Diff of the two buildlogs: -- --- b1/build.log 2021-07-29 08:16:39.328565222 +0000 +++ b2/build.log 2021-07-29 08:27:08.928830020 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Wed Jul 28 20:08:47 -12 2021 -I: pbuilder-time-stamp: 1627546127 +I: Current time: Thu Jul 29 22:16:50 +14 2021 +I: pbuilder-time-stamp: 1627546611 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration @@ -16,8 +16,8 @@ I: copying [./ataqv_1.2.1+ds-1.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' -gpgv: keyblock resource '/tmp/dpkg-verify-sig.1RG0Ie5_/trustedkeys.kbx': General error -gpgv: Signature made Wed Sep 30 23:42:09 2020 -12 +gpgv: keyblock resource '/tmp/dpkg-verify-sig.popnbQoH/trustedkeys.kbx': General error +gpgv: Signature made Fri Oct 2 01:42:09 2020 +14 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key @@ -35,135 +35,169 @@ dpkg-source: info: applying reproducible_build I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/16909/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/15331/tmp/hooks/D01_modify_environment starting +debug: Running on virt32c. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +Removing 'diversion of /bin/sh to /bin/sh.distrib by dash' +Adding 'diversion of /bin/sh to /bin/sh.distrib by bash' +Removing 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by dash' +Adding 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by bash' +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/15331/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/15331/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='armhf' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=3' - DISTRIBUTION='' - HOME='/root' - HOST_ARCH='armhf' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:hostcomplete:interactive_comments:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="1" [2]="4" [3]="1" [4]="release" [5]="arm-unknown-linux-gnueabihf") + BASH_VERSION='5.1.4(1)-release' + BUILDDIR=/build + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=armhf + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=4' + DIRSTACK=() + DISTRIBUTION= + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=arm + HOST_ARCH=armhf IFS=' ' - INVOCATION_ID='5ba65c3f88bf4f6eb12f7ac9cd8439f2' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='16909' - PS1='# ' - PS2='> ' + INVOCATION_ID=fe440f4b4b3d48ed9389d325ae9b9cc8 + LANG=C + LANGUAGE=it_CH:it + LC_ALL=C + MACHTYPE=arm-unknown-linux-gnueabihf + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnueabihf + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=15331 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.Wed8YMCWYb/pbuilderrc_YPvA --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.Wed8YMCWYb/b1 --logfile b1/build.log ataqv_1.2.1+ds-1.dsc' - SUDO_GID='114' - SUDO_UID='108' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://10.0.0.15:8000/' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.Wed8YMCWYb/pbuilderrc_LHzC --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.Wed8YMCWYb/b2 --logfile b2/build.log --extrapackages usrmerge ataqv_1.2.1+ds-1.dsc' + SUDO_GID=113 + SUDO_UID=107 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://10.0.0.15:8000/ I: uname -a - Linux jtx1c 5.10.0-8-arm64 #1 SMP Debian 5.10.46-2 (2021-07-20) aarch64 GNU/Linux + Linux i-capture-the-hostname 5.10.0-8-armmp-lpae #1 SMP Debian 5.10.46-2 (2021-07-20) armv7l GNU/Linux I: ls -l /bin total 3580 - -rwxr-xr-x 1 root root 816764 Jun 21 14:26 bash - -rwxr-xr-x 3 root root 26052 Jul 20 2020 bunzip2 - -rwxr-xr-x 3 root root 26052 Jul 20 2020 bzcat - lrwxrwxrwx 1 root root 6 Jul 20 2020 bzcmp -> bzdiff - -rwxr-xr-x 1 root root 2225 Jul 20 2020 bzdiff - lrwxrwxrwx 1 root root 6 Jul 20 2020 bzegrep -> bzgrep - -rwxr-xr-x 1 root root 4877 Sep 4 2019 bzexe - lrwxrwxrwx 1 root root 6 Jul 20 2020 bzfgrep -> bzgrep - -rwxr-xr-x 1 root root 3775 Jul 20 2020 bzgrep - -rwxr-xr-x 3 root root 26052 Jul 20 2020 bzip2 - -rwxr-xr-x 1 root root 9636 Jul 20 2020 bzip2recover - lrwxrwxrwx 1 root root 6 Jul 20 2020 bzless -> bzmore - -rwxr-xr-x 1 root root 1297 Jul 20 2020 bzmore - -rwxr-xr-x 1 root root 26668 Sep 22 2020 cat - -rwxr-xr-x 1 root root 43104 Sep 22 2020 chgrp - -rwxr-xr-x 1 root root 38984 Sep 22 2020 chmod - -rwxr-xr-x 1 root root 43112 Sep 22 2020 chown - -rwxr-xr-x 1 root root 92616 Sep 22 2020 cp - -rwxr-xr-x 1 root root 75524 Dec 10 2020 dash - -rwxr-xr-x 1 root root 75880 Sep 22 2020 date - -rwxr-xr-x 1 root root 55436 Sep 22 2020 dd - -rwxr-xr-x 1 root root 59912 Sep 22 2020 df - -rwxr-xr-x 1 root root 96764 Sep 22 2020 dir - -rwxr-xr-x 1 root root 55012 Feb 7 02:38 dmesg - lrwxrwxrwx 1 root root 8 Nov 6 2019 dnsdomainname -> hostname - lrwxrwxrwx 1 root root 8 Nov 6 2019 domainname -> hostname - -rwxr-xr-x 1 root root 22508 Sep 22 2020 echo - -rwxr-xr-x 1 root root 28 Nov 9 2020 egrep - -rwxr-xr-x 1 root root 22496 Sep 22 2020 false - -rwxr-xr-x 1 root root 28 Nov 9 2020 fgrep - -rwxr-xr-x 1 root root 47492 Feb 7 02:38 findmnt - -rwsr-xr-x 1 root root 26076 Feb 26 04:12 fusermount - -rwxr-xr-x 1 root root 124508 Nov 9 2020 grep - -rwxr-xr-x 2 root root 2346 Mar 2 11:30 gunzip - -rwxr-xr-x 1 root root 6376 Mar 2 11:30 gzexe - -rwxr-xr-x 