Diff of the two buildlogs: -- --- b1/build.log 2023-05-22 02:58:46.054569231 +0000 +++ b2/build.log 2023-05-22 03:39:03.780506676 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Sun May 21 14:50:52 -12 2023 -I: pbuilder-time-stamp: 1684723852 +I: Current time: Mon May 22 16:58:57 +14 2023 +I: pbuilder-time-stamp: 1684724337 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bookworm-reproducible-base.tgz] I: copying local configuration @@ -16,7 +16,7 @@ I: copying [./ataqv_1.3.0+ds.orig.tar.xz] I: copying [./ataqv_1.3.0+ds-2.debian.tar.xz] I: Extracting source -gpgv: Signature made Thu Sep 29 22:44:49 2022 -12 +gpgv: Signature made Sat Oct 1 00:44:49 2022 +14 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key @@ -34,135 +34,167 @@ dpkg-source: info: applying reproducible_build I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/32670/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/D01_modify_environment starting +debug: Running on cbxi4a. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 May 22 16:59 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='armhf' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=3 ' - DISTRIBUTION='bookworm' - HOME='/root' - HOST_ARCH='armhf' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="15" [3]="1" [4]="release" [5]="arm-unknown-linux-gnueabihf") + BASH_VERSION='5.2.15(1)-release' + BUILDDIR=/build + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=armhf + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=4 ' + DIRSTACK=() + DISTRIBUTION=bookworm + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=arm + HOST_ARCH=armhf IFS=' ' - INVOCATION_ID='c92cef8da69c427fbddedf9a54e634ae' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='32670' - PS1='# ' - PS2='> ' + INVOCATION_ID=51c8db9b47bd40ce9556b0eceb708a50 + LANG=C + LANGUAGE=it_CH:it + LC_ALL=C + MACHTYPE=arm-unknown-linux-gnueabihf + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnueabihf + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=27457 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/pbuilderrc_Odvn --distribution bookworm --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/b1 --logfile b1/build.log ataqv_1.3.0+ds-2.dsc' - SUDO_GID='113' - SUDO_UID='107' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://10.0.0.15:3142/' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/pbuilderrc_t217 --distribution bookworm --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/b2 --logfile b2/build.log --extrapackages usrmerge ataqv_1.3.0+ds-2.dsc' + SUDO_GID=113 + SUDO_UID=107 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://10.0.0.15:3142/ I: uname -a - Linux virt64c 5.10.0-23-arm64 #1 SMP Debian 5.10.179-1 (2023-05-12) aarch64 GNU/Linux + Linux i-capture-the-hostname 5.10.0-23-armmp #1 SMP Debian 5.10.179-1 (2023-05-12) armv7l GNU/Linux I: ls -l /bin total 5072 - -rwxr-xr-x 1 root root 838488 Apr 23 09:24 bash - -rwxr-xr-x 3 root root 67144 Sep 18 2022 bunzip2 - -rwxr-xr-x 3 root root 67144 Sep 18 2022 bzcat - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzcmp -> bzdiff - -rwxr-xr-x 1 root root 2225 Sep 18 2022 bzdiff - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzegrep -> bzgrep - -rwxr-xr-x 1 root root 4893 Nov 27 2021 bzexe - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzfgrep -> bzgrep - -rwxr-xr-x 1 root root 3775 Sep 18 2022 bzgrep - -rwxr-xr-x 3 root root 67144 Sep 18 2022 bzip2 - -rwxr-xr-x 1 root root 67112 Sep 18 2022 bzip2recover - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzless -> bzmore - -rwxr-xr-x 1 root root 1297 Sep 18 2022 bzmore - -rwxr-xr-x 1 root root 67632 Sep 20 2022 cat - -rwxr-xr-x 1 root root 67676 Sep 20 2022 chgrp - -rwxr-xr-x 1 root root 67644 Sep 20 2022 chmod - -rwxr-xr-x 1 root root 67684 Sep 20 2022 chown - -rwxr-xr-x 1 root root 133532 Sep 20 2022 cp - -rwxr-xr-x 1 root root 132868 Jan 5 01:20 dash - -rwxr-xr-x 1 root root 133220 Sep 20 2022 date - -rwxr-xr-x 1 root root 67732 Sep 20 2022 dd - -rwxr-xr-x 1 root root 68104 Sep 20 2022 df - -rwxr-xr-x 1 root root 133632 Sep 20 2022 dir - -rwxr-xr-x 1 root root 59128 Mar 22 21:02 dmesg - lrwxrwxrwx 1 root root 8 Dec 19 01:33 dnsdomainname -> hostname - lrwxrwxrwx 1 root root 8 Dec 19 01:33 domainname -> hostname - -rwxr-xr-x 1 root root 67560 Sep 20 2022 echo - -rwxr-xr-x 1 root root 41 Jan 24 02:43 egrep - -rwxr-xr-x 1 root root 67548 Sep 20 2022 false - -rwxr-xr-x 1 root root 41 Jan 24 02:43 fgrep - -rwxr-xr-x 1 root root 55748 Mar 22 21:02 findmnt - -rwsr-xr-x 1 root root 26208 Mar 22 20:15 fusermount - -rwxr-xr-x 1 root root 128608 Jan 24 02:43 grep - -rwxr-xr-x 2 root root 2346 Apr 9 2022 gunzip - -rwxr-xr-x 1 root root 6447 Apr 9 2022 gzexe - -rwxr-xr-x 1 root root 64220 Apr 9 2022 gzip - -rwxr-xr-x 1 root root 67032 Dec 19 01:33 hostname - -rwxr-xr-x 1 root root 67720 Sep 20 2022 ln - -rwxr-xr-x 1 root root 35132 Mar 22 21:51 login - -rwxr-xr-x 1 