr dna4 (dna4 const &) noexcept=default
    dna4 (dna4 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna4 (dna4 &&) noexcept=default
    dna4 (dna4 &&) noexcept=default
     Defaulted.
     
    \n-constexpr dna4 & operator= (dna4 const &) noexcept=default
    operator= (dna4 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna4 & operator= (dna4 &&) noexcept=default
    operator= (dna4 &&) noexcept=default
     Defaulted.
     
    \n- ~dna4 () noexcept=default
    ~dna4 () noexcept=default
     Defaulted.
     
    template<std::same_as< rna4 > t>
    constexpr dna4 (t const &r) noexcept
    constexpr dna4 (t const &r) noexcept
     Allow implicit construction from seqan3::rna4 of the same size.
     
    \"-\"/ Public Member Functions inherited from seqan3::nucleotide_base< dna4, 4 >
    constexpr dna4 complement () const noexcept
    constexpr dna4 complement () const noexcept
     Return the complement of the letter.
     
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
     Allow explicit construction from any other nucleotide type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using dna4_vector = std::vector< dna4 >
    using dna4_vector = std::vector< dna4 >
     Alias for a std::vector of seqan3::dna4.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::nucleotide_base< dna4, 4 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The four letter DNA alphabet of A,C,G,T.

    \n

    Note that you can assign 'U' as a character to dna4 and it will silently be converted to 'T'.

    \n

    Like most alphabets, this alphabet cannot be initialised directly from its character representation. Instead initialise/assign from the character literal 'A'_dna4 or use the function seqan3::dna4::assign_char().

    \n@@ -255,35 +255,35 @@\n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna4 letter{'C'_dna4};
    \n+
    seqan3::dna4 letter{'C'_dna4};
    \n
    \n-
    letter.assign_char('F'); // Characters other than IUPAC characters are implicitly converted to A.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n+
    letter.assign_char('F'); // Characters other than IUPAC characters are implicitly converted to A.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n
    \n
    // IUPAC characters are implicitly converted to their best fitting representative
    \n-
    seqan3::debug_stream << letter.assign_char('R') << '\\n'; // prints "A"
    \n-
    seqan3::debug_stream << letter.assign_char('Y') << '\\n'; // prints "C"
    \n-
    seqan3::debug_stream << letter.assign_char('S') << '\\n'; // prints "C"
    \n-
    seqan3::debug_stream << letter.assign_char('W') << '\\n'; // prints "A"
    \n-
    seqan3::debug_stream << letter.assign_char('K') << '\\n'; // prints "G"
    \n-
    seqan3::debug_stream << letter.assign_char('M') << '\\n'; // prints "A"
    \n-
    seqan3::debug_stream << letter.assign_char('B') << '\\n'; // prints "C"
    \n-
    seqan3::debug_stream << letter.assign_char('D') << '\\n'; // prints "A"
    \n-
    seqan3::debug_stream << letter.assign_char('H') << '\\n'; // prints "A"
    \n-
    seqan3::debug_stream << letter.assign_char('V') << '\\n'; // prints "A"
    \n+
    seqan3::debug_stream << letter.assign_char('R') << '\\n'; // prints "A"
    \n+
    seqan3::debug_stream << letter.assign_char('Y') << '\\n'; // prints "C"
    \n+
    seqan3::debug_stream << letter.assign_char('S') << '\\n'; // prints "C"
    \n+
    seqan3::debug_stream << letter.assign_char('W') << '\\n'; // prints "A"
    \n+
    seqan3::debug_stream << letter.assign_char('K') << '\\n'; // prints "G"
    \n+
    seqan3::debug_stream << letter.assign_char('M') << '\\n'; // prints "A"
    \n+
    seqan3::debug_stream << letter.assign_char('B') << '\\n'; // prints "C"
    \n+
    seqan3::debug_stream << letter.assign_char('D') << '\\n'; // prints "A"
    \n+
    seqan3::debug_stream << letter.assign_char('H') << '\\n'; // prints "A"
    \n+
    seqan3::debug_stream << letter.assign_char('V') << '\\n'; // prints "A"
    \n
    \n-
    letter.assign_char('a'); // Lower case letters are the same as their upper case equivalent.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n+
    letter.assign_char('a'); // Lower case letters are the same as their upper case equivalent.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "A"
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dna4
    The four letter DNA alphabet of A,C,G,T.
    Definition dna4.hpp:50
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna4.hpp
    Provides seqan3::dna4, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    If the special char conversion of IUPAC characters is not your desired behaviour, refer to our cookbook for an example of A custom dna4 alphabet that converts all unknown characters to A to change the conversion behaviour.

