Diff of the two buildlogs:

--
--- b1/build.log	2023-01-05 21:02:21.908203994 +0000
+++ b2/build.log	2023-01-05 22:43:12.418678344 +0000
@@ -1,6 +1,6 @@
 I: pbuilder: network access will be disabled during build
-I: Current time: Thu Jan  5 08:51:35 -12 2023
-I: pbuilder-time-stamp: 1672951895
+I: Current time: Thu Feb  8 17:25:25 +14 2024
+I: pbuilder-time-stamp: 1707362725
 I: Building the build Environment
 I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz]
 I: copying local configuration
@@ -17,8 +17,8 @@
 I: copying [./bowtie_1.3.0+dfsg1-1.debian.tar.xz]
 I: Extracting source
 gpgv: unknown type of key resource 'trustedkeys.kbx'
-gpgv: keyblock resource '/tmp/dpkg-verify-sig.RZW0Mtfs/trustedkeys.kbx': General error
-gpgv: Signature made Tue Oct 13 00:02:00 2020 -12
+gpgv: keyblock resource '/tmp/dpkg-verify-sig.Lh9Th27N/trustedkeys.kbx': General error
+gpgv: Signature made Wed Oct 14 02:02:00 2020 +14
 gpgv:                using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
 gpgv:                issuer "tille@debian.org"
 gpgv: Can't check signature: No public key
@@ -37,135 +37,170 @@
 dpkg-source: info: applying popcnt_capability.patch
 I: Not using root during the build.
 I: Installing the build-deps
-I: user script /srv/workspace/pbuilder/1934300/tmp/hooks/D02_print_environment starting
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/D01_modify_environment starting
+debug: Running on ionos15-amd64.
+I: Changing host+domainname to test build reproducibility
+I: Adding a custom variable just for the fun of it...
+I: Changing /bin/sh to bash
+Removing 'diversion of /bin/sh to /bin/sh.distrib by dash'
+Adding 'diversion of /bin/sh to /bin/sh.distrib by bash'
+Removing 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by dash'
+Adding 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by bash'
+lrwxrwxrwx 1 root root 4 Feb  8 17:25 /bin/sh -> bash
+I: Setting pbuilder2's login shell to /bin/bash
+I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/D01_modify_environment finished
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/D02_print_environment starting
 I: set
-  BUILDDIR='/build'
-  BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other'
-  BUILDUSERNAME='pbuilder1'
-  BUILD_ARCH='amd64'
-  DEBIAN_FRONTEND='noninteractive'
-  DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=15'
-  DISTRIBUTION='bullseye'
-  HOME='/root'
-  HOST_ARCH='amd64'
+  BASH=/bin/sh
+  BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:hostcomplete:interactive_comments:progcomp:promptvars:sourcepath
+  BASH_ALIASES=()
+  BASH_ARGC=()
+  BASH_ARGV=()
+  BASH_CMDS=()
+  BASH_LINENO=([0]="12" [1]="0")
+  BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment")
+  BASH_VERSINFO=([0]="5" [1]="1" [2]="4" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu")
+  BASH_VERSION='5.1.4(1)-release'
+  BUILDDIR=/build
+  BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other'
+  BUILDUSERNAME=pbuilder2
+  BUILD_ARCH=amd64
+  DEBIAN_FRONTEND=noninteractive
+  DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=16'
+  DIRSTACK=()
+  DISTRIBUTION=bullseye
+  EUID=0
+  FUNCNAME=([0]="Echo" [1]="main")
+  GROUPS=()
+  HOME=/root
+  HOSTNAME=i-capture-the-hostname
+  HOSTTYPE=x86_64
+  HOST_ARCH=amd64
   IFS=' 	
   '
-  INVOCATION_ID='8fc03ebcd3eb4c7b98e7bb1e77d444fe'
-  LANG='C'
-  LANGUAGE='en_US:en'
-  LC_ALL='C'
-  MAIL='/var/mail/root'
-  OPTIND='1'
-  PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games'
-  PBCURRENTCOMMANDLINEOPERATION='build'
-  PBUILDER_OPERATION='build'
-  PBUILDER_PKGDATADIR='/usr/share/pbuilder'
-  PBUILDER_PKGLIBDIR='/usr/lib/pbuilder'
-  PBUILDER_SYSCONFDIR='/etc'
-  PPID='1934300'
-  PS1='# '
-  PS2='> '
+  INVOCATION_ID=3c2aea6c7c644457bc8a5d1fe7576de0
+  LANG=C
+  LANGUAGE=et_EE:et
+  LC_ALL=C
+  MACHTYPE=x86_64-pc-linux-gnu
+  MAIL=/var/mail/root
+  OPTERR=1
+  OPTIND=1
+  OSTYPE=linux-gnu
+  PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path
+  PBCURRENTCOMMANDLINEOPERATION=build
+  PBUILDER_OPERATION=build
+  PBUILDER_PKGDATADIR=/usr/share/pbuilder
+  PBUILDER_PKGLIBDIR=/usr/lib/pbuilder
+  PBUILDER_SYSCONFDIR=/etc
+  PIPESTATUS=([0]="0")
+  POSIXLY_CORRECT=y
+  PPID=597387
   PS4='+ '
-  PWD='/'
-  SHELL='/bin/bash'
-  SHLVL='2'
-  SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.r6Vyn1aU/pbuilderrc_lu0K --distribution bullseye --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.r6Vyn1aU/b1 --logfile b1/build.log bowtie_1.3.0+dfsg1-1.dsc'