root root 133632 Sep 20 2022 ls - -rwxr-xr-x 1 root root 136808 Mar 22 21:02 lsblk - -rwxr-xr-x 1 root root 67800 Sep 20 2022 mkdir - -rwxr-xr-x 1 root root 67764 Sep 20 2022 mknod - -rwxr-xr-x 1 root root 67596 Sep 20 2022 mktemp - -rwxr-xr-x 1 root root 38504 Mar 22 21:02 more - -rwsr-xr-x 1 root root 38496 Mar 22 21:02 mount - -rwxr-xr-x 1 root root 9824 Mar 22 21:02 mountpoint - -rwxr-xr-x 1 root root 133532 Sep 20 2022 mv - lrwxrwxrwx 1 root root 8 Dec 19 01:33 nisdomainname -> hostname - lrwxrwxrwx 1 root root 14 Apr 2 18:25 pidof -> /sbin/killall5 - -rwxr-xr-x 1 root root 67608 Sep 20 2022 pwd - lrwxrwxrwx 1 root root 4 Apr 23 09:24 rbash -> bash - -rwxr-xr-x 1 root root 67600 Sep 20 2022 readlink - -rwxr-xr-x 1 root root 67672 Sep 20 2022 rm - -rwxr-xr-x 1 root root 67600 Sep 20 2022 rmdir - -rwxr-xr-x 1 root root 67400 Nov 2 2022 run-parts - -rwxr-xr-x 1 root root 133372 Jan 5 07:55 sed - lrwxrwxrwx 1 root root 4 Jan 5 01:20 sh -> dash - -rwxr-xr-x 1 root root 67584 Sep 20 2022 sleep - -rwxr-xr-x 1 root root 67644 Sep 20 2022 stty - -rwsr-xr-x 1 root root 50800 Mar 22 21:02 su - -rwxr-xr-x 1 root root 67584 Sep 20 2022 sync - -rwxr-xr-x 1 root root 336764 Apr 6 02:25 tar - -rwxr-xr-x 1 root root 67144 Nov 2 2022 tempfile - -rwxr-xr-x 1 root root 133224 Sep 20 2022 touch - -rwxr-xr-x 1 root root 67548 Sep 20 2022 true - -rwxr-xr-x 1 root root 9768 Mar 22 20:15 ulockmgr_server - -rwsr-xr-x 1 root root 22108 Mar 22 21:02 umount - -rwxr-xr-x 1 root root 67572 Sep 20 2022 uname - -rwxr-xr-x 2 root root 2346 Apr 9 2022 uncompress - -rwxr-xr-x 1 root root 133632 Sep 20 2022 vdir - -rwxr-xr-x 1 root root 42608 Mar 22 21:02 wdctl - lrwxrwxrwx 1 root root 8 Dec 19 01:33 ypdomainname -> hostname - -rwxr-xr-x 1 root root 1984 Apr 9 2022 zcat - -rwxr-xr-x 1 root root 1678 Apr 9 2022 zcmp - -rwxr-xr-x 1 root root 6460 Apr 9 2022 zdiff - -rwxr-xr-x 1 root root 29 Apr 9 2022 zegrep - -rwxr-xr-x 1 root root 29 Apr 9 2022 zfgrep - -rwxr-xr-x 1 root root 2081 Apr 9 2022 zforce - -rwxr-xr-x 1 root root 8103 Apr 9 2022 zgrep - -rwxr-xr-x 1 root root 2206 Apr 9 2022 zless - -rwxr-xr-x 1 root root 1842 Apr 9 2022 zmore - -rwxr-xr-x 1 root root 4577 Apr 9 2022 znew -I: user script /srv/workspace/pbuilder/32670/tmp/hooks/D02_print_environment finished + -rwxr-xr-x 1 root root 838488 Apr 24 11:24 bash + -rwxr-xr-x 3 root root 67144 Sep 19 2022 bunzip2 + -rwxr-xr-x 3 root root 67144 Sep 19 2022 bzcat + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzcmp -> bzdiff + -rwxr-xr-x 1 root root 2225 Sep 19 2022 bzdiff + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzegrep -> bzgrep + -rwxr-xr-x 1 root root 4893 Nov 28 2021 bzexe + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzfgrep -> bzgrep + -rwxr-xr-x 1 root root 3775 Sep 19 2022 bzgrep + -rwxr-xr-x 3 root root 67144 Sep 19 2022 bzip2 + -rwxr-xr-x 1 root root 67112 Sep 19 2022 bzip2recover + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzless -> bzmore + -rwxr-xr-x 1 root root 1297 Sep 19 2022 bzmore + -rwxr-xr-x 1 root root 67632 Sep 21 2022 cat + -rwxr-xr-x 1 root root 67676 Sep 21 2022 chgrp + -rwxr-xr-x 1 root root 67644 Sep 21 2022 chmod + -rwxr-xr-x 1 root root 67684 Sep 21 2022 chown + -rwxr-xr-x 1 root root 133532 Sep 21 2022 cp + -rwxr-xr-x 1 root root 132868 Jan 6 03:20 dash + -rwxr-xr-x 1 root root 133220 Sep 21 2022 date + -rwxr-xr-x 1 root root 67732 Sep 21 2022 dd + -rwxr-xr-x 1 root root 68104 Sep 21 2022 df + -rwxr-xr-x 1 root root 133632 Sep 21 2022 dir + -rwxr-xr-x 1 root root 59128 Mar 23 23:02 dmesg + lrwxrwxrwx 1 root root 8 Dec 20 03:33 dnsdomainname -> hostname + lrwxrwxrwx 1 root root 8 Dec 20 03:33 domainname -> hostname + -rwxr-xr-x 1 root root 67560 Sep 21 2022 echo + -rwxr-xr-x 1 root root 41 Jan 25 04:43 egrep + -rwxr-xr-x 1 root root 67548 Sep 21 2022 false + -rwxr-xr-x 1 root root 41 Jan 25 04:43 fgrep + -rwxr-xr-x 1 root root 55748 Mar 23 23:02 findmnt + -rwsr-xr-x 1 root root 26208 Mar 23 22:15 fusermount + -rwxr-xr-x 1 root root 128608 Jan 25 04:43 grep + -rwxr-xr-x 2 root root 2346 Apr 10 2022 gunzip + -rwxr-xr-x 1 root root 6447 Apr 10 2022 gzexe + -rwxr-xr-x 1 root root 64220 Apr 10 2022 gzip + -rwxr-xr-x 1 root root 67032 Dec 20 03:33 hostname + -rwxr-xr-x 1 root root 67720 Sep 21 2022 ln + -rwxr-xr-x 1 root root 35132 Mar 23 23:51 login + -rwxr-xr-x 1 root root 133632 Sep 21 2022 ls + -rwxr-xr-x 1 root root 136808 Mar 23 23:02 lsblk + -rwxr-xr-x 1 root root 67800 Sep 21 2022 mkdir + -rwxr-xr-x 1 root root 67764 Sep 21 2022 mknod + -rwxr-xr-x 1 root root 67596 Sep 21 2022 mktemp + -rwxr-xr-x 1 root root 38504 Mar 23 23:02 more + -rwsr-xr-x 1 root root 38496 Mar 23 23:02 mount + -rwxr-xr-x 1 root root 9824 Mar 23 23:02 mountpoint + -rwxr-xr-x 1 root root 133532 Sep 21 2022 mv + lrwxrwxrwx 1 root root 8 Dec 20 03:33 nisdomainname -> hostname + lrwxrwxrwx 1 root root 14 Apr 3 20:25 pidof -> /sbin/killall5 + -rwxr-xr-x 1 root root 67608 