Diff of the two buildlogs: -- --- b1/build.log 2025-08-26 10:21:26.845636245 +0000 +++ b2/build.log 2025-08-26 10:29:19.262230398 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Mon Sep 28 04:37:04 -12 2026 -I: pbuilder-time-stamp: 1790613424 +I: Current time: Wed Aug 27 00:21:30 +14 2025 +I: pbuilder-time-stamp: 1756203690 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/forky-reproducible-base.tgz] I: copying local configuration @@ -31,53 +31,85 @@ dpkg-source: info: applying popcnt_capability.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/36249/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/D01_modify_environment starting +debug: Running on codethink04-arm64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Aug 26 10:21 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='arm64' - DEBIAN_FRONTEND='noninteractive' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="aarch64-unknown-linux-gnu") + BASH_VERSION='5.2.37(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=arm64 + DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=12 ' - DISTRIBUTION='forky' - HOME='/root' - HOST_ARCH='arm64' + DIRSTACK=() + DISTRIBUTION=forky + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=aarch64 + HOST_ARCH=arm64 IFS=' ' - INVOCATION_ID='178d7efd49254f3ab0a758408ebf947c' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='36249' - PS1='# ' - PS2='> ' + INVOCATION_ID=cd925979808945eeafe790cb541ffcf2 + LANG=C + LANGUAGE=nl_BE:nl + LC_ALL=C + MACHTYPE=aarch64-unknown-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=3024104 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YjGP2FX4/pbuilderrc_I40s --distribution forky --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/forky-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YjGP2FX4/b1 --logfile b1/build.log bowtie_1.3.1-3.dsc' - SUDO_GID='109' - SUDO_HOME='/var/lib/jenkins' - SUDO_UID='104' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://192.168.101.4:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.YjGP2FX4/pbuilderrc_5Ijl --distribution forky --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/forky-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.YjGP2FX4/b2 --logfile b2/build.log bowtie_1.3.1-3.dsc' + SUDO_GID=109 + SUDO_HOME=/var/lib/jenkins + SUDO_UID=104 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://192.168.101.4:3128 I: uname -a - Linux codethink03-arm64 6.12.41+deb13-cloud-arm64 #1 SMP Debian 6.12.41-1 (2025-08-12) aarch64 GNU/Linux + Linux i-capture-the-hostname 6.12.41+deb13-cloud-arm64 #1 SMP Debian 6.12.41-1 (2025-08-12) aarch64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 Aug 10 2025 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/36249/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 Aug 10 12:30 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -185,7 +217,7 @@ Get: 56 http://deb.debian.org/debian forky/main arm64 libtbb-dev arm64 2022.1.0-1 [201 kB] Get: 57 http://deb.debian.org/debian forky/main arm64 libtest-deep-perl all 1.205-1 [52.3 kB] Get: 58 http://deb.debian.org/debian forky/main arm64 zlib1g-dev arm64 1:1.3.dfsg+really1.3.1-1+b1 [917 kB] -Fetched 19.0 MB in 0s (50.8 MB/s) +Fetched 19.0 MB in 0s (150 MB/s) Preconfiguring packages ... Selecting previously unselected package libexpat1:arm64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19969 files and directories currently installed.) @@ -391,8 +423,8 @@ Setting up tzdata (2025b-5) ... Current default time zone: 'Etc/UTC' -Local time is now: Mon Sep 28 16:37:20 UTC 2026. -Universal Time is now: Mon Sep 28 16:37:20 UTC 2026. +Local time is now: Tue Aug 26 10:21:52 UTC 2025. +Universal Time is now: Tue Aug 26 10:21:52 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20240727.1) ... @@ -444,7 +476,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/bowtie-1.3.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../bowtie_1.3.1-3_source.changes +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for forky +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/bowtie-1.3.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../bowtie_1.3.1-3_source.changes dpkg-buildpackage: info: source package bowtie dpkg-buildpackage: info: source version 1.3.1-3 dpkg-buildpackage: info: source distribution unstable @@ -839,10 +875,10 @@ ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -853,15 +889,15 @@ AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 3 -# reads with at least one alignment: 3 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 3 alignments -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +3 +# reads with at least one alignment: 3 (100.00%) seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +# reads that failed to align: 0 (0.00%) +Reported 3 alignments seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: @@ -869,11 +905,11 @@ AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -884,10 +920,10 @@ ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -912,14 +948,14 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -3 -@SQ SN:0 LN:12 -# reads with at least one alignment: 3 (100.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" -%) -# reads that failed to align: 0seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 - (0.00%) +# reads processed: 3 +# reads with at least one alignment: 3 (100.00%) +# reads that failed to align: 0 (0.00%) +@HD VN:1.0 SO:unsorted Reported 3 alignments +@SQ SN:0 LN:12 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" +seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) @@ -931,10 +967,10 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -945,10 +981,10 @@ ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (0.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 @@ -976,8 +1012,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1@HD VN:1.0 SO:unsorted - alignments +Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1004,15 +1040,15 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) +Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -# reads with at least one alignment: 1 (1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 @@ -1020,10 +1056,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 paired-end alignments +Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1037,8 +1073,8 @@ # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) -No alignments @HD VN:1.0 SO:unsorted +No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 @@ -1050,55 +1086,55 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) +Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" -r0 4 * 0 0 * * 0 0 XM:i:0 -1 +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" +r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" -0 +# reads processed: 0 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 0 (0.