-  SUDO_GID='111'
-  SUDO_UID='106'
-  SUDO_USER='jenkins'
-  TERM='unknown'
-  TZ='/usr/share/zoneinfo/Etc/GMT+12'
-  USER='root'
-  _='/usr/bin/systemd-run'
-  http_proxy='http://78.137.99.97:3128'
+  PWD=/
+  SHELL=/bin/bash
+  SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix
+  SHLVL=3
+  SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.r6Vyn1aU/pbuilderrc_DM8V --distribution bullseye --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.r6Vyn1aU/b2 --logfile b2/build.log bowtie_1.3.0+dfsg1-1.dsc'
+  SUDO_GID=111
+  SUDO_UID=106
+  SUDO_USER=jenkins
+  TERM=unknown
+  TZ=/usr/share/zoneinfo/Etc/GMT-14
+  UID=0
+  USER=root
+  _='I: set'
+  http_proxy=http://85.184.249.68:3128
 I: uname -a
-  Linux ionos11-amd64 5.10.0-20-amd64 #1 SMP Debian 5.10.158-2 (2022-12-13) x86_64 GNU/Linux
+  Linux i-capture-the-hostname 6.0.0-0.deb11.6-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.0.12-1~bpo11+1 (2022-12-19) x86_64 GNU/Linux
 I: ls -l /bin
   total 5476
-  -rwxr-xr-x 1 root root 1234376 Mar 27  2022 bash
-  -rwxr-xr-x 3 root root   38984 Jul 20  2020 bunzip2
-  -rwxr-xr-x 3 root root   38984 Jul 20  2020 bzcat
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzcmp -> bzdiff
-  -rwxr-xr-x 1 root root    2225 Jul 20  2020 bzdiff
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzegrep -> bzgrep
-  -rwxr-xr-x 1 root root    4877 Sep  4  2019 bzexe
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzfgrep -> bzgrep
-  -rwxr-xr-x 1 root root    3775 Jul 20  2020 bzgrep
-  -rwxr-xr-x 3 root root   38984 Jul 20  2020 bzip2
-  -rwxr-xr-x 1 root root   18424 Jul 20  2020 bzip2recover
-  lrwxrwxrwx 1 root root       6 Jul 20  2020 bzless -> bzmore
-  -rwxr-xr-x 1 root root    1297 Jul 20  2020 bzmore
-  -rwxr-xr-x 1 root root   43936 Sep 23  2020 cat
-  -rwxr-xr-x 1 root root   72672 Sep 23  2020 chgrp
-  -rwxr-xr-x 1 root root   64448 Sep 23  2020 chmod
-  -rwxr-xr-x 1 root root   72672 Sep 23  2020 chown
-  -rwxr-xr-x 1 root root  151168 Sep 23  2020 cp
-  -rwxr-xr-x 1 root root  125560 Dec 10  2020 dash
-  -rwxr-xr-x 1 root root  113664 Sep 23  2020 date
-  -rwxr-xr-x 1 root root   80968 Sep 23  2020 dd
-  -rwxr-xr-x 1 root root   93936 Sep 23  2020 df
-  -rwxr-xr-x 1 root root  147176 Sep 23  2020 dir
-  -rwxr-xr-x 1 root root   84440 Jan 20  2022 dmesg
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 dnsdomainname -> hostname
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 domainname -> hostname
-  -rwxr-xr-x 1 root root   39712 Sep 23  2020 echo
-  -rwxr-xr-x 1 root root      28 Nov  9  2020 egrep
-  -rwxr-xr-x 1 root root   39680 Sep 23  2020 false
-  -rwxr-xr-x 1 root root      28 Nov  9  2020 fgrep
-  -rwxr-xr-x 1 root root   69032 Jan 20  2022 findmnt
-  -rwsr-xr-x 1 root root   34896 Feb 26  2021 fusermount
-  -rwxr-xr-x 1 root root  203072 Nov  9  2020 grep
-  -rwxr-xr-x 2 root root    2346 Apr  9  2022 gunzip
-  -rwxr-xr-x 1 root root    6447 Apr  9  2022 gzexe
-  -rwxr-xr-x 1 root root   98048 Apr  9  2022 gzip
-  -rwxr-xr-x 1 root root   22600 Nov  6  2019 hostname
-  -rwxr-xr-x 1 root root   72840 Sep 23  2020 ln
-  -rwxr-xr-x 1 root root   56952 Feb  7  2020 login
-  -rwxr-xr-x 1 root root  147176 Sep 23  2020 ls
-  -rwxr-xr-x 1 root root  149736 Jan 20  2022 lsblk
-  -rwxr-xr-x 1 root root   85184 Sep 23  2020 mkdir
-  -rwxr-xr-x 1 root root   76896 Sep 23  2020 mknod
-  -rwxr-xr-x 1 root root   48064 Sep 23  2020 mktemp
-  -rwxr-xr-x 1 root root   59632 Jan 20  2022 more
-  -rwsr-xr-x 1 root root   55528 Jan 20  2022 mount
-  -rwxr-xr-x 1 root root   18664 Jan 20  2022 mountpoint
-  -rwxr-xr-x 1 root root  147080 Sep 23  2020 mv
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 nisdomainname -> hostname
-  lrwxrwxrwx 1 root root      14 Dec 16  2021 pidof -> /sbin/killall5
-  -rwxr-xr-x 1 root root   43872 Sep 23  2020 pwd
-  lrwxrwxrwx 1 root root       4 Mar 27  2022 rbash -> bash
-  -rwxr-xr-x 1 root root   52032 Sep 23  2020 readlink
-  -rwxr-xr-x 1 root root   72704 Sep 23  2020 rm
-  -rwxr-xr-x 1 root root   52032 Sep 23  2020 rmdir
-  -rwxr-xr-x 1 root root   27472 Sep 27  2020 run-parts
-  -rwxr-xr-x 1 root root  122224 Dec 22  2018 sed
-  lrwxrwxrwx 1 root root       4 Dec 20 21:25 sh -> dash
-  -rwxr-xr-x 1 root root   43808 Sep 23  2020 sleep
-  -rwxr-xr-x 1 root root   84928 Sep 23  2020 stty
-  -rwsr-xr-x 1 root root   71912 Jan 20  2022 su