    \n

    This entity is stable. Since version 3.1.

    \n@@ -296,17 +296,17 @@\n
    \n template<std::same_as< rna4 > t>
    \n \n \n \n \n@@ -319,38 +319,38 @@\n

    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna4.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna4 letter1 = 'C'_rna4; // implicitly converted
    \n-
    seqan3::dna4 letter2{};
    \n-
    letter2 = 'C'_rna4; // implicitly converted
    \n+
    seqan3::dna4 letter1 = 'C'_rna4; // implicitly converted
    \n+
    seqan3::dna4 letter2{};
    \n+
    letter2 = 'C'_rna4; // implicitly converted
    \n
    }
    \n
    rna4.hpp
    Provides seqan3::rna4, container aliases and string literals.
    \n

    \n seqan3::sequences (e.g. seqan3::dna4_vector) in general are not implicitly convertible and must be explicitly copied to be converted:
    \n

    #include <vector>
    \n
    \n
    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna4.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna4_vector vector{'A'_rna4, 'C'_rna4, 'G'_rna4}; // (element-wise) implicit conversion
    \n+
    seqan3::dna4_vector vector{'A'_rna4, 'C'_rna4, 'G'_rna4}; // (element-wise) implicit conversion
    \n
    \n
    // but this won't work:
    \n
    // seqan3::dna4_vector dna4_vector{"ACGT"_rna4};
    \n
    \n
    // as a workaround you can use:
    \n
    // side note: this would also work without the implicit conversion.
    \n-
    seqan3::rna4_vector rna4_vector = "ACGT"_rna4;
    \n+
    seqan3::rna4_vector rna4_vector = "ACGT"_rna4;
    \n
    seqan3::dna4_vector dna4_vector{rna4_vector.begin(), rna4_vector.end()};
    \n
    }
    \n
    seqan3::dna4::dna4_vector
    std::vector< dna4 > dna4_vector
    Alias for a std::vector of seqan3::dna4.
    Definition dna4.hpp:212
    \n \n

    \n You can avoid this copy by using std::ranges::views:
    \n

    #include <vector>
    \n@@ -359,36 +359,36 @@\n
    #include <seqan3/alphabet/nucleotide/rna4.hpp>
    \n
    #include <seqan3/utility/views/convert.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna4_vector vector = "ACG"_dna4;
    \n+
    seqan3::dna4_vector vector = "ACG"_dna4;
    \n
    \n-
    auto rna4_view = vector | seqan3::views::convert<seqan3::rna4>;
    \n+
    auto rna4_view = vector | seqan3::views::convert<seqan3::rna4>;
    \n
    \n-
    for (auto && chr : rna4_view) // converts lazily on-the-fly
    \n+
    for (auto && chr : rna4_view) // converts lazily on-the-fly
    \n
    {
    \n-
    static_assert(std::same_as<decltype(chr), seqan3::rna4 &&>);
    \n+
    static_assert(std::same_as<decltype(chr), seqan3::rna4 &&>);
    \n
    }
    \n
    }
    \n
    seqan3::rna4
    The four letter RNA alphabet of A,C,G,U.
    Definition rna4.hpp:46
    \n
    convert.hpp
    Provides seqan3::views::convert.
    \n

    \n This conversion constructor only allows converting seqan3::rna4 to seqan3::dna4. Other alphabets that inherit from seqan3::rna4 will not be implicitly convertible to seqan3::dna4.
    \n