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) No alignments +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 @@ -1107,9 +1143,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) -# reads that failed to align: 0 (0.00%) +# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted + Reported 2 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1121,26 +1157,26 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +@HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1151,10 +1187,10 @@ AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +@HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1167,14 +1203,14 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" +# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 @@ -1197,9 +1233,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 0 (0.00%) +# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted +%) No alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) @@ -1211,8 +1247,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 alignments -@HD VN:1.0 SO:unsorted +Reported 1@HD VN:1.0 SO:unsorted + alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1222,11 +1258,11 @@ AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 2 +# reads processed: @HD VN:1.0 SO:unsorted +2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1239,9 +1275,9 @@ ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" @@ -1253,14 +1289,14 @@ AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: @SQ SN:0 LN:19 +1 (100.00%) @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" -r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignmentsr0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 + r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: @@ -1268,14 +1304,14 @@ AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 0 (0.00%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +@SQ SN:0 LN:19 +# reads with at least one alignment: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" +0.000 77 * 0 0 * * 0 0 XM:i:0 +%) # reads that failed to align: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" -0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: @@ -1285,10 +1321,10 @@ ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -@HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -1300,8 +1336,8 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads that failed to align: 1 (100.00@HD VN:1.0 SO:unsorted +%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" @@ -1325,29 +1361,29 @@ AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" +# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -2 -@SQ SN:0 LN:19 +# reads processed: 2 # reads with at least one alignment: 2 (100.00%) +# reads that failed to align: @HD VN:1.0 SO:unsorted +0 (0.00%) +Reported 2 alignments +@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" -# reads that failed to align: 0 (0.00%)0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 - -Reported 21 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 - alignments +0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 @@ -1355,15 +1391,15 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted -# reads processed: 1 -# reads with at least one alignment: 1 (100.00@SQ SN:0 LN:19 -%) -# reads that failed to align: 0@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" - (0.00%) -Reported 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted +1@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" +1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 + +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 @@ -1371,13 +1407,13 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -1@SQ SN:0 LN:19 +1 +# reads with at least one alignment: @SQ SN:0 LN:19 +1 (100.00%) +# reads that failed to align: 0@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" + (0.00%) +Reported 1 paired-end alignments0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" -0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: @@ -1385,15 +1421,15 @@ AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1@SQ SN:0 LN:19 - -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" -# reads with at least one alignment: 0 77 * 0 0 * * 0 0 XM:i:0 -0 (0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 -0.00%) -# reads that failed to align: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted +100.00%) No alignments +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" +0 77 * 0 0 * * 0 0 XM:i:0 +0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 @@ -1402,13 +1438,13 @@ ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 @@ -1430,9 +1466,9 @@ ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 -# reads with at least one alignment: 0 (0.00%) -# reads that failed to align: @HD VN:1.0 SO:unsorted -0 (0.00%) +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) +# reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" @@ -1442,14 +1478,14 @@ AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +@HD VN:1.0 SO:unsorted # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments@HD VN:1.0 SO:unsorted - -@SQ SN:0 LN:19 +# reads with at least one alignment: 1 (100.00@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 @@ -1457,10 +1493,10 @@ ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2@HD VN:1.0 SO:unsorted - (100.00%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1473,9 +1509,9 @@ ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" @@ -1488,9 +1524,9 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0@HD VN:1.0 SO:unsorted + (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" @@ -1518,28 +1554,28 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:25 -1 (100.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" -r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 -%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" +r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: 1@SQ SN:0 LN:25 + (100.