-  -rwxr-xr-x 1 root root   39744 Sep 23  2020 sync
-  -rwxr-xr-x 1 root root  531928 Feb 16  2021 tar
-  -rwxr-xr-x 1 root root   14456 Sep 27  2020 tempfile
-  -rwxr-xr-x 1 root root  101408 Sep 23  2020 touch
-  -rwxr-xr-x 1 root root   39680 Sep 23  2020 true
-  -rwxr-xr-x 1 root root   14328 Feb 26  2021 ulockmgr_server
-  -rwsr-xr-x 1 root root   35040 Jan 20  2022 umount
-  -rwxr-xr-x 1 root root   39744 Sep 23  2020 uname
-  -rwxr-xr-x 2 root root    2346 Apr  9  2022 uncompress
-  -rwxr-xr-x 1 root root  147176 Sep 23  2020 vdir
-  -rwxr-xr-x 1 root root   63744 Jan 20  2022 wdctl
-  lrwxrwxrwx 1 root root       8 Nov  6  2019 ypdomainname -> hostname
-  -rwxr-xr-x 1 root root    1984 Apr  9  2022 zcat
-  -rwxr-xr-x 1 root root    1678 Apr  9  2022 zcmp
-  -rwxr-xr-x 1 root root    5898 Apr  9  2022 zdiff
-  -rwxr-xr-x 1 root root      29 Apr  9  2022 zegrep
-  -rwxr-xr-x 1 root root      29 Apr  9  2022 zfgrep
-  -rwxr-xr-x 1 root root    2081 Apr  9  2022 zforce
-  -rwxr-xr-x 1 root root    8049 Apr  9  2022 zgrep
-  -rwxr-xr-x 1 root root    2206 Apr  9  2022 zless
-  -rwxr-xr-x 1 root root    1842 Apr  9  2022 zmore
-  -rwxr-xr-x 1 root root    4577 Apr  9  2022 znew
-I: user script /srv/workspace/pbuilder/1934300/tmp/hooks/D02_print_environment finished
+  -rwxr-xr-x 1 root root 1234376 Mar 28  2022 bash
+  -rwxr-xr-x 3 root root   38984 Jul 21  2020 bunzip2
+  -rwxr-xr-x 3 root root   38984 Jul 21  2020 bzcat
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzcmp -> bzdiff
+  -rwxr-xr-x 1 root root    2225 Jul 21  2020 bzdiff
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzegrep -> bzgrep
+  -rwxr-xr-x 1 root root    4877 Sep  5  2019 bzexe
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzfgrep -> bzgrep
+  -rwxr-xr-x 1 root root    3775 Jul 21  2020 bzgrep
+  -rwxr-xr-x 3 root root   38984 Jul 21  2020 bzip2
+  -rwxr-xr-x 1 root root   18424 Jul 21  2020 bzip2recover
+  lrwxrwxrwx 1 root root       6 Jul 21  2020 bzless -> bzmore
+  -rwxr-xr-x 1 root root    1297 Jul 21  2020 bzmore
+  -rwxr-xr-x 1 root root   43936 Sep 24  2020 cat
+  -rwxr-xr-x 1 root root   72672 Sep 24  2020 chgrp
+  -rwxr-xr-x 1 root root   64448 Sep 24  2020 chmod
+  -rwxr-xr-x 1 root root   72672 Sep 24  2020 chown
+  -rwxr-xr-x 1 root root  151168 Sep 24  2020 cp
+  -rwxr-xr-x 1 root root  125560 Dec 11  2020 dash
+  -rwxr-xr-x 1 root root  113664 Sep 24  2020 date
+  -rwxr-xr-x 1 root root   80968 Sep 24  2020 dd
+  -rwxr-xr-x 1 root root   93936 Sep 24  2020 df
+  -rwxr-xr-x 1 root root  147176 Sep 24  2020 dir
+  -rwxr-xr-x 1 root root   84440 Jan 21  2022 dmesg
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 dnsdomainname -> hostname
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 domainname -> hostname
+  -rwxr-xr-x 1 root root   39712 Sep 24  2020 echo
+  -rwxr-xr-x 1 root root      28 Nov 10  2020 egrep
+  -rwxr-xr-x 1 root root   39680 Sep 24  2020 false
+  -rwxr-xr-x 1 root root      28 Nov 10  2020 fgrep
+  -rwxr-xr-x 1 root root   69032 Jan 21  2022 findmnt
+  -rwsr-xr-x 1 root root   34896 Feb 27  2021 fusermount
+  -rwxr-xr-x 1 root root  203072 Nov 10  2020 grep
+  -rwxr-xr-x 2 root root    2346 Apr 10  2022 gunzip
+  -rwxr-xr-x 1 root root    6447 Apr 10  2022 gzexe
+  -rwxr-xr-x 1 root root   98048 Apr 10  2022 gzip
+  -rwxr-xr-x 1 root root   22600 Nov  8  2019 hostname
+  -rwxr-xr-x 1 root root   72840 Sep 24  2020 ln
+  -rwxr-xr-x 1 root root   56952 Feb  8  2020 login
+  -rwxr-xr-x 1 root root  147176 Sep 24  2020 ls
+  -rwxr-xr-x 1 root root  149736 Jan 21  2022 lsblk
+  -rwxr-xr-x 1 root root   85184 Sep 24  2020 mkdir
+  -rwxr-xr-x 1 root root   76896 Sep 24  2020 mknod
+  -rwxr-xr-x 1 root root   48064 Sep 24  2020 mktemp
+  -rwxr-xr-x 1 root root   59632 Jan 21  2022 more
+  -rwsr-xr-x 1 root root   55528 Jan 21  2022 mount
+  -rwxr-xr-x 1 root root   18664 Jan 21  2022 mountpoint
+  -rwxr-xr-x 1 root root  147080 Sep 24  2020 mv
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 nisdomainname -> hostname
+  lrwxrwxrwx 1 root root      14 Dec 17  2021 pidof -> /sbin/killall5
+  -rwxr-xr-x 1 root root   43872 Sep 24  2020 pwd
+  lrwxrwxrwx 1 root root       4 Mar 28  2022 rbash -> bash
+  -rwxr-xr-x 1 root root   52032 Sep 24  2020 readlink
+  -rwxr-xr-x 1 root root   72704 Sep 24  2020 rm
+  -rwxr-xr-x 1 root root   52032 Sep 24  2020 rmdir
+  -rwxr-xr-x 1 root root   27472 Sep 28  2020 run-parts