    #include <seqan3/alphabet/nucleotide/dna4.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna4.hpp>
    \n
    \n-
    struct my_dna4 : public seqan3::dna4
    \n+
    struct my_dna4 : public seqan3::dna4
    \n
    {
    \n
    // using seqan3::dna4::dna4; // uncomment to import implicit conversion shown by letter1
    \n
    };
    \n
    \n-
    struct my_rna4 : public seqan3::rna4
    \n+
    struct my_rna4 : public seqan3::rna4
    \n
    {};
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    // my_dna4 letter1 = 'C'_rna4; // NO automatic implicit conversion!
    \n@@ -406,15 +406,15 @@\n
    \n
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::dna4::dna4 constexpr seqan3::dna4::dna4 (t const & t const & r)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using dna4_vector = std::vector<dna4>using dna4_vector = std::vector<dna4>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dna5.html", "unified_diff": "@@ -137,109 +137,109 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprdna5 & \n \n \n \n+constexprdna5 & \n \n \n \n+ \n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr dna5 () noexcept=default
    dna5 () noexcept=default
     Defaulted.
     
    \n-constexpr dna5 (dna5 const &) noexcept=default
    dna5 (dna5 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna5 (dna5 &&) noexcept=default
    dna5 (dna5 &&) noexcept=default
     Defaulted.
     
    \n-constexpr dna5 & operator= (dna5 const &) noexcept=default
    operator= (dna5 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dna5 & operator= (dna5 &&) noexcept=default
    operator= (dna5 &&) noexcept=default
     Defaulted.
     
    \n- ~dna5 () noexcept=default
    ~dna5 () noexcept=default
     Defaulted.
     
    template<std::same_as< rna5 > t>
    constexpr dna5 (t const &r) noexcept
    constexpr dna5 (t const &r) noexcept
     Allow implicit construction from seqan3::rna5 of the same size.
     
    \"-\"/ Public Member Functions inherited from seqan3::nucleotide_base< dna5, 5 >
    constexpr dna5 complement () const noexcept
    constexpr dna5 complement () const noexcept
     Return the complement of the letter.
     
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
    constexpr nucleotide_base (other_nucl_type const &other) noexcept
     Allow explicit construction from any other nucleotide type and convert via the character representation.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< derived_type, size, char_t >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr derived_type & assign_char (char_type const chr) noexcept
    constexpr derived_type & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr derived_type & assign_rank (rank_type const c) noexcept
    constexpr derived_type & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n

    \n Related Symbols

    (Note that these are not member symbols.)

    \n
    using dna5_vector = std::vector< dna5 >
    using dna5_vector = std::vector< dna5 >
     Alias for a std::vector of seqan3::dna5.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Member Functions inherited from seqan3::nucleotide_base< dna5, 5 >
    static constexpr bool char_is_valid (char_type const c) noexcept
    static constexpr bool char_is_valid (char_type const c) noexcept
     Validate whether a character value has a one-to-one mapping to an alphabet value.
     
    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< derived_type, size, char_t >
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
    static constexpr detail::min_viable_uint_t< size > alphabet_size = size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< derived_type, size, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
    using char_type = std::conditional_t< std::same_as< char_t, void >, char, char_t >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The five letter DNA alphabet of A,C,G,T and the unknown character N.

    \n

    Note that you can assign 'U' as a character to dna5 and it will silently be converted to 'T'.

    \n

    Like most alphabets, this alphabet cannot be initialised directly from its character representation. Instead initialise/assign from the character literal 'A'_dna5 or use the function seqan3::dna5::assign_char().