Sep 21 2022 pwd + lrwxrwxrwx 1 root root 4 Apr 24 11:24 rbash -> bash + -rwxr-xr-x 1 root root 67600 Sep 21 2022 readlink + -rwxr-xr-x 1 root root 67672 Sep 21 2022 rm + -rwxr-xr-x 1 root root 67600 Sep 21 2022 rmdir + -rwxr-xr-x 1 root root 67400 Nov 3 2022 run-parts + -rwxr-xr-x 1 root root 133372 Jan 6 09:55 sed + lrwxrwxrwx 1 root root 9 May 22 16:59 sh -> /bin/bash + -rwxr-xr-x 1 root root 67584 Sep 21 2022 sleep + -rwxr-xr-x 1 root root 67644 Sep 21 2022 stty + -rwsr-xr-x 1 root root 50800 Mar 23 23:02 su + -rwxr-xr-x 1 root root 67584 Sep 21 2022 sync + -rwxr-xr-x 1 root root 336764 Apr 7 04:25 tar + -rwxr-xr-x 1 root root 67144 Nov 3 2022 tempfile + -rwxr-xr-x 1 root root 133224 Sep 21 2022 touch + -rwxr-xr-x 1 root root 67548 Sep 21 2022 true + -rwxr-xr-x 1 root root 9768 Mar 23 22:15 ulockmgr_server + -rwsr-xr-x 1 root root 22108 Mar 23 23:02 umount + -rwxr-xr-x 1 root root 67572 Sep 21 2022 uname + -rwxr-xr-x 2 root root 2346 Apr 10 2022 uncompress + -rwxr-xr-x 1 root root 133632 Sep 21 2022 vdir + -rwxr-xr-x 1 root root 42608 Mar 23 23:02 wdctl + lrwxrwxrwx 1 root root 8 Dec 20 03:33 ypdomainname -> hostname + -rwxr-xr-x 1 root root 1984 Apr 10 2022 zcat + -rwxr-xr-x 1 root root 1678 Apr 10 2022 zcmp + -rwxr-xr-x 1 root root 6460 Apr 10 2022 zdiff + -rwxr-xr-x 1 root root 29 Apr 10 2022 zegrep + -rwxr-xr-x 1 root root 29 Apr 10 2022 zfgrep + -rwxr-xr-x 1 root root 2081 Apr 10 2022 zforce + -rwxr-xr-x 1 root root 8103 Apr 10 2022 zgrep + -rwxr-xr-x 1 root root 2206 Apr 10 2022 zless + -rwxr-xr-x 1 root root 1842 Apr 10 2022 zmore + -rwxr-xr-x 1 root root 4577 Apr 10 2022 znew +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -354,7 +386,7 @@ Get: 120 http://deb.debian.org/debian bookworm/main armhf node-d3-zoom all 1.8.3-4 [20.1 kB] Get: 121 http://deb.debian.org/debian bookworm/main armhf node-d3 all 5.16.0-10 [219 kB] Get: 122 http://deb.debian.org/debian bookworm/main armhf node-normalize.css all 8.0.1-5 [12.7 kB] -Fetched 54.2 MB in 1s (40.5 MB/s) +Fetched 54.2 MB in 6s (9844 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package liblocale-gettext-perl. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19329 files and directories currently installed.) @@ -858,8 +890,19 @@ Writing extended state information... Building tag database... -> Finished parsing the build-deps +Reading package lists... +Building dependency tree... +Reading state information... +usrmerge is already the newest version (35). +0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package -I: Running cd /build/ataqv-1.3.0+ds/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../ataqv_1.3.0+ds-2_source.changes +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/A99_set_merged_usr starting +Re-configuring usrmerge... +removed '/etc/unsupported-skip-usrmerge-conversion' +The system has been successfully converted. +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/ataqv-1.3.0+ds/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../ataqv_1.3.0+ds-2_source.changes dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.3.0+ds-2 dpkg-buildpackage: info: source distribution unstable @@ -869,16 +912,16 @@ debian/rules clean dh clean dh_auto_clean - make -j3 clean -make[1]: Entering directory '/build/ataqv-1.3.0+ds' -make[1]: Leaving directory '/build/ataqv-1.3.0+ds' + make -j4 clean +make[1]: ingresso nella directory «/build/ataqv-1.3.0+ds» +make[1]: uscita dalla directory «/build/ataqv-1.3.0+ds» dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure -make[1]: Entering directory '/build/ataqv-1.3.0+ds' +make[1]: ingresso nella directory «/build/ataqv-1.3.0+ds» cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css @@ -896,15 +939,16 @@ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js -make[1]: Leaving directory '/build/ataqv-1.3.0+ds' +make[1]: uscita dalla directory «/build/ataqv-1.3.0+ds» debian/rules override_dh_auto_build -make[1]: Entering directory '/build/ataqv-1.3.0+ds' +make[1]: ingresso nella directory «/build/ataqv-1.3.0+ds» dh_auto_build -- all testing/run_ataqv_tests - make -j3 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests -make[2]: Entering directory '/build/ataqv-1.3.0+ds' + make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests +make[2]: ingresso nella directory «/build/ataqv-1.3.0+ds» g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/ataqv.o -c /build/ataqv-1.3.0+ds/src/cpp/ataqv.