+  -rwxr-xr-x 1 root root  122224 Dec 23  2018 sed
+  lrwxrwxrwx 1 root root       4 Feb  8 17:25 sh -> bash
+  lrwxrwxrwx 1 root root       4 Jan 24 05:47 sh.distrib -> dash
+  -rwxr-xr-x 1 root root   43808 Sep 24  2020 sleep
+  -rwxr-xr-x 1 root root   84928 Sep 24  2020 stty
+  -rwsr-xr-x 1 root root   71912 Jan 21  2022 su
+  -rwxr-xr-x 1 root root   39744 Sep 24  2020 sync
+  -rwxr-xr-x 1 root root  531928 Feb 17  2021 tar
+  -rwxr-xr-x 1 root root   14456 Sep 28  2020 tempfile
+  -rwxr-xr-x 1 root root  101408 Sep 24  2020 touch
+  -rwxr-xr-x 1 root root   39680 Sep 24  2020 true
+  -rwxr-xr-x 1 root root   14328 Feb 27  2021 ulockmgr_server
+  -rwsr-xr-x 1 root root   35040 Jan 21  2022 umount
+  -rwxr-xr-x 1 root root   39744 Sep 24  2020 uname
+  -rwxr-xr-x 2 root root    2346 Apr 10  2022 uncompress
+  -rwxr-xr-x 1 root root  147176 Sep 24  2020 vdir
+  -rwxr-xr-x 1 root root   63744 Jan 21  2022 wdctl
+  lrwxrwxrwx 1 root root       8 Nov  8  2019 ypdomainname -> hostname
+  -rwxr-xr-x 1 root root    1984 Apr 10  2022 zcat
+  -rwxr-xr-x 1 root root    1678 Apr 10  2022 zcmp
+  -rwxr-xr-x 1 root root    5898 Apr 10  2022 zdiff
+  -rwxr-xr-x 1 root root      29 Apr 10  2022 zegrep
+  -rwxr-xr-x 1 root root      29 Apr 10  2022 zfgrep
+  -rwxr-xr-x 1 root root    2081 Apr 10  2022 zforce
+  -rwxr-xr-x 1 root root    8049 Apr 10  2022 zgrep
+  -rwxr-xr-x 1 root root    2206 Apr 10  2022 zless
+  -rwxr-xr-x 1 root root    1842 Apr 10  2022 zmore
+  -rwxr-xr-x 1 root root    4577 Apr 10  2022 znew
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/D02_print_environment finished
  -> Attempting to satisfy build-dependencies
  -> Creating pbuilder-satisfydepends-dummy package
 Package: pbuilder-satisfydepends-dummy
@@ -270,7 +305,7 @@
 Get: 53 http://deb.debian.org/debian bullseye/main amd64 libtbb-dev amd64 2020.3-1 [313 kB]
 Get: 54 http://deb.debian.org/debian bullseye/main amd64 libtest-deep-perl all 1.130-1 [49.3 kB]
 Get: 55 http://deb.debian.org/debian bullseye/main amd64 zlib1g-dev amd64 1:1.2.11.dfsg-2+deb11u2 [191 kB]
-Fetched 24.9 MB in 12s (2143 kB/s)
+Fetched 24.9 MB in 54s (458 kB/s)
 debconf: delaying package configuration, since apt-utils is not installed
 Selecting previously unselected package bsdextrautils.
 (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 19704 files and directories currently installed.)
@@ -508,7 +543,11 @@
 Building tag database...
  -> Finished parsing the build-deps
 I: Building the package
-I: Running cd /build/bowtie-1.3.0+dfsg1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S  > ../bowtie_1.3.0+dfsg1-1_source.changes
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/A99_set_merged_usr starting
+Not re-configuring usrmerge for bullseye
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/A99_set_merged_usr finished
+hostname: Name or service not known
+I: Running cd /build/bowtie-1.3.0+dfsg1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S  > ../bowtie_1.3.0+dfsg1-1_source.changes
 dpkg-buildpackage: info: source package bowtie
 dpkg-buildpackage: info: source version 1.3.0+dfsg1-1
 dpkg-buildpackage: info: source distribution unstable
@@ -521,7 +560,7 @@
 make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1'
 rm -f .bowtie*
 dh_auto_clean
-	make -j15 clean
+	make -j16 clean
 make[2]: Entering directory '/build/bowtie-1.3.0+dfsg1'
 rm -f bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-build-s-debug bowtie-build-l-debug bowtie-align-s-debug bowtie-align-l-debug bowtie-inspect-s-debug bowtie-inspect-l-debug \
 bowtie_prof \
@@ -635,14 +674,14 @@
 ./bowtie    -F 10,9 -S --quiet -a .simple_tests.tmp  .simple_tests
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
-# reads with at least one alignment: 2 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 2 alignments
-@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
 seq1_0	0	0	1	255	10M	*	0	0	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 seq1_9	0	0	10	255	10M	*	0	0	CAGTATCTGA	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
+100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 2 alignments
 FASTA-continuous 2 (fw:1, sam:1)
 References:
 >0
@@ -769,14 +808,14 @@
 
 
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII"
-0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 # reads processed: 1
 # reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
+@HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII"