1 root root 64212 Mar 2 11:30 gzip - -rwxr-xr-x 1 root root 13784 Nov 6 2019 hostname - -rwxr-xr-x 1 root root 43180 Sep 22 2020 ln - -rwxr-xr-x 1 root root 35068 Feb 7 2020 login - -rwxr-xr-x 1 root root 96764 Sep 22 2020 ls - -rwxr-xr-x 1 root root 99940 Feb 7 02:38 lsblk - -rwxr-xr-x 1 root root 51408 Sep 22 2020 mkdir - -rwxr-xr-x 1 root root 43184 Sep 22 2020 mknod - -rwxr-xr-x 1 root root 30780 Sep 22 2020 mktemp - -rwxr-xr-x 1 root root 34408 Feb 7 02:38 more - -rwsr-xr-x 1 root root 34400 Feb 7 02:38 mount - -rwxr-xr-x 1 root root 9824 Feb 7 02:38 mountpoint - -rwxr-xr-x 1 root root 88524 Sep 22 2020 mv - lrwxrwxrwx 1 root root 8 Nov 6 2019 nisdomainname -> hostname - lrwxrwxrwx 1 root root 14 Apr 18 03:38 pidof -> /sbin/killall5 - -rwxr-xr-x 1 root root 26652 Sep 22 2020 pwd - lrwxrwxrwx 1 root root 4 Jun 21 14:26 rbash -> bash - -rwxr-xr-x 1 root root 30740 Sep 22 2020 readlink - -rwxr-xr-x 1 root root 43104 Sep 22 2020 rm - -rwxr-xr-x 1 root root 30732 Sep 22 2020 rmdir - -rwxr-xr-x 1 root root 14144 Sep 27 2020 run-parts - -rwxr-xr-x 1 root root 76012 Dec 22 2018 sed - lrwxrwxrwx 1 root root 4 Jul 27 21:24 sh -> dash - -rwxr-xr-x 1 root root 22532 Sep 22 2020 sleep - -rwxr-xr-x 1 root root 55360 Sep 22 2020 stty - -rwsr-xr-x 1 root root 46704 Feb 7 02:38 su - -rwxr-xr-x 1 root root 22532 Sep 22 2020 sync - -rwxr-xr-x 1 root root 340872 Feb 16 21:55 tar - -rwxr-xr-x 1 root root 9808 Sep 27 2020 tempfile - -rwxr-xr-x 1 root root 67696 Sep 22 2020 touch - -rwxr-xr-x 1 root root 22496 Sep 22 2020 true - -rwxr-xr-x 1 root root 9636 Feb 26 04:12 ulockmgr_server - -rwsr-xr-x 1 root root 22108 Feb 7 02:38 umount - -rwxr-xr-x 1 root root 22520 Sep 22 2020 uname - -rwxr-xr-x 2 root root 2346 Mar 2 11:30 uncompress - -rwxr-xr-x 1 root root 96764 Sep 22 2020 vdir - -rwxr-xr-x 1 root root 38512 Feb 7 02:38 wdctl - lrwxrwxrwx 1 root root 8 Nov 6 2019 ypdomainname -> hostname - -rwxr-xr-x 1 root root 1984 Mar 2 11:30 zcat - -rwxr-xr-x 1 root root 1678 Mar 2 11:30 zcmp - -rwxr-xr-x 1 root root 5880 Mar 2 11:30 zdiff - -rwxr-xr-x 1 root root 29 Mar 2 11:30 zegrep - -rwxr-xr-x 1 root root 29 Mar 2 11:30 zfgrep - -rwxr-xr-x 1 root root 2081 Mar 2 11:30 zforce - -rwxr-xr-x 1 root root 7585 Mar 2 11:30 zgrep - -rwxr-xr-x 1 root root 2206 Mar 2 11:30 zless - -rwxr-xr-x 1 root root 1842 Mar 2 11:30 zmore - -rwxr-xr-x 1 root root 4553 Mar 2 11:30 znew -I: user script /srv/workspace/pbuilder/16909/tmp/hooks/D02_print_environment finished + -rwxr-xr-x 1 root root 816764 Jun 22 16:26 bash + -rwxr-xr-x 3 root root 26052 Jul 21 2020 bunzip2 + -rwxr-xr-x 3 root root 26052 Jul 21 2020 bzcat + lrwxrwxrwx 1 root root 6 Jul 21 2020 bzcmp -> bzdiff + -rwxr-xr-x 1 root root 2225 Jul 21 2020 bzdiff + lrwxrwxrwx 1 root root 6 Jul 21 2020 bzegrep -> bzgrep + -rwxr-xr-x 1 root root 4877 Sep 5 2019 bzexe + lrwxrwxrwx 1 root root 6 Jul 21 2020 bzfgrep -> bzgrep + -rwxr-xr-x 1 root root 3775 Jul 21 2020 bzgrep + -rwxr-xr-x 3 root root 26052 Jul 21 2020 bzip2 + -rwxr-xr-x 1 root root 9636 Jul 21 2020 bzip2recover + lrwxrwxrwx 1 root root 6 Jul 21 2020 bzless -> bzmore + -rwxr-xr-x 1 root root 1297 Jul 21 2020 bzmore + -rwxr-xr-x 1 root root 26668 Sep 23 2020 cat + -rwxr-xr-x 1 root root 43104 Sep 23 2020 chgrp + -rwxr-xr-x 1 root root 38984 Sep 23 2020 chmod + -rwxr-xr-x 1 root root 43112 Sep 23 2020 chown + -rwxr-xr-x 1 root root 92616 Sep 23 2020 cp + -rwxr-xr-x 1 root root 75524 Dec 11 2020 dash + -rwxr-xr-x 1 root root 75880 Sep 23 2020 date + -rwxr-xr-x 1 root root 55436 Sep 23 2020 dd + -rwxr-xr-x 1 root root 59912 Sep 23 2020 df + -rwxr-xr-x 1 root root 96764 Sep 23 2020 dir + -rwxr-xr-x 1 root root 55012 Feb 8 04:38 dmesg + lrwxrwxrwx 1 root root 8 Nov 8 2019 dnsdomainname -> hostname + lrwxrwxrwx 1 root root 8 Nov 8 2019 domainname -> hostname + -rwxr-xr-x 1 root root 22508 Sep 23 2020 echo + -rwxr-xr-x 1 root root 28 Nov 10 2020 egrep + -rwxr-xr-x 1 root root 22496 Sep 23 2020 false + -rwxr-xr-x 1 root root 28 Nov 10 2020 fgrep + -rwxr-xr-x 1 root root 47492 Feb 8 04:38 findmnt + -rwsr-xr-x 1 root root 26076 Feb 27 06:12 fusermount + -rwxr-xr-x 1 root root 124508 Nov 10 2020 grep + -rwxr-xr-x 2 root root 2346 Mar 3 13:30 gunzip + -rwxr-xr-x 1 root root 6376 Mar 3 13:30 gzexe + -rwxr-xr-x 1 root root 64212 Mar 3 13:30 gzip + -rwxr-xr-x 1 root root 13784 Nov 8 2019 hostname + -rwxr-xr-x 1 root root 43180 Sep 23 2020 ln + -rwxr-xr-x 1 root root 35068 Feb 8 2020 login + -rwxr-xr-x 1 root root 96764 Sep 23 2020 ls + -rwxr-xr-x 1 root root 99940 Feb 8 04:38 lsblk + -rwxr-xr-x 1 root root 51408 Sep 23 2020 mkdir + -rwxr-xr-x 1 root root 43184 Sep 23 2020 mknod + -rwxr-xr-x 1 root root 30780 Sep 23 2020 mktemp + -rwxr-xr-x 1 root root 34408 Feb 8 04:38 more + -rwsr-xr-x 1 root root 34400 Feb 8 04:38 mount + -rwxr-xr-x 1 root root 9824 Feb 8 04:38 mountpoint + -rwxr-xr-x 1 root root 88524 Sep 23 2020 mv + lrwxrwxrwx 1 root root 8 Nov 8 2019 nisdomainname -> hostname + lrwxrwxrwx 1 root root 14 Apr 19 05:38 pidof -> /sbin/killall5 + -rwxr-xr-x 1 root root 26652 Sep 23 2020 pwd + lrwxrwxrwx 1 root root 4 Jun 22 16:26 rbash -> bash + -rwxr-xr-x 1 root root 30740 Sep 23 2020 readlink + -rwxr-xr-x 1 root root 43104 Sep 23 2020 