Diff of the two buildlogs: -- --- b1/build.log 2025-03-02 18:14:01.446184434 +0000 +++ b2/build.log 2025-03-02 18:30:37.888979901 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Sat Apr 4 12:29:40 -12 2026 -I: pbuilder-time-stamp: 1775348980 +I: Current time: Mon Mar 3 08:14:04 +14 2025 +I: pbuilder-time-stamp: 1740939244 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration @@ -31,52 +31,84 @@ dpkg-source: info: applying popcnt_capability.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/2277368/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/D01_modify_environment starting +debug: Running on ionos11-amd64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Mar 2 18:14 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='amd64' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=42 ' - DISTRIBUTION='trixie' - HOME='/root' - HOST_ARCH='amd64' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu") + BASH_VERSION='5.2.37(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=amd64 + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=20 ' + DIRSTACK=() + DISTRIBUTION=trixie + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=x86_64 + HOST_ARCH=amd64 IFS=' ' - INVOCATION_ID='56e87ff922f24dff9fad75b2482b17f4' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='2277368' - PS1='# ' - PS2='> ' + INVOCATION_ID=3500219e62704efba50414a3c60ce1eb + LANG=C + LANGUAGE=et_EE:et + LC_ALL=C + MACHTYPE=x86_64-pc-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=4004970 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.jeV1YUeE/pbuilderrc_1iF0 --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.jeV1YUeE/b1 --logfile b1/build.log bowtie_1.3.1-3.dsc' - SUDO_GID='111' - SUDO_UID='106' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://213.165.73.152:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.jeV1YUeE/pbuilderrc_bx4h --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.jeV1YUeE/b2 --logfile b2/build.log bowtie_1.3.1-3.dsc' + SUDO_GID=111 + SUDO_UID=106 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://46.16.76.132:3128 I: uname -a - Linux ionos15-amd64 6.12.9+bpo-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.12.9-1~bpo12+1 (2025-01-19) x86_64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-31-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.128-1 (2025-02-07) x86_64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 Nov 22 2024 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/2277368/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 Nov 22 14:40 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -185,7 +217,7 @@ Get: 57 http://deb.debian.org/debian trixie/main amd64 libtbb-dev amd64 2022.0.0-2 [199 kB] Get: 58 http://deb.debian.org/debian trixie/main amd64 libtest-deep-perl all 1.204-1 [52.9 kB] Get: 59 http://deb.debian.org/debian trixie/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-1+b1 [920 kB] -Fetched 28.9 MB in 3s (8680 kB/s) +Fetched 28.9 MB in 0s (61.5 MB/s) Preconfiguring packages ... Selecting previously unselected package liblocale-gettext-perl. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19802 files and directories currently installed.) @@ -394,8 +426,8 @@ Setting up tzdata (2025a-2) ... Current default time zone: 'Etc/UTC' -Local time is now: Sun Apr 5 00:30:36 UTC 2026. -Universal Time is now: Sun Apr 5 00:30:36 UTC 2026. +Local time is now: Sun Mar 2 18:14:39 UTC 2025. +Universal Time is now: Sun Mar 2 18:14:39 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20220109.1) ... @@ -448,7 +480,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/bowtie-1.3.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../bowtie_1.3.1-3_source.changes +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for trixie +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/bowtie-1.3.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../bowtie_1.3.1-3_source.changes dpkg-buildpackage: info: source package bowtie dpkg-buildpackage: info: source version 1.3.1-3 dpkg-buildpackage: info: source distribution unstable @@ -463,7 +499,7 @@ rm -f .simple* rm -rf __pycache__ dh_auto_clean - make -j42 clean + make -j20 clean make[2]: Entering directory '/build/reproducible-path/bowtie-1.3.1' rm -f bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-build-s-debug bowtie-build-l-debug bowtie-align-s-debug bowtie-align-l-debug bowtie-inspect-s-debug bowtie-inspect-l-debug \ bowtie_prof \ @@ -896,9 +932,9 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -2 +# reads processed: 2 # reads with at least one alignment: 2 (100.00%) +@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @@ -911,9 +947,9 @@ AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -3 -# reads with at least one alignment: 3 (100.00%) +# reads processed: 3 +# reads with at least one alignment: 3 (100.00%)@HD VN:1.0 SO:unsorted + # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:19 @@ -927,13 +963,13 @@ AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (@SQ SN:0 LN:19 -100.00%) -# reads that failed to align: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" -0.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: @@ -942,8 +978,8 @@ ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @@ -956,9 +992,9 @@ ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: @HD VN:1.0 SO:unsorted +0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" @@ -988,40 +1024,40 @@ ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: @HD VN:1.0 SO:unsorted -0 (0.00%) -Reported 1 alignments +# reads processed: 1@HD VN:1.0 SO:unsorted + @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) -# reads that failed to align: 1 (100.00%) -No alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 0 -# reads with at least one alignment: 0 (0.00%) +# reads processed: @HD VN:1.0 SO:unsorted +0 +# reads with at least one alignment: 0 (0.00@SQ SN:0 LN:19 +%) # reads that failed to align: 0 (0.00%) No alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: @@ -1031,14 +1067,14 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" -0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +# reads with at least one alignment: 1 (100.00%)@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" + +# reads that failed to align: 0 (0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +0.00%) +Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 @@ -1048,13 +1084,13 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 -# reads with at least one alignment: 2 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments -@SQ SN:0 LN:19 +# reads with at least one alignment: @SQ SN:0 LN:19 +2 (100.00%) @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 -1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 +# reads that failed to align: 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 +0 (0.00%) +Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 @@ -1063,25 +1099,25 @@ ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1108,11 +1144,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -1122,12 +1158,12 @@ AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (0.00@SQ SN:0 LN:19 -%) +# reads processed: 1 +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) @@ -1149,9 +1185,9 @@ AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @@ -1163,11 +1199,11 @@ AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -2 +# reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1179,11 +1215,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1194,11 +1230,11 @@ AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1209,11 +1245,11 @@ AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 @@ -1225,11 +1261,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -1239,11 +1275,11 @@ AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 @@ -1253,11 +1289,11 @@ AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -0 +# reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) @@ -1266,11 +1302,11 @@ AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1280,11 +1316,11 @@ AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -2 +# reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1296,11 +1332,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 @@ -1312,11 +1348,11 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (@SQ SN:0 LN:19 -0.00%) +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 @@ -1326,11 +1362,11 @@ AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 @@ -1342,9 +1378,9 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @@ -1356,11 +1392,11 @@ AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 @@ -1370,9 +1406,9 @@ AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -0 -# reads with at least one alignment: 0 (0.00%) +# reads processed: 0 +# reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @@ -1385,12 +1421,12 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments @SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" +# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 @@ -1399,13 +1435,13 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 -# reads with at least one alignment: 2 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments -@SQ SN:0 LN:19 +# reads with at least one alignment: 2 (100.00%)@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 + 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 @@ -1413,30 +1449,30 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" -1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" +11 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 + (1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 paired-end alignments -@SQ SN:0 LN:19 +# reads processed: @HD VN:1.0 SO:unsorted +1@SQ SN:0 LN:19 + @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads with at least one alignment: 10 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 + (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 @@ -1444,10 +1480,10 @@ ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (0.00%) +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 @@ -1459,23 +1495,23 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (0.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @@ -1487,9 +1523,9 @@ AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -0 -# reads with at least one alignment: 0 (0.00%) +# reads processed: 0 +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @@ -1500,10 +1536,10 @@ AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) +# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" @@ -1515,8 +1551,8 @@ ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 2 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @@ -1531,10 +1567,10 @@ ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1545,12 +1581,12 @@ AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%)@SQ SN:0 LN:19 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted -# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 @@ -1560,9 +1596,9 @@ AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - -# reads with at least one alignment: 0 (0.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @@ -1576,26 +1612,26 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1606,14 +1642,14 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted +1@SQ SN:0 LN:25 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -# reads with at least one alignment: 1 (@SQ SN:0 LN:25 +# reads with at least one alignment: 1 (r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: @@ -1622,9 +1658,9 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1637,9 +1673,9 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1651,12 +1687,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 +# reads processed: @HD VN:1.0 SO:unsorted +1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted +# reads that failed to align: 0 (@SQ SN:0 LN:25 0.00%) Reported 1 paired-end alignments -@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 @@ -1666,11 +1702,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1681,12 +1717,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - -# reads with at least one alignment: 1 (@SQ SN:0 LN:25 -100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 @@ -1696,15 +1732,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments -@SQ SN:0 LN:25 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) +# reads that failed to align: 0 (0.00%)@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 + +Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 @@ -1712,9 +1748,9 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1744,8 +1780,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -@HD VN:1.0 SO:unsorted Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1758,9 +1794,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1787,8 +1823,8 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (0.00%) -@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @@ -1803,8 +1839,8 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads that failed to align: 1 (100.00%) +@HD VN:1.0 SO:unsorted No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1816,12 +1852,12 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1@HD VN:1.0 SO:unsorted + # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) -No alignments -@SQ SN:0 LN:25 +No alignments@SQ SN:0 LN:25 + @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 @@ -1831,10 +1867,10 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) +# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted +%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1847,8 +1883,8 @@ ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -@HD VN:1.0 SO:unsorted -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -1863,9 +1899,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1876,14 +1912,14 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) -Reported 1 paired-end alignments -@SQ SN:0 LN:25 +# reads processed: 1@HD VN:1.0 SO:unsorted + +# reads with at least one alignment: 1 (@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: @@ -1907,10 +1943,10 @@ ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1921,11 +1957,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1938,8 +1974,8 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted + Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1951,11 +1987,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1966,10 +2002,10 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 +# reads processed: @HD VN:1.0 SO:unsorted +1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -1982,10 +2018,10 @@ ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1997,10 +2033,10 @@ ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2012,10 +2048,10 @@ ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2026,11 +2062,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2041,11 +2077,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2058,9 +2094,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2071,11 +2107,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2086,11 +2122,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 @@ -2117,9 +2153,9 @@ ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -2132,11 +2168,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -2149,9 +2185,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted -%) +# reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -2163,11 +2199,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -2180,9 +2216,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -2194,9 +2230,9 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @@ -2208,9 +2244,9 @@ TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @@ -2223,12 +2259,12 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) @@ -2237,12 +2273,12 @@ TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1@HD VN:1.0 SO:unsorted - +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) @@ -2252,11 +2288,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 @@ -2266,14 +2302,14 @@ TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted +1@SQ SN:0 LN:8 + +# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@SQ SN:0 LN:8 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 @@ -2281,11 +2317,11 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 @@ -2296,10 +2332,10 @@ ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 @@ -2310,9 +2346,9 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @@ -2353,11 +2389,11 @@ TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 alignments +Reported 1 alignments@HD VN:1.0 SO:unsorted + @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -2369,9 +2405,9 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: @HD VN:1.0 SO:unsorted -0 (0.00%) +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) +# reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" @@ -2383,10 +2419,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -2397,9 +2433,9 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) +@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @@ -2413,9 +2449,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -2427,10 +2463,10 @@ ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (100.00%) +# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2442,8 +2478,8 @@ ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 -# reads with at least one alignment: 3 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:19 @@ -2457,11 +2493,11 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2471,11 +2507,11 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2485,9 +2521,9 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @@ -2501,9 +2537,9 @@ ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 -# reads with at least one alignment: 3 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted +100.00%) +# reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" @@ -2518,12 +2554,12 @@ ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 alignments @SQ SN:0 LN:19 +Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) @@ -2532,9 +2568,9 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (0.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @@ -2546,13 +2582,13 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 0 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted +0@SQ SN:0 LN:19 + +# reads with at least one alignment: 0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 @@ -2563,12 +2599,12 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: @SQ SN:0 LN:19 +1@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" + (0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" -0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 @@ -2577,13 +2613,13 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -2 -# reads with at least one alignment: 2 (100.00%) +2@SQ SN:0 LN:19 + +# reads with at least one alignment: 2 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" +0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" -0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: @@ -2593,10 +2629,10 @@ ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2607,15 +2643,15 @@ AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: @SQ SN:0 LN:19 -0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" -0.000 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 -%) -Reported 1 paired-end alignments0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 - +# reads processed: 1 +# reads with at least one alignment: @HD VN:1.0 SO:unsorted +1 (@SQ SN:0 LN:19 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" +0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments +0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 @@ -2624,13 +2660,13 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 -# reads with at least one alignment: 0 (0.00%) +@SQ SN:0 LN:19 +# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" +00 77 * 0 0 * * 0 0 XM:i:0 + (0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 +0.00%) # reads that failed to align: 1 (100.00%) No alignments -@SQ SN:0 LN:19 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" -0 77 * 0 0 * * 0 0 XM:i:0 -0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 @@ -2638,11 +2674,11 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -2652,9 +2688,9 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (0.