+0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Cline multiread 3 (fw:1, sam:1)
 References:
 >0
@@ -830,15 +869,15 @@
 AGCATCGATCAAAAACTGA
 ./bowtie    -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
-0.00%)
-# reads that failed to align: 1 (100.00%)
-No alignments
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII"
 0	77	*	0	0	*	*	0	0			XM:i:0
 0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
+# reads processed: 1
+# reads with at least one alignment: 0 (0.00%)
+# reads that failed to align: 1 (100.00%)
+No alignments
 Fastq 7 (fw:1, sam:1)
 References:
 >0
@@ -887,14 +926,14 @@
 AGCATCGATCAGTATCTGA
 ./bowtie    -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
-r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 # reads processed: 1
 # reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
+@HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
+r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 Fastq multiread 3 (fw:1, sam:1)
 References:
 >0
@@ -932,15 +971,15 @@
 AGCATCGATCAAAAACTGA
 ./bowtie    -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Fastq paired 4 (fw:1, sam:1)
 References:
 >0
@@ -964,10 +1003,10 @@
 ./bowtie    --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (100.00@HD	VN:1.0	SO:unsorted
+%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 r0	0	0	3	255	12M	*	0	0	CATCGATCAGTA	IIIIIIIIIIII	XA:i:0	MD:Z:12	NM:i:0	XM:i:2
@@ -978,10 +1017,10 @@
 ./bowtie    --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
+# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+0.00%)
 # reads that failed to align: 1 (100.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 r0	4	*	0	0	*	*	0	0			XM:i:0
@@ -1136,10 +1175,10 @@
 ./bowtie    -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
-# reads with at least one alignment: 2 (100.00%)
+# reads with at least one alignment: 2 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 2 alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
@@ -1151,15 +1190,15 @@
 ./bowtie-build  --quiet  .simple_tests.pl.fa .simple_tests.tmp
 ./bowtie    -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
 1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Raw paired 3 (fw:1, sam:1)
 References:
 >0
@@ -1269,13 +1308,13 @@
 ./bowtie    -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
-r1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
+100.00r1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
+%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 r1	83	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
 Tabbed paired 3 (fw:1, sam:1)
 References:
@@ -1298,15 +1337,15 @@
 AGCATCGATCAAAAACTGA
 ./bowtie    -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (100.00%)
-No alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	77	*	0	0	*	*	0	0			XM:i:0
 r0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
+1
+# reads with at least one alignment: 0 (0.00%)
+# reads that failed to align: 1 (100.00%)
+No alignments
 Interleaved 1 (fw:1, sam:1)
 References:
 >0
@@ -1404,15 +1443,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	12	255	7M	=	3	-16	TTTTATA	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Paired-end 2 (fw:1, sam:1)
 References:
 >0
@@ -1450,10 +1489,10 @@
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1465,10 +1504,10 @@
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1481,9 +1520,9 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0@HD	VN:1.0	SO:unsorted
- (0.00%)
+# reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1496,9 +1535,9 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)@HD	VN:1.0	SO:unsorted
-
+# reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1510,10 +1549,10 @@
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
-0.00%)
+# reads with at least one alignment: 0 (0.00%)
 # reads that failed to align: 1 (100.00%)
 No alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
@@ -1524,15 +1563,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (100.00%)
-No alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	CTTTCGT	IIIIIII	XM:i:0
 r0	141	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
+1
+# reads with at least one alignment: 0 (0.00%)
+# reads that failed to align: 1 (100.00%)
+No alignments
 Paired-end 4, containment excluded (fw:1, sam:1)
 References:
 >0
@@ -1554,12 +1593,12 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 0 (@HD	VN:1.0	SO:unsorted
+# reads processed: 1@HD	VN:1.0	SO:unsorted
+
+# reads with at least one alignment: 0 (@SQ	SN:0	LN:25
 0.00%)
 # reads that failed to align: 1 (100.00%)
 No alignments
-@SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	77	*	0	0	*	*	0	0	CTTTCGT	IIIIIII	XM:i:0
 r0	141	*	0	0	*	*	0	0	AACGAAAG	IIIIIIII	XM:i:0
@@ -1584,15 +1623,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Paired-end 5, allow contain (fw:1, sam:1)
 References:
 >0
@@ -1600,10 +1639,10 @@
 ./bowtie    --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1614,30 +1653,30 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	4	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	83	0	4	255	7M	=	3	-8	ACGAAAG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Paired-end 6, allow contain (fw:1, sam:1)
 References:
 >0
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Paired-end 6, allow contain (fw:0, sam:1)
 References:
 >0
@@ -1645,10 +1684,10 @@
 ./bowtie    --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1660,10 +1699,10 @@
 ./bowtie    --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1690,10 +1729,10 @@
 ./bowtie    --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -1764,15 +1803,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie    --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Paired-end 8, allow contain (fw:1, sam:1)
 References:
 >0
@@ -1901,15 +1940,15 @@
 ./bowtie-build  --quiet  .simple_tests.pl.fa .simple_tests.tmp
 ./bowtie    -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 2 alignments
 @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:16
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	0	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 2 alignments
 Checking -m, 1 (fw:0, sam:1)
 References:
 >0
@@ -2063,10 +2102,10 @@
 ./bowtie    -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
@@ -2078,10 +2117,10 @@
 ./bowtie    -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	1	255	8M	*	0	0	TTGCCCGT	IIIIIIII	XA:i:2	MD:Z:3T0T3	NM:i:2	XM:i:2
@@ -2135,14 +2174,14 @@
 ./bowtie-build  --quiet  .simple_tests.pl.fa .simple_tests.tmp
 ./bowtie    -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 alignments
 Checking edits 3 (fw:0, sam:1)
 References:
 >0
@@ -2150,10 +2189,10 @@
 ./bowtie    -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	16	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
@@ -2284,13 +2323,13 @@
 AGCATCGATCAGTATCTGA
 ./bowtie   --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 0
+# reads processed: @HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
+0
 # reads with at least one alignment: 0 (0.00%)
 # reads that failed to align: 0 (0.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
 Cline multiread 2 (fw:1, sam:1)
 References:
 >0
@@ -2345,15 +2384,15 @@
 AGCATCGATCAAAAACTGA
 ./bowtie   --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
 0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 Cline paired 4 (fw:1, sam:1)
 References:
 >0
@@ -2432,14 +2471,14 @@
 ./bowtie   --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 2
-# reads with at least one alignment: @HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 2 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 2 alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
 r0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
 r1	0	0	4	255	15M	*	0	0	ATCGATCAGTATCTG	IIIIIIIIIIIIIII	XA:i:0	MD:Z:15	NM:i:0	XM:i:2
-2 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 2 alignments
 Fastq paired 2 (fw:1, sam:1)
 References:
 >0
@@ -2462,15 +2501,15 @@
 AGCATCGATCAAAAACTGA
 ./bowtie   --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
 r0	147	0	9	255	11M	=	1	-19	TCAAAAACTGA	IIIIIIIIIII	XA:i:0	MD:Z:11	NM:i:0	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Fastq paired 4 (fw:1, sam:1)
 References:
 >0
@@ -2507,27 +2546,27 @@
 AGCATCGATCAGTATCTGA
 ./bowtie   --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (100.00%)
-No alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 r0	4	*	0	0	*	*	0	0			XM:i:0
+1
+# reads with at least one alignment: 0 (0.00%)
+# reads that failed to align: 1 (100.00%)
+No alignments
 Fasta 9 (fw:1, sam:1)
 References:
 >0
 AGCATCGATCAGTATCTGA
 ./bowtie   --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
+@HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:19
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 # reads processed: 0
 # reads with at least one alignment: 0 (0.00%)
 # reads that failed to align: 0 (0.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:19
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
 Fasta multiread 2 (fw:1, sam:1)
 References:
 >0
@@ -2652,13 +2691,13 @@
 ./bowtie   --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
 0	0	0	3	255	16M	*	0	0	CATCGATCAGTATCTG	IIIIIIIIIIIIIIII	XA:i:0	MD:Z:16	NM:i:0	XM:i:2
+100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 alignments
 Raw multiread 3 (fw:1, sam:1)
 References:
 >0
@@ -2711,15 +2750,15 @@
 AGCATCGATCAAAAACTGA
 ./bowtie   --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (100.00%)
-No alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
 0	77	*	0	0	*	*	0	0			XM:i:0
 0	141	*	0	0	*	*	0	0	GATCAA	IIIIII	XM:i:0
+1
+# reads with at least one alignment: 0 (0.00%)
+# reads that failed to align: 1 (100.00%)
+No alignments
 Tabbed 7 (fw:1, sam:1)
 References:
 >0
@@ -2743,9 +2782,9 @@
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
 # reads with at least one alignment: 0 (0.00%)
-# reads that failed to align: 1 (100.00%)
+# reads that failed to align: 1 (100.00@HD	VN:1.0	SO:unsorted
+%)
 No alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	4	*	0	0	*	*	0	0			XM:i:0
@@ -2799,10 +2838,10 @@
 ./bowtie   --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r1	163	0	1	255	10M	=	9	19	AGCATCGATC	IIIIIIIIII	XA:i:0	MD:Z:10	NM:i:0	XM:i:2
@@ -2831,8 +2870,8 @@
 # reads processed: 1
 # reads with at least one alignment: 0 (0.00%)
 # reads that failed to align: 1 (100.00%)
-No alignments
-@HD	VN:1.0	SO:unsorted
+No alignments@HD	VN:1.0	SO:unsorted
+
 @SQ	SN:0	LN:19
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
 r0	77	*	0	0	*	*	0	0			XM:i:0
@@ -2875,10 +2914,10 @@
 ./bowtie   --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
-@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	163	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -2889,15 +2928,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie   --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	17	21	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	17	255	7M	=	3	-21	TAGATGG	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 Paired-end 1 (fw:0, sam:1)
 References:
 >0
@@ -2949,12 +2988,12 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie   --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	12	16	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	12	255	7M	=	3	-16	TTTTATA	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
-# reads processed: 1
+1
 # reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
@@ -2979,15 +3018,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie   --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-@HD	VN:1.0	SO:unsorted
+# reads processed: 1
+# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
+100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	8	12	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	8	255	7M	=	3	-12	AAGCTTT	IIIIIII	XA:i:0	MD:Z:7	NM:i:0	XM:i:2
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 Paired-end 3 (fw:0, sam:1)
 References:
 >0
@@ -3189,15 +3228,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie   --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	99	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	147	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Paired-end 6, allow contain (fw:0, sam:1)
 References:
 >0
@@ -3279,15 +3318,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie   --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
 Paired-end 8, allow contain (fw:0, sam:1)
 References:
 >0
@@ -3354,15 +3393,15 @@
 AAAACGAAAGCTTTTATAGATGGGG
 ./bowtie   --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: @HD	VN:1.0	SO:unsorted
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGATAG	IIIIIIII	XA:i:1	MD:Z:5A2	NM:i:1	XM:i:2
 r0	131	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
-1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 paired-end alignments
 Paired-end 9, allow contain (fw:1, sam:1)
 References:
 >0
@@ -3370,10 +3409,10 @@
 ./bowtie   --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
 # reads processed: 1
-# reads with at least one alignment: 1 (@HD	VN:1.0	SO:unsorted
-100.00%)
+# reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 paired-end alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:25
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
 r0	67	0	3	255	8M	=	3	8	AACGAAAG	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:2
@@ -3400,15 +3439,15 @@
 ./bowtie-build --large-index --quiet  .simple_tests.pl.fa .simple_tests.tmp
 ./bowtie   --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: @HD	VN:1.0	SO:unsorted
+# reads processed: 1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 2 alignments
+@HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:16
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	9	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:0	MD:Z:8	NM:i:0	XM:i:3
-1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 2 alignments
 Checking -m, 1 (fw:0, sam:1)
 References:
 >0
@@ -3476,14 +3515,14 @@
 TTGTTCGTTTGTTCGTTTGTTCGT
 ./bowtie   --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
+# reads processed: @HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:24
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
+1
 # reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 # reads with alignments suppressed due to -m: 1 (100.00%)
 No alignments
-@HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:24
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
 Checking -m, 2 (fw:1, sam:1)
 References:
 >0
@@ -3549,14 +3588,14 @@
 ./bowtie-build --large-index --quiet  .simple_tests.pl.fa .simple_tests.tmp
 ./bowtie   --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: 1
-# reads with at least one alignment: 1 (100.00%)
-# reads that failed to align: 0 (0.00%)
-Reported 1 alignments
-@HD	VN:1.0	SO:unsorted
+# reads processed: @HD	VN:1.0	SO:unsorted
 @SQ	SN:0	LN:8
 @PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
 r0	0	0	1	255	8M	*	0	0	TTGTTCGT	IIIIIIII	XA:i:2	MD:Z:3C0C3	NM:i:2	XM:i:2
+1
+# reads with at least one alignment: 1 (100.00%)
+# reads that failed to align: 0 (0.00%)
+Reported 1 alignments
 Checking edits 1 (fw:0, sam:1)
 References:
 >0
@@ -3636,14 +3675,14 @@
 ./bowtie-build --large-index --quiet  .simple_tests.pl.fa .simple_tests.tmp
 ./bowtie   --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
-# reads processed: @HD	VN:1.0	SO:unsorted
-@SQ	SN:0	LN:8
-@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
-r0	0	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
-1
+# reads processed: 1
 # reads with at least one alignment: 1 (100.00%)
 # reads that failed to align: 0 (0.00%)
 Reported 1 alignments
+@HD	VN:1.0	SO:unsorted
+@SQ	SN:0	LN:8
+@PG	ID:Bowtie	VN:1.3.0	CL:"/build/bowtie-1.3.0+dfsg1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
+r0	0	0	3	255	4M	*	0	0	GTTC	IIII	XA:i:0	MD:Z:4	NM:i:0	XM:i:2
 Checking edits 3 (fw:0, sam:1)
 References:
 >0
@@ -3745,7 +3784,7 @@
 find . -name .cvsignore -delete
 make[1]: Leaving directory '/build/bowtie-1.3.0+dfsg1'
    dh_auto_install -Nbowtie
-	make -j15 install DESTDIR=/build/bowtie-1.3.0\+dfsg1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true"
+	make -j16 install DESTDIR=/build/bowtie-1.3.0\+dfsg1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true"
 make[1]: Entering directory '/build/bowtie-1.3.0+dfsg1'
 mkdir -p /build/bowtie-1.3.0+dfsg1/debian/tmp/usr/local/bin
 for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \
@@ -3797,8 +3836,8 @@
    dh_gencontrol
    dh_md5sums
    dh_builddeb
-dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.0+dfsg1-1_amd64.deb'.
 dpkg-deb: building package 'bowtie' in '../bowtie_1.3.0+dfsg1-1_amd64.deb'.
+dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.0+dfsg1-1_amd64.deb'.
 dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.0+dfsg1-1_all.deb'.
  dpkg-genbuildinfo --build=binary
  dpkg-genchanges --build=binary >../bowtie_1.3.0+dfsg1-1_amd64.changes
@@ -3807,12 +3846,14 @@
 dpkg-buildpackage: info: binary-only upload (no source included)
 dpkg-genchanges: info: including full source code in upload
 I: copying local configuration
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/B01_cleanup starting
+I: user script /srv/workspace/pbuilder/597387/tmp/hooks/B01_cleanup finished
 I: unmounting dev/ptmx filesystem
 I: unmounting dev/pts filesystem
 I: unmounting dev/shm filesystem
 I: unmounting proc filesystem
 I: unmounting sys filesystem
 I: cleaning the build env 
-I: removing directory /srv/workspace/pbuilder/1934300 and its subdirectories
-I: Current time: Thu Jan  5 09:02:21 -12 2023
-I: pbuilder-time-stamp: 1672952541
+I: removing directory /srv/workspace/pbuilder/597387 and its subdirectories
+I: Current time: Thu Feb  8 19:06:10 +14 2024
+I: pbuilder-time-stamp: 1707368770