    \n@@ -250,23 +250,23 @@\n
    #include <seqan3/alphabet/nucleotide/dna5.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna5 letter{'A'_dna5};
    \n+
    seqan3::dna5 letter{'A'_dna5};
    \n
    \n-
    letter.assign_char('C');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n+
    letter.assign_char('C');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "C"
    \n
    \n-
    letter.assign_char('F'); // Unknown characters are implicitly converted to N.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "N"
    \n+
    letter.assign_char('F'); // Unknown characters are implicitly converted to N.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "N"
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dna5
    The five letter DNA alphabet of A,C,G,T and the unknown character N.
    Definition dna5.hpp:48
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dna5.hpp
    Provides seqan3::dna5, container aliases and string literals.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is stable. Since version 3.1.

    \n

    Constructor & Destructor Documentation

    \n@@ -278,17 +278,17 @@\n
    \n template<std::same_as< rna5 > t>
    \n \n \n \n \n@@ -301,38 +301,38 @@\n

    #include <seqan3/alphabet/nucleotide/dna5.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna5.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna5 letter1 = 'C'_rna5; // implicitly converted
    \n-
    seqan3::dna5 letter2{};
    \n-
    letter2 = 'C'_rna5; // implicitly converted
    \n+
    seqan3::dna5 letter1 = 'C'_rna5; // implicitly converted
    \n+
    seqan3::dna5 letter2{};
    \n+
    letter2 = 'C'_rna5; // implicitly converted
    \n
    }
    \n
    rna5.hpp
    Provides seqan3::rna5, container aliases and string literals.
    \n

    \n seqan3::sequences (e.g. seqan3::dna5_vector) in general are not implicitly convertible and must be explicitly copied to be converted:
    \n

    #include <vector>
    \n
    \n
    #include <seqan3/alphabet/nucleotide/dna5.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna5.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna5_vector vector{'A'_rna5, 'C'_rna5, 'G'_rna5}; // (element-wise) implicit conversion
    \n+
    seqan3::dna5_vector vector{'A'_rna5, 'C'_rna5, 'G'_rna5}; // (element-wise) implicit conversion
    \n
    \n
    // but this won't work:
    \n
    // seqan3::dna5_vector dna5_vector{"ACGT"_rna5};
    \n
    \n
    // as a workaround you can use:
    \n
    // side note: this would also work without the implicit conversion.
    \n-
    seqan3::rna5_vector rna5_vector = "ACGT"_rna5;
    \n+
    seqan3::rna5_vector rna5_vector = "ACGT"_rna5;
    \n
    seqan3::dna5_vector dna5_vector{rna5_vector.begin(), rna5_vector.end()};
    \n
    }
    \n
    seqan3::dna5::dna5_vector
    std::vector< dna5 > dna5_vector
    Alias for a std::vector of seqan3::dna5.
    Definition dna5.hpp:153
    \n \n

    \n You can avoid this copy by using std::ranges::views:
    \n

    #include <vector>
    \n@@ -341,36 +341,36 @@\n
    #include <seqan3/alphabet/nucleotide/rna5.hpp>
    \n
    #include <seqan3/utility/views/convert.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dna5_vector vector = "ACG"_dna5;
    \n+
    seqan3::dna5_vector vector = "ACG"_dna5;
    \n
    \n-
    auto rna5_view = vector | seqan3::views::convert<seqan3::rna5>;
    \n+
    auto rna5_view = vector | seqan3::views::convert<seqan3::rna5>;
    \n
    \n-
    for (auto && chr : rna5_view) // converts lazily on-the-fly
    \n+
    for (auto && chr : rna5_view) // converts lazily on-the-fly
    \n
    {
    \n-
    static_assert(std::same_as<decltype(chr), seqan3::rna5 &&>);
    \n+
    static_assert(std::same_as<decltype(chr), seqan3::rna5 &&>);
    \n
    }
    \n
    }
    \n
    seqan3::rna5
    The five letter RNA alphabet of A,C,G,U and the unknown character N.
    Definition rna5.hpp:46
    \n
    convert.hpp
    Provides seqan3::views::convert.
    \n

    \n This conversion constructor only allows converting seqan3::rna5 to seqan3::dna5. Other alphabets that inherit from seqan3::rna5 will not be implicitly convertible to seqan3::dna5.
    \n