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @@ -2667,8 +2703,8 @@ ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @@ -2679,9 +2715,9 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @@ -2694,14 +2730,14 @@ ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -2 -# reads with at least one alignment: 2 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 +2 +# reads with at least one alignment: 2 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 @@ -2710,8 +2746,8 @@ ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @@ -2724,11 +2760,11 @@ AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2741,8 +2777,8 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1@HD VN:1.0 SO:unsorted - (100.00%) +@HD VN:1.0 SO:unsorted +# reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -2756,10 +2792,10 @@ ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -2769,24 +2805,24 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) -# reads that failed to align: 1 (100.00%) -No alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 +1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 0 +# reads processed: @HD VN:1.0 SO:unsorted +0 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" @@ -2826,15 +2862,15 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted -%) -Reported 1 paired-end alignments -@SQ SN:0 LN:19 +# reads processed: @HD VN:1.0 SO:unsorted +1@SQ SN:0 LN:19 + @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" -r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 -r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads with at least one alignment: r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 +1 (r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 @@ -2872,12 +2908,12 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 +# reads processed: @HD VN:1.0 SO:unsorted +1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) +# reads that failed to align: 0 (0.00@SQ SN:0 LN:19 +%) Reported 1 alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) @@ -2914,10 +2950,10 @@ ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 alignments +Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2929,9 +2965,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2945,9 +2981,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2960,9 +2996,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2975,9 +3011,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 @@ -2990,10 +3026,10 @@ ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -3004,10 +3040,10 @@ ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 @@ -3019,9 +3055,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: @HD VN:1.0 SO:unsorted -0 (0.00%) +# reads that failed to align: 0 (0.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) @@ -3033,8 +3069,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1@HD VN:1.0 SO:unsorted - alignments +Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -3045,10 +3081,10 @@ ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -3061,10 +3097,10 @@ ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -3076,10 +3112,10 @@ ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -3092,9 +3128,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 @@ -3106,15 +3142,15 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" -r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" +1r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 + (r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 @@ -3122,10 +3158,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3137,10 +3173,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3152,10 +3188,10 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3168,9 +3204,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted -%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3181,11 +3217,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3197,10 +3233,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3212,8 +3248,8 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -3226,11 +3262,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3242,10 +3278,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3257,9 +3293,9 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -3272,9 +3308,9 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" @@ -3287,10 +3323,10 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3302,10 +3338,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (0.00%) +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) -No alignments@HD VN:1.0 SO:unsorted - +No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 @@ -3316,9 +3352,9 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (0.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @@ -3331,9 +3367,9 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 0 (0.00%) +# reads processed: 1 +# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted +0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @@ -3346,11 +3382,11 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 +# reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 @@ -3362,8 +3398,8 @@ ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -3378,9 +3414,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3391,9 +3427,9 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: 1 +# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted +%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -3406,15 +3442,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted +@HD VN:1.0 SO:unsorted +# reads processed: @SQ SN:0 LN:25 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +1 (r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +100.00r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments -@SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 @@ -3422,14 +3458,14 @@ ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 @@ -3439,21 +3475,21 @@ # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@SQ SN:0 LN:25 - (0.00%) -Reported 1 paired-end alignments -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads that failed to align: @SQ SN:0 LN:25 +0 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +0.00r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +%) r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -3466,45 +3502,45 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted -%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1@HD