rm + -rwxr-xr-x 1 root root 30732 Sep 23 2020 rmdir + -rwxr-xr-x 1 root root 14144 Sep 28 2020 run-parts + -rwxr-xr-x 1 root root 76012 Dec 23 2018 sed + lrwxrwxrwx 1 root root 4 Jul 29 22:17 sh -> bash + lrwxrwxrwx 1 root root 4 Jul 26 23:25 sh.distrib -> dash + -rwxr-xr-x 1 root root 22532 Sep 23 2020 sleep + -rwxr-xr-x 1 root root 55360 Sep 23 2020 stty + -rwsr-xr-x 1 root root 46704 Feb 8 04:38 su + -rwxr-xr-x 1 root root 22532 Sep 23 2020 sync + -rwxr-xr-x 1 root root 340872 Feb 17 23:55 tar + -rwxr-xr-x 1 root root 9808 Sep 28 2020 tempfile + -rwxr-xr-x 1 root root 67696 Sep 23 2020 touch + -rwxr-xr-x 1 root root 22496 Sep 23 2020 true + -rwxr-xr-x 1 root root 9636 Feb 27 06:12 ulockmgr_server + -rwsr-xr-x 1 root root 22108 Feb 8 04:38 umount + -rwxr-xr-x 1 root root 22520 Sep 23 2020 uname + -rwxr-xr-x 2 root root 2346 Mar 3 13:30 uncompress + -rwxr-xr-x 1 root root 96764 Sep 23 2020 vdir + -rwxr-xr-x 1 root root 38512 Feb 8 04:38 wdctl + lrwxrwxrwx 1 root root 8 Nov 8 2019 ypdomainname -> hostname + -rwxr-xr-x 1 root root 1984 Mar 3 13:30 zcat + -rwxr-xr-x 1 root root 1678 Mar 3 13:30 zcmp + -rwxr-xr-x 1 root root 5880 Mar 3 13:30 zdiff + -rwxr-xr-x 1 root root 29 Mar 3 13:30 zegrep + -rwxr-xr-x 1 root root 29 Mar 3 13:30 zfgrep + -rwxr-xr-x 1 root root 2081 Mar 3 13:30 zforce + -rwxr-xr-x 1 root root 7585 Mar 3 13:30 zgrep + -rwxr-xr-x 1 root root 2206 Mar 3 13:30 zless + -rwxr-xr-x 1 root root 1842 Mar 3 13:30 zmore + -rwxr-xr-x 1 root root 4553 Mar 3 13:30 znew +I: user script /srv/workspace/pbuilder/15331/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -357,7 +391,7 @@ Get: 124 http://deb.debian.org/debian bullseye/main armhf node-d3-voronoi all 1.1.4-3 [17.1 kB] Get: 125 http://deb.debian.org/debian bullseye/main armhf node-d3-zoom all 1.8.3-2 [20.1 kB] Get: 126 http://deb.debian.org/debian bullseye/main armhf node-d3 all 5.16.0-4 [208 kB] -Fetched 62.2 MB in 6s (10.1 MB/s) +Fetched 62.2 MB in 13s (4781 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19398 files and directories currently installed.) @@ -879,8 +913,45 @@ Writing extended state information... Building tag database... -> Finished parsing the build-deps +Reading package lists... +Building dependency tree... +Reading state information... +The following additional packages will be installed: + libfile-find-rule-perl libnumber-compare-perl libtext-glob-perl +The following NEW packages will be installed: + libfile-find-rule-perl libnumber-compare-perl libtext-glob-perl usrmerge +0 upgraded, 4 newly installed, 0 to remove and 0 not upgraded. +Need to get 59.5 kB of archives. +After this operation, 157 kB of additional disk space will be used. +Get:1 http://deb.debian.org/debian bullseye/main armhf libnumber-compare-perl all 0.03-1.1 [6956 B] +Get:2 http://deb.debian.org/debian bullseye/main armhf libtext-glob-perl all 0.11-1 [8888 B] +Get:3 http://deb.debian.org/debian bullseye/main armhf libfile-find-rule-perl all 0.34-1 [30.6 kB] +Get:4 http://deb.debian.org/debian bullseye/main armhf usrmerge all 25 [13.0 kB] +debconf: delaying package configuration, since apt-utils is not installed +Fetched 59.5 kB in 0s (897 kB/s) +Selecting previously unselected package libnumber-compare-perl. +(Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 39792 files and directories currently installed.) +Preparing to unpack .../libnumber-compare-perl_0.03-1.1_all.deb ... +Unpacking libnumber-compare-perl (0.03-1.1) ... +Selecting previously unselected package libtext-glob-perl. +Preparing to unpack .../libtext-glob-perl_0.11-1_all.deb ... +Unpacking libtext-glob-perl (0.11-1) ... +Selecting previously unselected package libfile-find-rule-perl. +Preparing to unpack .../libfile-find-rule-perl_0.34-1_all.deb ... +Unpacking libfile-find-rule-perl (0.34-1) ... +Selecting previously unselected package usrmerge. +Preparing to unpack .../archives/usrmerge_25_all.deb ... +Unpacking usrmerge (25) ... +Setting up libtext-glob-perl (0.11-1) ... +Setting up libnumber-compare-perl (0.03-1.1) ... +Setting up libfile-find-rule-perl (0.34-1) ... +Setting up usrmerge (25) ... +The system has been successfully converted. +Processing triggers for man-db (2.9.4-2) ... +Not building database; man-db/auto-update is not 'true'. I: Building the package -I: Running cd /build/ataqv-1.2.1+ds/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../ataqv_1.2.1+ds-1_source.changes +hostname: Name or service not known +I: Running cd /build/ataqv-1.2.1+ds/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../ataqv_1.2.1+ds-1_source.changes dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.2.1+ds-1 dpkg-buildpackage: info: source distribution unstable @@ -890,16 +961,16 @@ debian/rules clean dh clean dh_auto_clean - make -j3 clean -make[1]: Entering directory '/build/ataqv-1.2.1+ds' -make[1]: Leaving directory '/build/ataqv-1.2.1+ds' + make -j4 clean +make[1]: ingresso nella directory «/build/ataqv-1.2.1+ds» +make[1]: uscita dalla directory «/build/ataqv-1.2.1+ds» dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure -make[1]: Entering directory '/build/ataqv-1.2.1+ds' +make[1]: ingresso nella directory «/build/ataqv-1.2.1+ds» cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css @@ -917,15 +988,16 @@ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js -make[1]: Leaving directory '/build/ataqv-1.2.1+ds' +make[1]: uscita dalla directory «/build/ataqv-1.2.1+ds» debian/rules override_dh_auto_build -make[1]: Entering directory '/build/ataqv-1.2.1+ds' +make[1]: ingresso nella directory «/build/ataqv-1.2.1+ds» dh_auto_build -- all testing/run_ataqv_tests - make -j3 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests -make[2]: Entering directory '/build/ataqv-1.2.1+ds' + make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests +make[2]: ingresso nella directory «/build/ataqv-1.2.1+ds» g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/ataqv.o -c /build/ataqv-1.2.1+ds/src/cpp/ataqv.cpp g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Features.o -c /build/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/HTS.o -c /build/ataqv-1.2.1+ds/src/cpp/HTS.cpp +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/IO.o -c /build/ataqv-1.2.1+ds/src/cpp/IO.cpp In file included from /usr/include/c++/10/map:60, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:10, from /build/ataqv-1.2.1+ds/src/cpp/Features.hpp:12, @@ -984,7 +1056,6 @@ | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 503 | std::tuple<>()); | ~~~~~~~~~~~~~~~ -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/IO.o -c /build/ataqv-1.2.1+ds/src/cpp/IO.cpp g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Metrics.o -c /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Peaks.o -c /build/ataqv-1.2.1+ds/src/cpp/Peaks.cpp In file included from /usr/include/c++/10/bits/stl_algo.h:61, @@ -1051,12 +1122,12 @@ /usr/include/c++/10/bits/stl_algo.h:1819:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1819 | __unguarded_linear_insert(_RandomAccessIterator __last, | ^~~~~~~~~~~~~~~~~~~~~~~~~ -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Utils.o -c /build/ataqv-1.2.1+ds/src/cpp/Utils.cpp /usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/10/bits/stl_algo.h:1839:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1839 | __insertion_sort(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/10/bits/stl_algo.h:1839:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o build/Utils.o -c /build/ataqv-1.2.1+ds/src/cpp/Utils.cpp /usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/10/bits/stl_algo.h:1945:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1945 | __introsort_loop(_RandomAccessIterator __first, @@ -1156,6 +1227,7 @@ /usr/include/c++/10/bits/stl_algo.h:1666:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1666 | std::__make_heap(__first, __middle, __comp); | ~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /build/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp In file included from /usr/include/c++/10/vector:67, from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, @@ -1181,7 +1253,6 @@ /usr/include/c++/10/bits/stl_algo.h:1891:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1891 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /build/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp In file included from /usr/include/c++/10/vector:67, from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, @@ -1208,11 +1279,65 @@ 1891 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_features.o -c /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_hts.o -c /build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp In file included from /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ +In file included from /build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:3: +/build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: +/build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] + 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); + | ^~~~~~~~~~~~ +In file included from /usr/include/c++/10/bits/stl_algo.h:61, + from /usr/include/c++/10/algorithm:62, + from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:76, + from /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: +/usr/include/c++/10/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Feature; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: +/usr/include/c++/10/bits/stl_heap.h:223:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 223 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, + | ^~~~~~~~~~~~~ +In file included from /usr/include/c++/10/algorithm:62, + from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:76, + from /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: +/usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: +/usr/include/c++/10/bits/stl_algo.h:1839:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1839 | __insertion_sort(_RandomAccessIterator __first, + | ^~~~~~~~~~~~~~~~ +/usr/include/c++/10/bits/stl_algo.h:1839:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +/usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__heap_select(_RandomAccessIterator, _RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: +/usr/include/c++/10/bits/stl_algo.h:1662:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1662 | __heap_select(_RandomAccessIterator __first, + | ^~~~~~~~~~~~~ +/usr/include/c++/10/bits/stl_algo.h:1662:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +/usr/include/c++/10/bits/stl_algo.h:1662:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +/usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: +/usr/include/c++/10/bits/stl_algo.h:1945:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1945 | __introsort_loop(_RandomAccessIterator __first, + | ^~~~~~~~~~~~~~~~ +/usr/include/c++/10/bits/stl_algo.h:1945:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 +/usr/include/c++/10/bits/stl_algo.h:1959:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1959 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +/usr/include/c++/10/bits/stl_algo.h:1937:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1937 | std::__heap_select(__first, __middle, __last, __comp); + | ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +/usr/include/c++/10/bits/stl_algo.h: In function ‘void ____C_A_T_C_H____T_E_S_T____61()’: +/usr/include/c++/10/bits/stl_algo.h:1974:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1974 | std::__introsort_loop(__first, __last, + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ + 1975 | std::__lg(__last - __first) * 2, + | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + 1976 | __comp); + | ~~~~~~~ +/usr/include/c++/10/bits/stl_algo.h:1886:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1886 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +/usr/include/c++/10/bits/stl_algo.h:1891:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1891 | std::__insertion_sort(__first, __last, __comp); + | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_io.o -c /build/ataqv-1.2.1+ds/src/cpp/test_io.cpp In file included from /usr/include/c++/10/vector:72, from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, @@ -1242,14 +1367,6 @@ | ^~~~~~~~~~~~~~~~~~~ /usr/include/c++/10/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(std::vector<_Tp, _Alloc>::iterator, _Args&& ...) [with _Args = {const long double&}; _Tp = long double; _Alloc = std::allocator]’: /usr/include/c++/10/bits/vector.tcc:426:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 -In file included from /usr/include/c++/10/bits/stl_algo.h:61, - from /usr/include/c++/10/algorithm:62, - from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:76, - from /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: -/usr/include/c++/10/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Feature; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: -/usr/include/c++/10/bits/stl_heap.h:223:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 223 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, - | ^~~~~~~~~~~~~ In file included from /usr/include/c++/10/map:60, from /usr/include/boost/system/detail/std_interoperability.hpp:11, from /usr/include/boost/system/error_code.hpp:963, @@ -1263,14 +1380,6 @@ /usr/include/c++/10/bits/stl_tree.h:2193:5: note: parameter passing for argument of type ‘std::_Rb_tree, std::_Select1st >, std::less, std::allocator > >::const_iterator’ changed in GCC 7.1 2193 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -In file included from /usr/include/c++/10/algorithm:62, - from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:76, - from /build/ataqv-1.2.1+ds/src/cpp/test_features.cpp:1: -/usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: -/usr/include/c++/10/bits/stl_algo.h:1839:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1839 | __insertion_sort(_RandomAccessIterator __first, - | ^~~~~~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h:1839:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 In file included from /usr/include/c++/10/vector:72, from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, @@ -1290,20 +1399,16 @@ /usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 1198 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp In file included from /build/ataqv-1.2.1+ds/src/cpp/Metrics.hpp:16, from /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:21: /build/ataqv-1.2.1+ds/src/cpp/json.hpp: In constructor ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, nlohmann::basic_json::value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.2.1+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 2082 | basic_json(std::initializer_list init, | ^~~~~~~~~~ +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp /build/ataqv-1.2.1+ds/src/cpp/json.hpp: In function ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, nlohmann::basic_json::value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.2.1+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 -/usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__heap_select(_RandomAccessIterator, _RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: -/usr/include/c++/10/bits/stl_algo.h:1662:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1662 | __heap_select(_RandomAccessIterator __first, - | ^~~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h:1662:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 -/usr/include/c++/10/bits/stl_algo.h:1662:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp: In member function ‘nlohmann::json Library::to_json()’: /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:1341:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1341 | }; @@ -1333,31 +1438,27 @@ /usr/include/c++/10/bits/vector.tcc:121:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 121 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: -/usr/include/c++/10/bits/stl_algo.h:1945:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1945 | __introsort_loop(_RandomAccessIterator __first, - | ^~~~~~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h:1945:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 -/usr/include/c++/10/bits/stl_algo.h:1959:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1959 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h:1937:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1937 | std::__heap_select(__first, __middle, __last, __comp); - | ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h: In function ‘void ____C_A_T_C_H____T_E_S_T____61()’: -/usr/include/c++/10/bits/stl_algo.h:1974:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1974 | std::__introsort_loop(__first, __last, - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ - 1975 | std::__lg(__last - __first) * 2, - | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - 1976 | __comp); - | ~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h:1886:25: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1886 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_algo.h:1891:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1891 | std::__insertion_sort(__first, __last, __comp); - | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ +In file included from /build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:1: +/build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: +/build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] + 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); + | ^~~~~~~~~~~~ +In file included from /build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:3: +/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: +/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:172:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 172 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ +/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:177:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 177 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ +/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____242()’: +/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:248:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 248 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ +/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____251()’: +/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:258:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] + 258 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); + | ^~~~~~~~~~~~~ In file included from /usr/include/c++/10/vector:67, from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, @@ -1370,12 +1471,24 @@ /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:881:1: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 881 | } | ^ -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_hts.o -c /build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp -In file included from /build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:3: -/build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: -/build/ataqv-1.2.1+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] - 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); - | ^~~~~~~~~~~~ +In file included from /usr/include/c++/10/vector:72, + from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:569, + from /build/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp:2: +/usr/include/c++/10/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(std::vector<_Tp, _Alloc>::iterator, _Args&& ...) [with _Args = {const Catch::SectionEndInfo&}; _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’: +/usr/include/c++/10/bits/vector.tcc:426:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 + 426 | vector<_Tp, _Alloc>:: + | ^~~~~~~~~~~~~~~~~~~ +In file included from /usr/include/c++/10/vector:67, + from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:569, + from /build/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp:2: +/usr/include/c++/10/bits/stl_vector.h: In member function ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’: +/usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1198 | _M_realloc_insert(end(), __x); + | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ +/usr/include/c++/10/bits/stl_vector.h: In destructor ‘Catch::Section::~Section()’: +/usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 + 1198 | _M_realloc_insert(end(), __x); + | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In file included from /usr/include/c++/10/vector:67, from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, @@ -1462,57 +1575,6 @@ /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:1531:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:1531:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:1531:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_io.o -c /build/ataqv-1.2.1+ds/src/cpp/test_io.cpp -In file included from /usr/include/c++/10/vector:72, - from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:569, - from /build/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp:2: -/usr/include/c++/10/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(std::vector<_Tp, _Alloc>::iterator, _Args&& ...) [with _Args = {const Catch::SectionEndInfo&}; _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’: -/usr/include/c++/10/bits/vector.tcc:426:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 - 426 | vector<_Tp, _Alloc>:: - | ^~~~~~~~~~~~~~~~~~~ -In file included from /usr/include/c++/10/vector:67, - from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:569, - from /build/ataqv-1.2.1+ds/src/cpp/run_ataqv_tests.cpp:2: -/usr/include/c++/10/bits/stl_vector.h: In member function ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’: -/usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1198 | _M_realloc_insert(end(), __x); - | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ -/usr/include/c++/10/bits/stl_vector.h: In destructor ‘Catch::Section::~Section()’: -/usr/include/c++/10/bits/stl_vector.h:1198:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 - 1198 | _M_realloc_insert(end(), __x); - | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ -In file included from /usr/include/c++/10/vector:72, - from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, - from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, - from /build/ataqv-1.2.1+ds/src/cpp/Features.hpp:12, - from /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:18: -/usr/include/c++/10/bits/vector.tcc: In member function ‘nlohmann::json MetricsCollector::to_json()’: -/usr/include/c++/10/bits/vector.tcc:121:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 - 121 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); - | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp -In file included from /build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:3: -/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: -/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:172:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 172 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:177:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 177 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____242()’: -/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:248:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 248 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____251()’: -/build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:258:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] - 258 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); - | ^~~~~~~~~~~~~ -In file included from /build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:1: -/build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: -/build/ataqv-1.2.1+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] - 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); - | ^~~~~~~~~~~~ In file included from /usr/include/c++/10/vector:72, from /build/ataqv-1.2.1+ds/src/cpp/catch.hpp:569, from /build/ataqv-1.2.1+ds/src/cpp/test_metrics.cpp:3: @@ -1528,6 +1590,15 @@ 1338 | _M_fill_insert(begin() + __offset, __n, __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/test_utils.o -c /build/ataqv-1.2.1+ds/src/cpp/test_utils.cpp +In file included from /usr/include/c++/10/vector:72, + from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, + from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, + from /build/ataqv-1.2.1+ds/src/cpp/Features.hpp:12, + from /build/ataqv-1.2.1+ds/src/cpp/Metrics.cpp:18: +/usr/include/c++/10/bits/vector.tcc: In member function ‘nlohmann::json MetricsCollector::to_json()’: +/usr/include/c++/10/bits/vector.tcc:121:21: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 + 121 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); + | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Features.o -c /build/ataqv-1.2.1+ds/src/cpp/Features.cpp g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/HTS.o -c /build/ataqv-1.2.1+ds/src/cpp/HTS.cpp In file included from /usr/include/c++/10/map:60, @@ -1707,7 +1778,6 @@ /usr/include/c++/10/bits/stl_algo.h:1891:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1891 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ -g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Utils.o -c /build/ataqv-1.2.1+ds/src/cpp/Utils.cpp In file included from /usr/include/c++/10/vector:67, from /build/ataqv-1.2.1+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.2.1+ds/src/cpp/HTS.hpp:19, @@ -1735,6 +1805,7 @@ | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 503 | std::tuple<>()); | ~~~~~~~~~~~~~~~ +g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/Utils.o -c /build/ataqv-1.2.1+ds/src/cpp/Utils.cpp In file included from /usr/include/c++/10/bits/stl_algo.h:61, from /usr/include/c++/10/algorithm:62, from /build/ataqv-1.2.1+ds/src/cpp/Peaks.cpp:7: @@ -2017,11 +2088,11 @@ 121 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -fdebug-prefix-map=/build/ataqv-1.2.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.2.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread -make[2]: Leaving directory '/build/ataqv-1.2.1+ds' -make[1]: Leaving directory '/build/ataqv-1.2.1+ds' +make[2]: uscita dalla directory «/build/ataqv-1.2.1+ds» +make[1]: uscita dalla directory «/build/ataqv-1.2.1+ds» dh_auto_test - make -j3 test -make[1]: Entering directory '/build/ataqv-1.2.1+ds' + make -j4 test +make[1]: ingresso nella directory «/build/ataqv-1.2.1+ds» [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 Reading human autosomal references from autosomal_references.gz. Autosomal references for human: @@ -2077,7 +2148,7 @@ chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 -Loaded 24989 TSS in 3.7794 seconds. (6611.9 TSS/second). +Loaded 24989 TSS in 4.59884 seconds. (5433.76 TSS/second). Collecting metrics from test.bam. @@ -2260,7 +2331,7 @@ chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 -Loaded 37276 peaks in 42.5849 seconds. (875.333 peaks/second). +Loaded 37276 peaks in 45.3467 seconds. (822.023 peaks/second). Logging problematic reads to SRR891278.problems. @@ -2441,7 +2512,7 @@ chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 -Loaded 37276 peaks in 48.6036 seconds. (766.939 peaks/second). +Loaded 37276 peaks in 45.7686 seconds. (814.445 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] @@ -2479,12 +2550,12 @@ Added TSS coverage for chr2; thread count=1 Added TSS coverage for chr1; thread count=1 All TSS jobs started. Waiting for last ones to complete. -Calculated TSS coverage in 0.617536 seconds. +Calculated TSS coverage in 0.571089 seconds. Calculating TSS metrics... -Calculated TSS metrics in 0.000817699 seconds. +Calculated TSS metrics in 0.00107236 seconds. Calculating TSS metrics... -Calculated TSS metrics in 0.000802855 seconds. -Analyzed 1040 reads in 0.902525 seconds (1152.32 reads/second). +Calculated TSS metrics in 0.000829482 seconds. +Analyzed 1040 reads in 0.800324 seconds (1299.47 reads/second). ataqv 1.2.1 @@ -2893,7 +2964,7 @@ chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 -Loaded 37276 peaks in 48.048 seconds. (775.810 peaks/second). +Loaded 37276 peaks in 68.390 seconds. (545.049 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] @@ -2902,7 +2973,7 @@ New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH build/$(basename $f); install -m 0755 build/$(basename $f) /build/ataqv-1.2.1+ds/debian/ataqv/usr/bin; done +install -m 0755 build/ataqv /build/ataqv-1.2.1+ds/debian/ataqv/usr/bin install -d -m 0755 /build/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web cp -a src/web/* /build/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web find /build/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web -type d -exec chmod 755 {} \; find /build/ataqv-1.2.1+ds/debian/ataqv/usr/share/ataqv/web -type f -exec chmod 644 {} \; -make[2]: Leaving directory '/build/ataqv-1.2.1+ds' -make[1]: Leaving directory '/build/ataqv-1.2.1+ds' +make[2]: uscita dalla directory «/build/ataqv-1.2.1+ds» +make[1]: uscita dalla directory «/build/ataqv-1.2.1+ds» dh_install dh_installdocs dh_installchangelogs dh_installexamples debian/rules override_dh_installman -make[1]: Entering directory '/build/ataqv-1.2.1+ds' +make[1]: ingresso nella directory «/build/ataqv-1.2.1+ds» help2man --no-info --name="QC metrics for ATAC-seq data" build/ataqv > debian/ataqv.1 help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1 help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.2.1+ds src/scripts/srvarv > debian/srvarv.1 dh_installman -make[1]: Leaving directory '/build/ataqv-1.2.1+ds' +make[1]: uscita dalla directory «/build/ataqv-1.2.1+ds» dh_perl dh_link dh_strip_nondeterminism @@ -3079,14 +3150,14 @@ dh_strip -a dh_makeshlibs -a dh_shlibdeps -a -dpkg-shlibdeps: warning: debian/ataqv/usr/lib/ataqv/run_ataqv_tests contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin dpkg-shlibdeps: warning: debian/ataqv/usr/bin/ataqv contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin +dpkg-shlibdeps: warning: debian/ataqv/usr/lib/ataqv/run_ataqv_tests contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin dh_installdeb dh_gencontrol dh_md5sums dh_builddeb -dpkg-deb: building package 'ataqv' in '../ataqv_1.2.1+ds-1_armhf.deb'. -dpkg-deb: building package 'ataqv-dbgsym' in '../ataqv-dbgsym_1.2.1+ds-1_armhf.deb'. +dpkg-deb: generazione del pacchetto "ataqv" in "../ataqv_1.2.1+ds-1_armhf.deb". +dpkg-deb: generazione del pacchetto "ataqv-dbgsym" in "../ataqv-dbgsym_1.2.1+ds-1_armhf.deb". dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../ataqv_1.2.1+ds-1_armhf.changes dpkg-genchanges: info: binary-only upload (no source code included) @@ -3094,12 +3165,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/15331/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/15331/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/16909 and its subdirectories -I: Current time: Wed Jul 28 20:15:50 -12 2021 -I: pbuilder-time-stamp: 1627546550 +I: removing directory /srv/workspace/pbuilder/15331 and its subdirectories +I: Current time: Thu Jul 29 22:26:33 +14 2021 +I: pbuilder-time-stamp: 1627547193