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments -@SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) @@ -1549,10 +1585,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1563,9 +1599,9 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -1593,14 +1629,14 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -@SQ SN:0 LN:25 -1 -# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: @@ -1609,8 +1645,8 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted + # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -1623,12 +1659,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:25 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 @@ -1639,10 +1675,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1653,15 +1689,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 @@ -1669,10 +1705,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1684,9 +1720,9 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1698,9 +1734,9 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -1713,14 +1749,14 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1@SQ SN:0 LN:25 - -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (100.00%) +# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted +100.00%) No alignments +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: @@ -1729,14 +1765,14 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (@SQ SN:0 LN:25 -0.00%) -# reads that failed to align: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -100.00%) -No alignments +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 +1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 @@ -1744,10 +1780,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 @@ -1759,10 +1795,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 @@ -1774,10 +1810,10 @@ ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1789,8 +1825,8 @@ ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -1804,9 +1840,9 @@ ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1819,10 +1855,10 @@ ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1834,10 +1870,10 @@ ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1850,9 +1886,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1863,12 +1899,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:25 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1878,14 +1914,14 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:25 -# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: @@ -1893,12 +1929,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:25 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1909,10 +1945,10 @@ ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1924,10 +1960,10 @@ ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1939,10 +1975,10 @@ ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1953,13 +1989,13 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:25 -# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) @@ -1969,10 +2005,10 @@ ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1984,9 +2020,9 @@ ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: @HD VN:1.0 SO:unsorted +0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1999,10 +2035,10 @@ ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2028,11 +2064,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 @@ -2043,11 +2079,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2075,10 +2111,10 @@ ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -2105,30 +2141,30 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 @HD VN:1.0 SO:unsorted -# reads with at least one alignment: 1 (100.00@SQ SN:0 LN:16 -%) +@SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" -# reads that failed to align: r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 -0 (0.00%) -Reported 2 alignments +r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 @@ -2136,24 +2172,24 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:24 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" -# reads processed: 1 +1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) @@ -2167,9 +2203,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 -# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" -1 (100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @@ -2179,13 +2215,13 @@ TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:24 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: @@ -2195,10 +2231,10 @@ ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 @@ -2208,14 +2244,14 @@ TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 @@ -2223,28 +2259,28 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 @@ -2266,13 +2302,13 @@ TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:8 -1 (100.00%) -# reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -0 (0.00%) +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:8 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: @@ -2281,28 +2317,28 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 @@ -2310,28 +2346,28 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@SQ SN:0 LN:8 -0.00%) -Reported 1 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 @@ -2339,28 +2375,28 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: @SQ SN:0 LN:8 -0 (0.00%) -Reported 1 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:8 -1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 @@ -2368,12 +2404,12 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -2seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 - +seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +# reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @@ -2383,58 +2419,58 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 3 -# reads with at least one alignment: 3 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +# reads processed: 3 +# reads with at least one alignment: 3 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (@SQ SN:0 LN:19 +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" -100.00%) +seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 @@ -2442,12 +2478,12 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +@HD VN:1.0 SO:unsorted # reads processed: 3 -# reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 3 (100.00@SQ SN:0 LN:12 +%) # reads that failed to align: 0 (0.00%) Reported 3 alignments -@SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2461,10 +2497,10 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) -Reported 1@HD VN:1.0 SO:unsorted - alignments +Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -2474,27 +2510,27 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (100.00%) -No alignments -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 +1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 0 +# reads processed: @HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" +0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 @@ -2534,12 +2570,12 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 @@ -2549,13 +2585,13 @@ AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:19 -# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" -1 (100.00%) +# reads processed: 1@HD VN:1.0 SO:unsorted + +# reads with at least one alignment: 1 (@SQ SN:0 LN:19 +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) @@ -2564,10 +2600,10 @@ AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:19 -0 (0.00%) +# reads processed: 1@HD VN:1.0 SO:unsorted + +# reads with at least one alignment: 0 (@SQ SN:0 LN:19 +0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" @@ -2582,11 +2618,11 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 -# reads with at least one alignment: 1@SQ SN:0 LN:19 - (100.00%) -# reads that failed to align: 0 (0.00%)@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" - +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 alignments +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: @@ -2594,13 +2630,13 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" -1 +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: @@ -2610,22 +2646,22 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 -@SQ SN:0 LN:19 -# reads with at least one alignment: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 +# reads processed: @HD VN:1.0 SO:unsorted +1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2651,14 +2687,14 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:19 -1 (100.00%) -# reads that failed to align: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -0.00%) -Reported r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -1 paired-end alignments +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: @@ -2667,10 +2703,10 @@ ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2681,14 +2717,14 @@ AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:19 -# reads with at least one alignment: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -0.00%) -# reads that failed to align: r0 77 * 0 0 * * 0 0 XM:i:0 -1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: @@ -2697,41 +2733,41 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" -r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) +@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" +r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" -r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) -No alignments +No alignments@HD VN:1.0 SO:unsorted + +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" +r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) +@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) No alignments +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 @@ -2740,9 +2776,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) +@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2752,15 +2788,15 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted +# reads processed: 2 +# reads with at least one alignment: 2 (100.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) +Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 -# reads processed: 2 -# reads with at least one alignment: 2 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 @@ -2770,8 +2806,8 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: @HD VN:1.0 SO:unsorted -0 (0.00%) +# reads that failed to align: 0 (0.00%) +@HD VN:1.0 SO:unsorted Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" @@ -2784,10 +2820,10 @@ ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +Reported @HD VN:1.0 SO:unsorted +1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2799,9 +2835,9 @@ ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) +@HD VN:1.0 SO:unsorted No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" @@ -2815,10 +2851,10 @@ ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 alignments +Reported @HD VN:1.0 SO:unsorted +1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -2830,8 +2866,8 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads that failed to align: 1 (100.00%)@HD VN:1.0 SO:unsorted + No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" @@ -2856,10 +2892,10 @@ ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2869,12 +2905,12 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +@HD VN:1.0 SO:unsorted # reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 2 (100.00@SQ SN:0 LN:19 +%) # reads that failed to align: 0 (0.00%) Reported 2 alignments -@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 @@ -2885,45 +2921,45 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:19 -1 (100.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" -%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted -100.00%) -No alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 +1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Tabbed 7 (fw:1, sam:1) References: >0 @@ -2931,13 +2967,13 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" +r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 -# reads with at least one alignment: @HD VN:1.0 SO:unsorted -1 (100.00%)@SQ SN:0 LN:19 - -# reads that failed to align: 0@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" - (0.00r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 -%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: @@ -2945,24 +2981,24 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - -# reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (100.00%) -No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 +# reads processed: 1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -0@SQ SN:0 LN:19 +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" - +# reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @@ -2972,28 +3008,28 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -2 +@HD VN:1.0 SO:unsorted +# reads processed: 2 # reads with at least one alignment: 2@SQ SN:0 LN:19 - (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments -r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 + (100.00%) +# reads that failed to align: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" +0.00%) +Reported 2r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 + alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: @@ -3002,42 +3038,42 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 -1 +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @@ -3048,15 +3084,15 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 @@ -3078,12 +3114,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 -# reads processed: 1 +1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @@ -3093,43 +3129,43 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 -# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:25 -1@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" - (r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -100.00r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 -%) +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) @@ -3138,30 +3174,30 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 @@ -3183,28 +3219,28 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:25 -1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -# reads that failed to align: 0 (0.00%)r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 - -Reported 1r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 - paired-end alignments +r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted # reads processed: 1 -# reads with at least one alignment: 1 (100.00@SQ SN:0 LN:25 -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" - +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) @@ -3213,12 +3249,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @@ -3228,28 +3264,28 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (@SQ SN:0 LN:25 +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 -0.