Diff of the two buildlogs: -- --- b1/build.log 2025-03-05 06:15:22.627749839 +0000 +++ b2/build.log 2025-03-05 06:19:11.929360221 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Tue Mar 4 18:13:17 -12 2025 -I: pbuilder-time-stamp: 1741155197 +I: Current time: Wed Apr 8 02:38:25 +14 2026 +I: pbuilder-time-stamp: 1775565505 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration @@ -24,52 +24,84 @@ dpkg-source: info: applying python3.12-syntax.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/2109715/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/D01_modify_environment starting +debug: Running on codethink03-arm64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Apr 7 12:38 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build/reproducible-path' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='arm64' - DEBIAN_FRONTEND='noninteractive' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="aarch64-unknown-linux-gnu") + BASH_VERSION='5.2.37(1)-release' + BUILDDIR=/build/reproducible-path + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=arm64 + DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=12 ' - DISTRIBUTION='trixie' - HOME='/root' - HOST_ARCH='arm64' + DIRSTACK=() + DISTRIBUTION=trixie + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=aarch64 + HOST_ARCH=arm64 IFS=' ' - INVOCATION_ID='d54792ab7dc54354be5cc6c8f793dba4' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='2109715' - PS1='# ' - PS2='> ' + INVOCATION_ID=b138d9379ba444c08988466dcc68ea0d + LANG=C + LANGUAGE=nl_BE:nl + LC_ALL=C + MACHTYPE=aarch64-unknown-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=1278174 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.OzdgfGTy/pbuilderrc_OWcq --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.OzdgfGTy/b1 --logfile b1/build.log presto_0.7.2-2.dsc' - SUDO_GID='109' - SUDO_UID='104' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://192.168.101.4:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.OzdgfGTy/pbuilderrc_C021 --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.OzdgfGTy/b2 --logfile b2/build.log presto_0.7.2-2.dsc' + SUDO_GID=109 + SUDO_UID=104 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://192.168.101.4:3128 I: uname -a - Linux codethink04-arm64 6.1.0-31-cloud-arm64 #1 SMP Debian 6.1.128-1 (2025-02-07) aarch64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-31-cloud-arm64 #1 SMP Debian 6.1.128-1 (2025-02-07) aarch64 GNU/Linux I: ls -l /bin - lrwxrwxrwx 1 root root 7 Nov 22 14:40 /bin -> usr/bin -I: user script /srv/workspace/pbuilder/2109715/tmp/hooks/D02_print_environment finished + lrwxrwxrwx 1 root root 7 Nov 22 2024 /bin -> usr/bin +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -246,7 +278,7 @@ Get: 121 http://deb.debian.org/debian trixie/main arm64 python3-pandas all 2.2.3+dfsg-8 [3097 kB] Get: 122 http://deb.debian.org/debian trixie/main arm64 python3-scipy arm64 1.14.1-4+b1 [15.8 MB] Get: 123 http://deb.debian.org/debian trixie/main arm64 vsearch arm64 2.29.4-1 [411 kB] -Fetched 82.3 MB in 0s (221 MB/s) +Fetched 82.3 MB in 1s (97.3 MB/s) Preconfiguring packages ... Selecting previously unselected package libpython3.13-minimal:arm64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19916 files and directories currently installed.) @@ -661,8 +693,8 @@ Setting up tzdata (2025a-2) ... Current default time zone: 'Etc/UTC' -Local time is now: Wed Mar 5 06:13:43 UTC 2025. -Universal Time is now: Wed Mar 5 06:13:43 UTC 2025. +Local time is now: Tue Apr 7 12:39:29 UTC 2026. +Universal Time is now: Tue Apr 7 12:39:29 UTC 2026. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libfontenc1:arm64 (1:1.1.8-1+b2) ... @@ -771,7 +803,11 @@ Building tag database... -> Finished parsing the build-deps I: Building the package -I: Running cd /build/reproducible-path/presto-0.7.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../presto_0.7.2-2_source.changes +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/A99_set_merged_usr starting +Not re-configuring usrmerge for trixie +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/reproducible-path/presto-0.7.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../presto_0.7.2-2_source.changes dpkg-buildpackage: info: source package presto dpkg-buildpackage: info: source version 0.7.2-2 dpkg-buildpackage: info: source distribution unstable @@ -940,7 +976,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runCDHit() 0.023 +<- test_runCDHit() 0.046 -> test_runUClust() FULL_LENGTH> {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} @@ -948,7 +984,7 @@ {1: ['SEQ1', 'SEQ2', 'SEQ3'], 2: ['SEQ4', 'SEQ5']} ZERO_LENGTH> None -<- test_runUClust() 0.037 +<- test_runUClust() 0.077 -> test_checkSeqEqual() DNA Equality> SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA @@ -1015,9 +1051,9 @@ OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) <- test_convertSRAHeader() 0.000 -> test_calculateDistances() -<- test_calculateDistances() 0.002 +<- test_calculateDistances() 0.001 -> test_countMismatches() -<- test_countMismatches() 0.002 +<- test_countMismatches() 0.001 -> test_initializeMismatchDictionary() <- test_initializeMismatchDictionary() 0.000 -> test_getFileType() @@ -1274,7 +1310,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_localAlignment() 0.038 +<- test_localAlignment() 0.056 -> test_maskSeq() TEST CUT> ID> SEQ|PRIMER=A|BARCODE=CCA @@ -1364,7 +1400,7 @@ GAPS> 0 ERROR> 1.000000 -<- test_scoreAlignment() 0.009 +<- test_scoreAlignment() 0.019 -> test_calculateSetError() REF> CGGCGTAA 0.4347826086956522 REF> NNNNNNNN 1.0 @@ -1567,7 +1603,7 @@ test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok ---------------------------------------------------------------------- -Ran 40 tests in 0.127s +Ran 40 tests in 0.236s OK (skipped=6) @@ -2127,8 +2163,8 @@ dh_gencontrol -O--buildsystem=pybuild dh_md5sums -O--buildsystem=pybuild dh_builddeb -O--buildsystem=pybuild -dpkg-deb: building package 'python3-presto' in '../python3-presto_0.7.2-2_arm64.deb'. dpkg-deb: building package 'presto' in '../presto_0.7.2-2_all.deb'. +dpkg-deb: building package 'python3-presto' in '../python3-presto_0.7.2-2_arm64.deb'. dpkg-genbuildinfo --build=binary -O../presto_0.7.2-2_arm64.buildinfo dpkg-genchanges --build=binary -O../presto_0.7.2-2_arm64.changes dpkg-genchanges: info: binary-only upload (no source code included) @@ -2137,12 +2173,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/1278174/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/2109715 and its subdirectories -I: Current time: Tue Mar 4 18:15:21 -12 2025 -I: pbuilder-time-stamp: 1741155321 +I: removing directory /srv/workspace/pbuilder/1278174 and its subdirectories +I: Current time: Wed Apr 8 02:42:09 +14 2026 +I: pbuilder-time-stamp: 1775565729