    #include <seqan3/alphabet/nucleotide/dna5.hpp>
    \n
    #include <seqan3/alphabet/nucleotide/rna5.hpp>
    \n
    \n-
    struct my_dna5 : public seqan3::dna5
    \n+
    struct my_dna5 : public seqan3::dna5
    \n
    {
    \n
    // using seqan3::dna5::dna5; // uncomment to import implicit conversion shown by letter1
    \n
    };
    \n
    \n-
    struct my_rna5 : public seqan3::rna5
    \n+
    struct my_rna5 : public seqan3::rna5
    \n
    {};
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n
    // my_dna5 letter1 = 'C'_rna5; // NO automatic implicit conversion!
    \n@@ -388,15 +388,15 @@\n
    \n
    \n
    \n \n \n- \n+ \n \n- \n+ \n \n \n \n
    constexpr seqan3::dna5::dna5 constexpr seqan3::dna5::dna5 (t const & t const & r)
    \n     		\n inlineconstexprnoexcept
    \n \n \n \n \n
    \n \n \n- \n+ \n \n
    using dna5_vector = std::vector<dna5>using dna5_vector = std::vector<dna5>
    \n     		\n related
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dot__bracket3.html", "unified_diff": "@@ -136,103 +136,103 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprdot_bracket3 & \n \n \n \n+constexprdot_bracket3 & \n \n \n \n+ \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr dot_bracket3 () noexcept=default
    dot_bracket3 () noexcept=default
     Defaulted.
     
    \n-constexpr dot_bracket3 (dot_bracket3 const &) noexcept=default
    dot_bracket3 (dot_bracket3 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dot_bracket3 (dot_bracket3 &&) noexcept=default
    dot_bracket3 (dot_bracket3 &&) noexcept=default
     Defaulted.
     
    \n-constexpr dot_bracket3 & operator= (dot_bracket3 const &) noexcept=default
    operator= (dot_bracket3 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dot_bracket3 & operator= (dot_bracket3 &&) noexcept=default
    operator= (dot_bracket3 &&) noexcept=default
     Defaulted.
     
    \n- ~dot_bracket3 () noexcept=default
    ~dot_bracket3 () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< dot_bracket3, 3 >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr dot_bracket3 & assign_char (char_type const chr) noexcept
    constexpr dot_bracket3 & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr dot_bracket3 & assign_rank (rank_type const c) noexcept
    constexpr dot_bracket3 & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    RNA structure properties

    static constexpr uint8_t max_pseudoknot_depth {1u}
    static constexpr uint8_t max_pseudoknot_depth {1u}
     The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.
     
    constexpr bool is_pair_open () const noexcept
    constexpr bool is_pair_open () const noexcept
     Check whether the character represents a rightward interaction in an RNA structure.
     
    constexpr bool is_pair_close () const noexcept
    constexpr bool is_pair_close () const noexcept
     Check whether the character represents a leftward interaction in an RNA structure.
     
    constexpr bool is_unpaired () const noexcept
    constexpr bool is_unpaired () const noexcept
     Check whether the character represents an unpaired position in an RNA structure.
     
    constexpr std::optional< uint8_t > pseudoknot_id () const noexcept
    constexpr std::optional< uint8_t > pseudoknot_id () const noexcept
     Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< dot_bracket3, 3 >
    static constexpr detail::min_viable_uint_t< size > alphabet_size
    static constexpr detail::min_viable_uint_t< size > alphabet_size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< dot_bracket3, 3 >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The three letter RNA structure alphabet of the characters \".()\".

    \n

    The brackets denote RNA base pair interactions. Every left bracket must have a corresponding right bracket. Pseudoknots cannot be expressed in this format. A dot (.) represents a character that is not paired.