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) @@ -3258,28 +3294,28 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted -# reads processed: 1 -# reads with at least one alignment: 0 (0.00@SQ SN:0 LN:25 -%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +@SQ SN:0 LN:25 +# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +0r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 + (r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 +0.00%) # reads that failed to align: 1 (100.00%) No alignments -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 -r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +# reads with at least one alignment: 0 (0.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 -# reads processed: 1 -# reads with at least one alignment: 0 (0.00%) +%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) @@ -3288,13 +3324,13 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted # reads processed: 1 -# reads with at least one alignment: 0 (0.00@SQ SN:0 LN:25 -%) -# reads that failed to align: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -100.00%) +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) @@ -3304,10 +3340,10 @@ ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3318,13 +3354,13 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1@SQ SN:0 LN:25 - -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) @@ -3333,15 +3369,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 -# reads with at least one alignment: 1 (100.00%)@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" - -# reads that failed to align: 0 (0.00%)r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 - -Reported 1r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 - paired-end alignments +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 @@ -3363,15 +3399,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted + +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 @@ -3528,12 +3564,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:25 -1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3543,60 +3579,60 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: @SQ SN:0 LN:25 -1@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" - (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 @@ -3604,30 +3640,30 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - -# reads with at least one alignment: 1 (@SQ SN:0 LN:16 -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 @@ -3635,30 +3671,30 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 -# reads with at least one alignment: 1 (100.00%)@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" - -# reads that failed to align: 0 (0.00r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 -%) -Reported 2 alignmentsr0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 - +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 @@ -3666,28 +3702,28 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: 1 (@SQ SN:0 LN:24 +100.00%) +# reads that failed to align: 0 (0.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: @SQ SN:0 LN:24 +1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 @@ -3696,13 +3732,13 @@ ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -@HD VN:1.0 SO:unsorted -# reads with at least one alignment: 1 (100.00%)@SQ SN:0 LN:24 - -# reads that failed to align: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" -0.00%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:24 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 @@ -3710,11 +3746,11 @@ ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1@SQ SN:0 LN:24 + (100.00%) # reads that failed to align: 0 (0.00%) +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) @@ -3727,8 +3763,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 alignments @HD VN:1.0 SO:unsorted +Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 @@ -3738,14 +3774,14 @@ TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 @@ -3753,13 +3789,13 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:8 -# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -1 (100.00%) -# reads that failed to align: 0 (0.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) Reported 1 alignments +@SQ SN:0 LN:8 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: @@ -3767,12 +3803,12 @@ TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -@SQ SN:0 LN:8 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) @@ -3783,13 +3819,13 @@ ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -1 @SQ SN:0 LN:8 -# reads with at least one alignment: 1 (100.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -%) +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 @@ -3797,13 +3833,13 @@ ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -1@SQ SN:0 LN:8 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 - +1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@SQ SN:0 LN:8 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 @@ -3811,12 +3847,12 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00@SQ SN:0 LN:8 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) @@ -3825,11 +3861,11 @@ TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -3840,28 +3876,28 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:8 # reads processed: 1 -# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -100.00r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:8 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:8 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@SQ SN:0 LN:8 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 @@ -3869,12 +3905,12 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1@SQ SN:0 LN:8 - +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) @@ -3883,12 +3919,12 @@ ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1@SQ SN:0 LN:8 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted -# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 PASSED @@ -4005,8 +4041,8 @@ dh_gencontrol dh_md5sums dh_builddeb -dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.1-3_arm64.deb'. dpkg-deb: building package 'bowtie' in '../bowtie_1.3.1-3_arm64.deb'. +dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.1-3_arm64.deb'. dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.1-3_all.deb'. dpkg-genbuildinfo --build=binary -O../bowtie_1.3.1-3_arm64.buildinfo dpkg-genchanges --build=binary -O../bowtie_1.3.1-3_arm64.changes @@ -4015,12 +4051,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/3024104/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/36249 and its subdirectories -I: Current time: Mon Sep 28 04:44:11 -12 2026 -I: pbuilder-time-stamp: 1790613851 +I: removing directory /srv/workspace/pbuilder/3024104 and its subdirectories +I: Current time: Wed Aug 27 00:29:17 +14 2025 +I: pbuilder-time-stamp: 1756204157