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Features.o -c /build/ataqv-1.3.0+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/HTS.o -c /build/ataqv-1.3.0+ds/src/cpp/HTS.cpp +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/IO.o -c /build/ataqv-1.3.0+ds/src/cpp/IO.cpp In file included from /usr/include/c++/12/map:60, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:10, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, @@ -955,7 +999,6 @@ | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/IO.o -c /build/ataqv-1.3.0+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Metrics.o -c /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Peaks.o -c /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp In file included from /usr/include/c++/12/bits/stl_algo.h:60, @@ -1007,7 +1050,6 @@ | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Utils.o -c /build/ataqv-1.3.0+ds/src/cpp/Utils.cpp /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__unguarded_linear_insert(_RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Val_comp_iter]’: /usr/include/c++/12/bits/stl_algo.h:1782:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1782 | __unguarded_linear_insert(_RandomAccessIterator __last, @@ -1089,6 +1131,7 @@ /usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, | ^~~~~~~~~~~~~ +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Utils.o -c /build/ataqv-1.3.0+ds/src/cpp/Utils.cpp /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__make_heap(_RandomAccessIterator, _RandomAccessIterator, _Compare&) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_heap.h:340:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 340 | __make_heap(_RandomAccessIterator __first, _RandomAccessIterator __last, @@ -1108,6 +1151,7 @@ /usr/include/c++/12/bits/stl_algo.h:1629:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1629 | std::__make_heap(__first, __middle, __comp); | ~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /build/ataqv-1.3.0+ds/src/cpp/run_ataqv_tests.cpp In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks_by_size_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:221:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 @@ -1133,7 +1177,6 @@ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /build/ataqv-1.3.0+ds/src/cpp/run_ataqv_tests.cpp In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks_by_overlapping_hqaa_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:209:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 @@ -1160,11 +1203,58 @@ 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_features.o -c /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_hts.o -c /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp In file included from /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:1: /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ +In file included from /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp:3: +/build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: +/build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] + 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); + | ^~~~~~~~~~~~ +In file included from /usr/include/c++/12/bits/stl_algo.h:60, + from /usr/include/c++/12/algorithm:61, + from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:76: +/usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Feature; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: +/usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, + | ^~~~~~~~~~~~~ +/usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: +/usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1802 | __insertion_sort(_RandomAccessIterator __first, + | ^~~~~~~~~~~~~~~~ +/usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_io.o -c /build/ataqv-1.3.0+ds/src/cpp/test_io.cpp +/usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: +/usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1908 | __introsort_loop(_RandomAccessIterator __first, + | ^~~~~~~~~~~~~~~~ +/usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +/usr/include/c++/12/bits/stl_algo.h:1922:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1922 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, + inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, + inlined from ‘void ____C_A_T_C_H____T_E_S_T____61()’ at /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:67:14: +/usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1937 | std::__introsort_loop(__first, __last, + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ + 1938 | std::__lg(__last - __first) * 2, + | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + 1939 | __comp); + | ~~~~~~~ +In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, + inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, + inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, + inlined from ‘void ____C_A_T_C_H____T_E_S_T____61()’ at /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:67:14: +/usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +/usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1854 | std::__insertion_sort(__first, __last, __comp); + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19, @@ -1199,13 +1289,6 @@ /usr/include/c++/12/bits/stl_tree.h:2209:5: note: parameter passing for argument of type ‘std::_Rb_tree, std::_Select1st >, std::less, std::allocator > >::const_iterator’ changed in GCC 7.1 