    \n
    GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
    \n@@ -245,23 +245,23 @@\n
    #include <seqan3/alphabet/structure/dot_bracket3.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dot_bracket3 letter{'.'_db3};
    \n+
    seqan3::dot_bracket3 letter{'.'_db3};
    \n
    \n-
    letter.assign_char('(');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "("
    \n+
    letter.assign_char('(');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "("
    \n
    \n-
    letter.assign_char('F'); // Unknown characters are implicitly converted to '.'.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "."
    \n+
    letter.assign_char('F'); // Unknown characters are implicitly converted to '.'.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "."
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dot_bracket3
    The three letter RNA structure alphabet of the characters ".()".
    Definition dot_bracket3.hpp:51
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dot_bracket3.hpp
    Provides the dot bracket format for RNA structure.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n

    Member Function Documentation

    \n@@ -271,15 +271,15 @@\n
    \n
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr bool seqan3::dot_bracket3::is_pair_close constexpr bool seqan3::dot_bracket3::is_pair_close () const
    \n     		\n@@ -300,15 +300,15 @@\n
    \n
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr bool seqan3::dot_bracket3::is_pair_open constexpr bool seqan3::dot_bracket3::is_pair_open () const
    \n     		\n@@ -329,15 +329,15 @@\n
    \n
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr bool seqan3::dot_bracket3::is_unpaired constexpr bool seqan3::dot_bracket3::is_unpaired () const
    \n     		\n@@ -358,15 +358,15 @@\n
    \n
    \n \n \n \n
    \n \n \n- \n+ \n \n \n \n \n
    constexpr std::optional< uint8_t > seqan3::dot_bracket3::pseudoknot_id constexpr std::optional< uint8_t > seqan3::dot_bracket3::pseudoknot_id () const
    \n     		\n@@ -388,15 +388,15 @@\n
    \n
    \n \n \n \n \n \n
    \n \n \n- \n+ \n \n
    constexpr uint8_t seqan3::dot_bracket3::max_pseudoknot_depth {1u}constexpr uint8_t seqan3::dot_bracket3::max_pseudoknot_depth {1u}
    \n     		\n staticconstexpr
    \n"}, {"source1": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9.html", "source2": "./usr/share/doc/libseqan3-dev/html/classseqan3_1_1dssp9.html", "unified_diff": "@@ -136,86 +136,86 @@\n
    \n
    [legend]
    \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexprdssp9 & \n \n \n \n+constexprdssp9 & \n \n \n \n+ \n \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpr \n \n \n \n+constexpralphabet_base & \n \n \n \n+constexpralphabet_base & \n \n \n \n+ \n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Public Member Functions

    Constructors, destructor and assignment
    \n-constexpr dssp9 () noexcept=default
    dssp9 () noexcept=default
     Defaulted.
     
    \n-constexpr dssp9 (dssp9 const &) noexcept=default
    dssp9 (dssp9 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dssp9 (dssp9 &&) noexcept=default
    dssp9 (dssp9 &&) noexcept=default
     Defaulted.
     
    \n-constexpr dssp9 & operator= (dssp9 const &) noexcept=default
    operator= (dssp9 const &) noexcept=default
     Defaulted.
     
    \n-constexpr dssp9 & operator= (dssp9 &&) noexcept=default
    operator= (dssp9 &&) noexcept=default
     Defaulted.
     
    \n- ~dssp9 () noexcept=default
    ~dssp9 () noexcept=default
     Defaulted.
     
    \"-\"/ Public Member Functions inherited from seqan3::alphabet_base< dssp9, 9 >
    \n-constexpr alphabet_base () noexcept=default
    alphabet_base () noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base const &) noexcept=default
    alphabet_base (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base (alphabet_base &&) noexcept=default
    alphabet_base (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base const &) noexcept=default
    operator= (alphabet_base const &) noexcept=default
     Defaulted.
     
    \n-constexpr alphabet_base & operator= (alphabet_base &&) noexcept=default
    operator= (alphabet_base &&) noexcept=default
     Defaulted.
     