VN:1.0 SO:unsorted - paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads with at least one alignment: 1 (100.00r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +%) +# reads that failed to align: r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +0 (0.00%) +Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 @@ -3513,9 +3549,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3529,8 +3565,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1@HD VN:1.0 SO:unsorted - paired-end alignments +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3543,9 +3579,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3556,13 +3592,13 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted -%) -Reported 1 paired-end alignments -@SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: 1 (@SQ SN:0 LN:25 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" + paired-end alignments r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) @@ -3572,44 +3608,44 @@ ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted -%) -Reported 1 paired-end alignments -@SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted + +# reads that failed to align: 0 (@SQ SN:0 LN:25 +0.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +%)r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 + +Reported 1r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 + paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -@HD VN:1.0 SO:unsorted -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 @@ -3619,8 +3655,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1@HD VN:1.0 SO:unsorted - paired-end alignments +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 @@ -3631,30 +3667,30 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" -r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 +# reads with at least one alignment: 1 (100.00%)@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" + +# reads that failed to align: 0 (r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +0.00%) +Reported 1r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 + paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 @@ -3662,15 +3698,15 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +# reads with at least one alignment: 1@SQ SN:0 LN:16 + (100.00@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +%) +# reads that failed to align: r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 +0 (0.00%)r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 + Reported 2 alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:16 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 -r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 @@ -3678,8 +3714,8 @@ ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @@ -3694,10 +3730,10 @@ ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -3708,14 +3744,14 @@ TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +# reads processed: 1@HD VN:1.0 SO:unsorted + +# reads with at least one alignment: 1 (@SQ SN:0 LN:16 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments -@SQ SN:0 LN:16 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: @@ -3725,11 +3761,11 @@ ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) @@ -3738,14 +3774,14 @@ TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 +# reads processed: @HD VN:1.0 SO:unsorted +@SQ SN:0 LN:24 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 @@ -3753,28 +3789,28 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads processed: @HD VN:1.0 SO:unsorted +1 +@SQ SN:0 LN:24 +# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 +# reads processed: @HD VN:1.0 SO:unsorted +@SQ SN:0 LN:24 +@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" +1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -# reads with alignments suppressed due to -m: @HD VN:1.0 SO:unsorted -1 (100.00%) +# reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 @@ -3841,10 +3877,10 @@ ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -3854,14 +3890,14 @@ TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted +1@SQ SN:0 LN:8 + +# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@SQ SN:0 LN:8 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 @@ -3869,14 +3905,14 @@ ./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +# reads processed: 1@HD VN:1.0 SO:unsorted + +# reads with at least one alignment: 1@SQ SN:0 LN:8 + (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@SQ SN:0 LN:8 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" -r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 @@ -3885,9 +3921,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -3899,10 +3935,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -3912,13 +3948,13 @@ ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 alignments +# reads processed: @HD VN:1.0 SO:unsorted +1 @SQ SN:0 LN:8 -@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: @@ -3928,27 +3964,27 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 alignments -@SQ SN:0 LN:8 +Reported @HD VN:1.0 SO:unsorted +1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 + alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments PASSED make[2]: Leaving directory '/build/reproducible-path/bowtie-1.3.1' ln -s debian/tests @@ -4007,7 +4043,7 @@ find . -name .cvsignore -delete make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1' dh_auto_install -Nbowtie - make -j42 install DESTDIR=/build/reproducible-path/bowtie-1.3.1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" + make -j20 install DESTDIR=/build/reproducible-path/bowtie-1.3.1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1' mkdir -p /build/reproducible-path/bowtie-1.3.1/debian/tmp/usr/local/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ @@ -4059,9 +4095,9 @@ dh_gencontrol dh_md5sums dh_builddeb -dpkg-deb: building package 'bowtie' in '../bowtie_1.3.1-3_amd64.deb'. dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.1-3_amd64.deb'. dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.1-3_all.deb'. +dpkg-deb: building package 'bowtie' in '../bowtie_1.3.1-3_amd64.deb'. dpkg-genbuildinfo --build=binary -O../bowtie_1.3.1-3_amd64.buildinfo dpkg-genchanges --build=binary -O../bowtie_1.3.1-3_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) @@ -4069,12 +4105,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/4004970/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/2277368 and its subdirectories -I: Current time: Sat Apr 4 12:36:59 -12 2026 -I: pbuilder-time-stamp: 1775349419 +I: removing directory /srv/workspace/pbuilder/4004970 and its subdirectories +I: Current time: Mon Mar 3 08:30:37 +14 2025 +I: pbuilder-time-stamp: 1740940237