2209 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -In file included from /usr/include/c++/12/bits/stl_algo.h:60, - from /usr/include/c++/12/algorithm:61, - from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:76: -/usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Feature; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: -/usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, - | ^~~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>&}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector, std::allocator > >::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: @@ -1215,50 +1298,56 @@ /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ -/usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: -/usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1802 | __insertion_sort(_RandomAccessIterator __first, - | ^~~~~~~~~~~~~~~~ -/usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = long long unsigned int; _Alloc = std::allocator]’, inlined from ‘void Metrics::add_alignment(const bam_hdr_t*, const bam1_t*)’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:893:59: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ -/usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: -/usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1908 | __introsort_loop(_RandomAccessIterator __first, +In file included from /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:1: +/build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: +/build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] + 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); + | ^~~~~~~~~~~~ +In file included from /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:3: +/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’: +/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 173 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ +/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 178 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ +/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’: +/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 249 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ +/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’: +/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 259 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ +In file included from /usr/include/c++/12/memory:66, + from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:568: +/usr/include/c++/12/bits/stl_uninitialized.h: In function ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’: +/usr/include/c++/12/bits/stl_uninitialized.h:113:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 113 | __do_uninit_copy(_InputIterator __first, _InputIterator __last, | ^~~~~~~~~~~~~~~~ -/usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 -/usr/include/c++/12/bits/stl_algo.h:1922:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1922 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, - inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, - inlined from ‘void ____C_A_T_C_H____T_E_S_T____61()’ at /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:67:14: -/usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1937 | std::__introsort_loop(__first, __last, - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ - 1938 | std::__lg(__last - __first) * 2, - | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - 1939 | __comp); - | ~~~~~~~ -In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, - inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, - inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, - inlined from ‘void ____C_A_T_C_H____T_E_S_T____61()’ at /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:67:14: -/usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -/usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1854 | std::__insertion_sort(__first, __last, __comp); - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ +/usr/include/c++/12/bits/stl_uninitialized.h:113:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 In file included from /build/ataqv-1.3.0+ds/src/cpp/Metrics.hpp:16, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:21: /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In function ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 2082 | basic_json(std::initializer_list init, | ^~~~~~~~~~ +In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, + inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, + inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, + inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, + inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, + inlined from ‘void ____C_A_T_C_H____T_E_S_T____155()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:166:68: +/usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 137 | { return std::__do_uninit_copy(__first, __last, __result); } + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In function ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp: In member function ‘nlohmann::json Library::to_json()’: @@ -1289,6 +1378,24 @@ /usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, + inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, + inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, + inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, + inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, + inlined from ‘void ____C_A_T_C_H____T_E_S_T____100()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:125:68: +/usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 137 | { return std::__do_uninit_copy(__first, __last, __result); } + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ +In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, + inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, + inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, + inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, + inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, + inlined from ‘void ____C_A_T_C_H____T_E_S_T____100()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:131:70: +/usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 137 | { return std::__do_uninit_copy(__first, __last, __result); } + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/stl_pair.h:61, from /usr/include/c++/12/tuple:38, from /usr/include/c++/12/mutex:38, @@ -1304,7 +1411,25 @@ /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_hts.o -c /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp +In file included from /usr/include/c++/12/vector:70, + from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:569, + from /build/ataqv-1.3.0+ds/src/cpp/run_ataqv_tests.cpp:2: +/usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Catch::SectionEndInfo&}; _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’: +/usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 + 439 | vector<_Tp, _Alloc>:: + | ^~~~~~~~~~~~~~~~~~~ +In file included from /usr/include/c++/12/vector:64: +In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’, + inlined from ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:6057:43: +/usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1287 | _M_realloc_insert(end(), __x); + | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ +In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’, + inlined from ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:6057:43, + inlined from ‘Catch::Section::~Section()’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:7923:53: +/usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1287 | _M_realloc_insert(end(), __x); + | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, @@ -1570,95 +1695,6 @@ /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1566:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1566 | }; | ^ -In file included from /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp:3: -/build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: -/build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] - 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); - | ^~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_io.o -c /build/ataqv-1.3.0+ds/src/cpp/test_io.cpp -In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, - inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, - inlined from ‘void nlohmann::basic_json::push_back(nlohmann::basic_json&&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5275:33, - inlined from ‘nlohmann::json MetricsCollector::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1586:25: -/usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 - 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); - | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -In file included from /usr/include/c++/12/vector:70, - from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:569, - from /build/ataqv-1.3.0+ds/src/cpp/run_ataqv_tests.cpp:2: -/usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Catch::SectionEndInfo&}; _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’: -/usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 - 439 | vector<_Tp, _Alloc>:: - | ^~~~~~~~~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp -In file included from /usr/include/c++/12/vector:64: -In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’, - inlined from ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:6057:43: -/usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1287 | _M_realloc_insert(end(), __x); - | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ -In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’, - inlined from ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:6057:43, - inlined from ‘Catch::Section::~Section()’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:7923:53: -/usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1287 | _M_realloc_insert(end(), __x); - | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp -In file included from /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:1: -/build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: -/build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] - 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); - | ^~~~~~~~~~~~ -In file included from /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:3: -/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’: -/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 173 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 178 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’: -/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 249 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’: -/build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 259 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -In file included from /usr/include/c++/12/memory:66, - from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:568: -/usr/include/c++/12/bits/stl_uninitialized.h: In function ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’: -/usr/include/c++/12/bits/stl_uninitialized.h:113:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 113 | __do_uninit_copy(_InputIterator __first, _InputIterator __last, - | ^~~~~~~~~~~~~~~~ -/usr/include/c++/12/bits/stl_uninitialized.h:113:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 -In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, - inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, - inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, - inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, - inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, - inlined from ‘void ____C_A_T_C_H____T_E_S_T____155()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:166:68: -/usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 137 | { return std::__do_uninit_copy(__first, __last, __result); } - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ -In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, - inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, - inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, - inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, - inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, - inlined from ‘void ____C_A_T_C_H____T_E_S_T____100()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:125:68: -/usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 137 | { return std::__do_uninit_copy(__first, __last, __result); } - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ -In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, - inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, - inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, - inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, - inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, - inlined from ‘void ____C_A_T_C_H____T_E_S_T____100()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:131:70: -/usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 137 | { return std::__do_uninit_copy(__first, __last, __result); } - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:569: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_fill_insert(iterator, size_type, const value_type&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’: @@ -1672,9 +1708,15 @@ 1435 | _M_fill_insert(begin() + __offset, __n, __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_utils.o -c /build/ataqv-1.3.0+ds/src/cpp/test_utils.cpp +In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, + inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, + inlined from ‘void nlohmann::basic_json::push_back(nlohmann::basic_json&&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5275:33, + inlined from ‘nlohmann::json MetricsCollector::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1586:25: +/usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 + 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); + | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Features.o -c /build/ataqv-1.3.0+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/HTS.o -c /build/ataqv-1.3.0+ds/src/cpp/HTS.cpp -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/IO.o -c /build/ataqv-1.3.0+ds/src/cpp/IO.cpp In file included from /usr/include/c++/12/map:60, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:10, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, @@ -1710,6 +1752,7 @@ /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/IO.o -c /build/ataqv-1.3.0+ds/src/cpp/IO.cpp In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Feature; _Alloc = std::allocator]’, inlined from ‘void ReferenceFeatureCollection::add(const Feature&)’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:101:23: @@ -1727,6 +1770,7 @@ | ~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Metrics.o -c /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Peaks.o -c /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Utils.o -c /build/ataqv-1.3.0+ds/src/cpp/Utils.cpp In file included from /usr/include/c++/12/bits/stl_algo.h:60, from /usr/include/c++/12/algorithm:61, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:7: @@ -1766,6 +1810,7 @@ /usr/include/c++/12/bits/stl_tree.h:2457:7: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferencePeakCollection>, std::_Select1st, ReferencePeakCollection> >, numeric_string_comparator, std::allocator, ReferencePeakCollection> > >::const_iterator’ changed in GCC 7.1 2457 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread In file included from /usr/include/c++/12/map:61: In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferencePeakCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferencePeakCollection> >]’, inlined from ‘ReferencePeakCollection* PeakTree::get_reference_peaks(const std::string&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:121:32: @@ -1926,8 +1971,6 @@ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Utils.o -c /build/ataqv-1.3.0+ds/src/cpp/Utils.cpp -g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19, @@ -2300,11 +2343,11 @@ 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread -make[2]: Leaving directory '/build/ataqv-1.3.0+ds' -make[1]: Leaving directory '/build/ataqv-1.3.0+ds' +make[2]: uscita dalla directory «/build/ataqv-1.3.0+ds» +make[1]: uscita dalla directory «/build/ataqv-1.3.0+ds» dh_auto_test - make -j3 test -make[1]: Entering directory '/build/ataqv-1.3.0+ds' + make -j4 test +make[1]: ingresso nella directory «/build/ataqv-1.3.0+ds» [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 Reading human autosomal references from autosomal_references.gz. Autosomal references for human: @@ -2360,7 +2403,7 @@ chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 -Loaded 24989 TSS in 4.47616 seconds. (5582.69 TSS/second). +Loaded 24989 TSS in 22.0568 seconds. (1132.94 TSS/second). Collecting metrics from test.bam. @@ -2543,7 +2586,7 @@ chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 -Loaded 37276 peaks in 39.8159 seconds. (936.21 peaks/second). +Loaded 37276 peaks in 178.633 seconds. (208.673 peaks/second). Logging problematic reads to SRR891278.problems. @@ -2724,7 +2767,7 @@ chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 -Loaded 37276 peaks in 39.0519 seconds. (954.525 peaks/second). +Loaded 37276 peaks in 247.728 seconds. (150.471 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] @@ -2762,12 +2805,12 @@ Added TSS coverage for chr2; thread count=1 Added TSS coverage for chr1; thread count=1 All TSS jobs started. Waiting for last ones to complete. -Calculated TSS coverage in 0.347571 seconds. +Calculated TSS coverage in 1.95777 seconds. Calculating TSS metrics... -Calculated TSS metrics in 0.000880559 seconds. +Calculated TSS metrics in 0.00163243 seconds. Calculating TSS metrics... -Calculated TSS metrics in 0.000822464 seconds. -Analyzed 1040 reads in 0.510857 seconds (2035.8 reads/second). +Calculated TSS metrics in 0.0252741 seconds. +Analyzed 1040 reads in 5.31655 seconds (195.616 reads/second). ataqv 1.3.0 @@ -3177,7 +3220,7 @@ chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 -Loaded 37276 peaks in 37.349 seconds. (998.041 peaks/second). +Loaded 37276 peaks in 271.601 seconds. (137.245 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] @@ -3186,7 +3229,7 @@ New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH debian/ataqv.1 help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1 help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.3.0+ds src/scripts/srvarv > debian/srvarv.1 dh_installman -make[1]: Leaving directory '/build/ataqv-1.3.0+ds' +make[1]: uscita dalla directory «/build/ataqv-1.3.0+ds» dh_perl dh_link dh_strip_nondeterminism @@ -3370,8 +3413,8 @@ dh_gencontrol dh_md5sums dh_builddeb -dpkg-deb: building package 'ataqv-dbgsym' in '../ataqv-dbgsym_1.3.0+ds-2_armhf.deb'. -dpkg-deb: building package 'ataqv' in '../ataqv_1.3.0+ds-2_armhf.deb'. +dpkg-deb: generazione del pacchetto "ataqv" in "../ataqv_1.3.0+ds-2_armhf.deb". +dpkg-deb: generazione del pacchetto "ataqv-dbgsym" in "../ataqv-dbgsym_1.3.0+ds-2_armhf.deb". dpkg-genbuildinfo --build=binary -O../ataqv_1.3.0+ds-2_armhf.buildinfo dpkg-genchanges --build=binary -O../ataqv_1.3.0+ds-2_armhf.changes dpkg-genchanges: info: binary-only upload (no source code included) @@ -3379,12 +3422,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/27457/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/32670 and its subdirectories -I: Current time: Sun May 21 14:58:06 -12 2023 -I: pbuilder-time-stamp: 1684724286 +I: removing directory /srv/workspace/pbuilder/27457 and its subdirectories +I: Current time: Mon May 22 17:38:37 +14 2023 +I: pbuilder-time-stamp: 1684726717