    \n- ~alphabet_base () noexcept=default
    ~alphabet_base () noexcept=default
     Defaulted.
     
    constexpr char_type to_char () const noexcept
    constexpr char_type to_char () const noexcept
     Return the letter as a character of char_type.
     
    constexpr rank_type to_rank () const noexcept
    constexpr rank_type to_rank () const noexcept
     Return the letter's numeric value (rank in the alphabet).
     
    constexpr dssp9 & assign_char (char_type const chr) noexcept
    constexpr dssp9 & assign_char (char_type const chr) noexcept
     Assign from a character, implicitly converts invalid characters.
     
    constexpr dssp9 & assign_rank (rank_type const c) noexcept
    constexpr dssp9 & assign_rank (rank_type const c) noexcept
     Assign from a numeric value.
     
    \n \n \n-\n+\n \n \n \n-\n+\n \n \n-\n+\n \n \n

    \n Additional Inherited Members

    \"-\"/ Static Public Attributes inherited from seqan3::alphabet_base< dssp9, 9 >
    static constexpr detail::min_viable_uint_t< size > alphabet_size
    static constexpr detail::min_viable_uint_t< size > alphabet_size
     The size of the alphabet, i.e. the number of different values it can take.
     
    \"-\"/ Protected Types inherited from seqan3::alphabet_base< dssp9, 9 >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
    using char_type = std::conditional_t< std::same_as< char, void >, char, char >
     The char representation; conditional needed to make semi alphabet definitions legal.
     
    using rank_type = detail::min_viable_uint_t< size - 1 >
    using rank_type = detail::min_viable_uint_t< size - 1 >
     The type of the alphabet when represented as a number (e.g. via to_rank()).
     
    \n

    Detailed Description

    \n

    The protein structure alphabet of the characters \"HGIEBTSCX\".

    \n

    The DSSP annotation links structure elements to protein sequences. Originally created with 7 letters as a file format for the DSSP program (https://swift.cmbi.umcn.nl/gv/dssp/), it is also used in the stockholm file format for structure alignments, extended by the characters C and X (https://en.wikipedia.org/wiki/Stockholm_format).

    \n

    The letter abbreviations are as follows:

    \n@@ -228,23 +228,23 @@\n
    #include <seqan3/alphabet/structure/dssp9.hpp>
    \n
    #include <seqan3/core/debug_stream.hpp>
    \n
    \n
    int main()
    \n
    {
    \n
    using namespace seqan3::literals;
    \n
    \n-
    seqan3::dssp9 letter{'H'_dssp9};
    \n+
    seqan3::dssp9 letter{'H'_dssp9};
    \n
    \n-
    letter.assign_char('B');
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "B"
    \n+
    letter.assign_char('B');
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "B"
    \n
    \n-
    letter.assign_char('F'); // Unknown characters are implicitly converted to 'X'.
    \n-
    seqan3::debug_stream << letter << '\\n'; // prints "X"
    \n+
    letter.assign_char('F'); // Unknown characters are implicitly converted to 'X'.
    \n+
    seqan3::debug_stream << letter << '\\n'; // prints "X"
    \n
    }
    \n-
    seqan3::alphabet_base::assign_char
    constexpr derived_type & assign_char(char_type const chr) noexcept
    Assign from a character, implicitly converts invalid characters.
    Definition alphabet_base.hpp:160
    \n+
    seqan3::debug_stream_type
    A "pretty printer" for most SeqAn data structures and related types.
    Definition debug_stream_type.hpp:79
    \n
    seqan3::dssp9
    The protein structure alphabet of the characters "HGIEBTSCX".
    Definition dssp9.hpp:59
    \n
    debug_stream.hpp
    Provides seqan3::debug_stream and related types.
    \n
    dssp9.hpp
    Provides the dssp format for protein structure.
    \n
    seqan3::debug_stream
    debug_stream_type debug_stream
    A global instance of seqan3::debug_stream_type.
    Definition debug_stream.hpp:37
    \n
    seqan3::literals
    The SeqAn namespace for literals.
    \n

    This entity is experimental and subject to change in the future. Experimental since version 3.1.

    \n
    The documentation for this class was generated from the following file: