Diff of the two buildlogs: -- --- b1/build.log 2023-05-21 00:07:53.778657641 +0000 +++ b2/build.log 2023-05-21 00:51:19.856384019 +0000 @@ -1,6 +1,6 @@ I: pbuilder: network access will be disabled during build -I: Current time: Sat May 20 11:56:40 -12 2023 -I: pbuilder-time-stamp: 1684627000 +I: Current time: Sat Jun 22 20:31:06 +14 2024 +I: pbuilder-time-stamp: 1719037866 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bookworm-reproducible-base.tgz] I: copying local configuration @@ -16,7 +16,7 @@ I: copying [./bowtie_1.3.1.orig.tar.gz] I: copying [./bowtie_1.3.1-1.debian.tar.xz] I: Extracting source -gpgv: Signature made Tue Sep 21 17:01:26 2021 -12 +gpgv: Signature made Wed Sep 22 19:01:26 2021 +14 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key @@ -35,135 +35,167 @@ dpkg-source: info: applying popcnt_capability.patch I: Not using root during the build. I: Installing the build-deps -I: user script /srv/workspace/pbuilder/2759864/tmp/hooks/D02_print_environment starting +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/D01_modify_environment starting +debug: Running on ionos15-amd64. +I: Changing host+domainname to test build reproducibility +I: Adding a custom variable just for the fun of it... +I: Changing /bin/sh to bash +'/bin/sh' -> '/bin/bash' +lrwxrwxrwx 1 root root 9 Jun 22 20:31 /bin/sh -> /bin/bash +I: Setting pbuilder2's login shell to /bin/bash +I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/D01_modify_environment finished +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/D02_print_environment starting I: set - BUILDDIR='/build' - BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' - BUILDUSERNAME='pbuilder1' - BUILD_ARCH='amd64' - DEBIAN_FRONTEND='noninteractive' - DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=15 ' - DISTRIBUTION='bookworm' - HOME='/root' - HOST_ARCH='amd64' + BASH=/bin/sh + BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath + BASH_ALIASES=() + BASH_ARGC=() + BASH_ARGV=() + BASH_CMDS=() + BASH_LINENO=([0]="12" [1]="0") + BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. + BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") + BASH_VERSINFO=([0]="5" [1]="2" [2]="15" [3]="1" [4]="release" [5]="x86_64-pc-linux-gnu") + BASH_VERSION='5.2.15(1)-release' + BUILDDIR=/build + BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' + BUILDUSERNAME=pbuilder2 + BUILD_ARCH=amd64 + DEBIAN_FRONTEND=noninteractive + DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=16 ' + DIRSTACK=() + DISTRIBUTION=bookworm + EUID=0 + FUNCNAME=([0]="Echo" [1]="main") + GROUPS=() + HOME=/root + HOSTNAME=i-capture-the-hostname + HOSTTYPE=x86_64 + HOST_ARCH=amd64 IFS=' ' - INVOCATION_ID='cec1c516c92340cd8e8d684b1aa10b36' - LANG='C' - LANGUAGE='en_US:en' - LC_ALL='C' - MAIL='/var/mail/root' - OPTIND='1' - PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' - PBCURRENTCOMMANDLINEOPERATION='build' - PBUILDER_OPERATION='build' - PBUILDER_PKGDATADIR='/usr/share/pbuilder' - PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' - PBUILDER_SYSCONFDIR='/etc' - PPID='2759864' - PS1='# ' - PS2='> ' + INVOCATION_ID=204c2f9e2e794ac8a41e5b61c16ad9f0 + LANG=C + LANGUAGE=et_EE:et + LC_ALL=C + MACHTYPE=x86_64-pc-linux-gnu + MAIL=/var/mail/root + OPTERR=1 + OPTIND=1 + OSTYPE=linux-gnu + PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path + PBCURRENTCOMMANDLINEOPERATION=build + PBUILDER_OPERATION=build + PBUILDER_PKGDATADIR=/usr/share/pbuilder + PBUILDER_PKGLIBDIR=/usr/lib/pbuilder + PBUILDER_SYSCONFDIR=/etc + PIPESTATUS=([0]="0") + POSIXLY_CORRECT=y + PPID=903529 PS4='+ ' - PWD='/' - SHELL='/bin/bash' - SHLVL='2' - SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.Yv01128t/pbuilderrc_o7Iu --distribution bookworm --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.Yv01128t/b1 --logfile b1/build.log bowtie_1.3.1-1.dsc' - SUDO_GID='111' - SUDO_UID='106' - SUDO_USER='jenkins' - TERM='unknown' - TZ='/usr/share/zoneinfo/Etc/GMT+12' - USER='root' - _='/usr/bin/systemd-run' - http_proxy='http://78.137.99.97:3128' + PWD=/ + SHELL=/bin/bash + SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix + SHLVL=3 + SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.Yv01128t/pbuilderrc_Uj5V --distribution bookworm --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.Yv01128t/b2 --logfile b2/build.log --extrapackages usrmerge bowtie_1.3.1-1.dsc' + SUDO_GID=111 + SUDO_UID=106 + SUDO_USER=jenkins + TERM=unknown + TZ=/usr/share/zoneinfo/Etc/GMT-14 + UID=0 + USER=root + _='I: set' + http_proxy=http://85.184.249.68:3128 I: uname -a - Linux ionos11-amd64 5.10.0-23-amd64 #1 SMP Debian 5.10.179-1 (2023-05-12) x86_64 GNU/Linux + Linux i-capture-the-hostname 6.1.0-0.deb11.6-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.15-1~bpo11+1 (2023-03-16) x86_64 GNU/Linux I: ls -l /bin total 5632 - -rwxr-xr-x 1 root root 1265648 Apr 23 09:23 bash - -rwxr-xr-x 3 root root 39224 Sep 18 2022 bunzip2 - -rwxr-xr-x 3 root root 39224 Sep 18 2022 bzcat - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzcmp -> bzdiff - -rwxr-xr-x 1 root root 2225 Sep 18 2022 bzdiff - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzegrep -> bzgrep - -rwxr-xr-x 1 root root 4893 Nov 27 2021 bzexe - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzfgrep -> bzgrep - -rwxr-xr-x 1 root root 3775 Sep 18 2022 bzgrep - -rwxr-xr-x 3 root root 39224 Sep 18 2022 bzip2 - -rwxr-xr-x 1 root root 14568 Sep 18 2022 bzip2recover - lrwxrwxrwx 1 root root 6 Sep 18 2022 bzless -> bzmore - -rwxr-xr-x 1 root root 1297 Sep 18 2022 bzmore - -rwxr-xr-x 1 root root 44016 Sep 20 2022 cat - -rwxr-xr-x 1 root root 68656 Sep 20 2022 chgrp - -rwxr-xr-x 1 root root 64496 Sep 20 2022 chmod - -rwxr-xr-x 1 root root 72752 Sep 20 2022 chown - -rwxr-xr-x 1 root root 151152 Sep 20 2022 cp - -rwxr-xr-x 1 root root 125640 Jan 5 01:20 dash - -rwxr-xr-x 1 root root 121904 Sep 20 2022 date - -rwxr-xr-x 1 root root 89240 Sep 20 2022 dd - -rwxr-xr-x 1 root root 102200 Sep 20 2022 df - -rwxr-xr-x 1 root root 151344 Sep 20 2022 dir - -rwxr-xr-x 1 root root 88656 Mar 22 22:02 dmesg - lrwxrwxrwx 1 root root 8 Dec 19 01:33 dnsdomainname -> hostname - lrwxrwxrwx 1 root root 8 Dec 19 01:33 domainname -> hostname - -rwxr-xr-x 1 root root 43856 Sep 20 2022 echo - -rwxr-xr-x 1 root root 41 Jan 24 02:43 egrep - -rwxr-xr-x 1 root root 35664 Sep 20 2022 false - -rwxr-xr-x 1 root root 41 Jan 24 02:43 fgrep - -rwxr-xr-x 1 root root 85600 Mar 22 22:02 findmnt - -rwsr-xr-x 1 root root 35128 Mar 22 20:35 fusermount - -rwxr-xr-x 1 root root 203152 Jan 24 02:43 grep - -rwxr-xr-x 2 root root 2346 Apr 9 2022 gunzip - -rwxr-xr-x 1 root root 6447 Apr 9 2022 gzexe - -rwxr-xr-x 1 root root 98136 Apr 9 2022 gzip - -rwxr-xr-x 1 root root 22680 Dec 19 01:33 hostname - -rwxr-xr-x 1 root root 72824 Sep 20 2022 ln - -rwxr-xr-x 1 root root 53024 Mar 23 00:40 login - -rwxr-xr-x 1 root root 151344 Sep 20 2022 ls - -rwxr-xr-x 1 root root 207168 Mar 22 22:02 lsblk - -rwxr-xr-x 1 root root 97552 Sep 20 2022 mkdir - -rwxr-xr-x 1 root root 72912 Sep 20 2022 mknod - -rwxr-xr-x 1 root root 43952 Sep 20 2022 mktemp - -rwxr-xr-x 1 root root 59712 Mar 22 22:02 more - -rwsr-xr-x 1 root root 59704 Mar 22 22:02 mount - -rwxr-xr-x 1 root root 18744 Mar 22 22:02 mountpoint - -rwxr-xr-x 1 root root 142968 Sep 20 2022 mv - lrwxrwxrwx 1 root root 8 Dec 19 01:33 nisdomainname -> hostname - lrwxrwxrwx 1 root root 14 Apr 2 18:25 pidof -> /sbin/killall5 - -rwxr-xr-x 1 root root 43952 Sep 20 2022 pwd - lrwxrwxrwx 1 root root 4 Apr 23 09:23 rbash -> bash - -rwxr-xr-x 1 root root 52112 Sep 20 2022 readlink - -rwxr-xr-x 1 root root 72752 Sep 20 2022 rm - -rwxr-xr-x 1 root root 56240 Sep 20 2022 rmdir - -rwxr-xr-x 1 root root 27560 Nov 2 2022 run-parts - -rwxr-xr-x 1 root root 126424 Jan 5 07:55 sed - lrwxrwxrwx 1 root root 4 Jan 5 01:20 sh -> dash - -rwxr-xr-x 1 root root 43888 Sep 20 2022 sleep - -rwxr-xr-x 1 root root 85008 Sep 20 2022 stty - -rwsr-xr-x 1 root root 72000 Mar 22 22:02 su - -rwxr-xr-x 1 root root 39824 Sep 20 2022 sync - -rwxr-xr-x 1 root root 531984 Apr 6 02:25 tar - -rwxr-xr-x 1 root root 14520 Nov 2 2022 tempfile - -rwxr-xr-x 1 root root 109616 Sep 20 2022 touch - -rwxr-xr-x 1 root root 35664 Sep 20 2022 true - -rwxr-xr-x 1 root root 14568 Mar 22 20:35 ulockmgr_server - -rwsr-xr-x 1 root root 35128 Mar 22 22:02 umount - -rwxr-xr-x 1 root root 43888 Sep 20 2022 uname - -rwxr-xr-x 2 root root 2346 Apr 9 2022 uncompress - -rwxr-xr-x 1 root root 151344 Sep 20 2022 vdir - -rwxr-xr-x 1 root root 72024 Mar 22 22:02 wdctl - lrwxrwxrwx 1 root root 8 Dec 19 01:33 ypdomainname -> hostname - -rwxr-xr-x 1 root root 1984 Apr 9 2022 zcat - -rwxr-xr-x 1 root root 1678 Apr 9 2022 zcmp - -rwxr-xr-x 1 root root 6460 Apr 9 2022 zdiff - -rwxr-xr-x 1 root root 29 Apr 9 2022 zegrep - -rwxr-xr-x 1 root root 29 Apr 9 2022 zfgrep - -rwxr-xr-x 1 root root 2081 Apr 9 2022 zforce - -rwxr-xr-x 1 root root 8103 Apr 9 2022 zgrep - -rwxr-xr-x 1 root root 2206 Apr 9 2022 zless - -rwxr-xr-x 1 root root 1842 Apr 9 2022 zmore - -rwxr-xr-x 1 root root 4577 Apr 9 2022 znew -I: user script /srv/workspace/pbuilder/2759864/tmp/hooks/D02_print_environment finished + -rwxr-xr-x 1 root root 1265648 Apr 24 2023 bash + -rwxr-xr-x 3 root root 39224 Sep 19 2022 bunzip2 + -rwxr-xr-x 3 root root 39224 Sep 19 2022 bzcat + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzcmp -> bzdiff + -rwxr-xr-x 1 root root 2225 Sep 19 2022 bzdiff + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzegrep -> bzgrep + -rwxr-xr-x 1 root root 4893 Nov 28 2021 bzexe + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzfgrep -> bzgrep + -rwxr-xr-x 1 root root 3775 Sep 19 2022 bzgrep + -rwxr-xr-x 3 root root 39224 Sep 19 2022 bzip2 + -rwxr-xr-x 1 root root 14568 Sep 19 2022 bzip2recover + lrwxrwxrwx 1 root root 6 Sep 19 2022 bzless -> bzmore + -rwxr-xr-x 1 root root 1297 Sep 19 2022 bzmore + -rwxr-xr-x 1 root root 44016 Sep 21 2022 cat + -rwxr-xr-x 1 root root 68656 Sep 21 2022 chgrp + -rwxr-xr-x 1 root root 64496 Sep 21 2022 chmod + -rwxr-xr-x 1 root root 72752 Sep 21 2022 chown + -rwxr-xr-x 1 root root 151152 Sep 21 2022 cp + -rwxr-xr-x 1 root root 125640 Jan 6 2023 dash + -rwxr-xr-x 1 root root 121904 Sep 21 2022 date + -rwxr-xr-x 1 root root 89240 Sep 21 2022 dd + -rwxr-xr-x 1 root root 102200 Sep 21 2022 df + -rwxr-xr-x 1 root root 151344 Sep 21 2022 dir + -rwxr-xr-x 1 root root 88656 Mar 24 2023 dmesg + lrwxrwxrwx 1 root root 8 Dec 20 2022 dnsdomainname -> hostname + lrwxrwxrwx 1 root root 8 Dec 20 2022 domainname -> hostname + -rwxr-xr-x 1 root root 43856 Sep 21 2022 echo + -rwxr-xr-x 1 root root 41 Jan 25 2023 egrep + -rwxr-xr-x 1 root root 35664 Sep 21 2022 false + -rwxr-xr-x 1 root root 41 Jan 25 2023 fgrep + -rwxr-xr-x 1 root root 85600 Mar 24 2023 findmnt + -rwsr-xr-x 1 root root 35128 Mar 23 2023 fusermount + -rwxr-xr-x 1 root root 203152 Jan 25 2023 grep + -rwxr-xr-x 2 root root 2346 Apr 10 2022 gunzip + -rwxr-xr-x 1 root root 6447 Apr 10 2022 gzexe + -rwxr-xr-x 1 root root 98136 Apr 10 2022 gzip + -rwxr-xr-x 1 root root 22680 Dec 20 2022 hostname + -rwxr-xr-x 1 root root 72824 Sep 21 2022 ln + -rwxr-xr-x 1 root root 53024 Mar 24 2023 login + -rwxr-xr-x 1 root root 151344 Sep 21 2022 ls + -rwxr-xr-x 1 root root 207168 Mar 24 2023 lsblk + -rwxr-xr-x 1 root root 97552 Sep 21 2022 mkdir + -rwxr-xr-x 1 root root 72912 Sep 21 2022 mknod + -rwxr-xr-x 1 root root 43952 Sep 21 2022 mktemp + -rwxr-xr-x 1 root root 59712 Mar 24 2023 more + -rwsr-xr-x 1 root root 59704 Mar 24 2023 mount + -rwxr-xr-x 1 root root 18744 Mar 24 2023 mountpoint + -rwxr-xr-x 1 root root 142968 Sep 21 2022 mv + lrwxrwxrwx 1 root root 8 Dec 20 2022 nisdomainname -> hostname + lrwxrwxrwx 1 root root 14 Apr 3 2023 pidof -> /sbin/killall5 + -rwxr-xr-x 1 root root 43952 Sep 21 2022 pwd + lrwxrwxrwx 1 root root 4 Apr 24 2023 rbash -> bash + -rwxr-xr-x 1 root root 52112 Sep 21 2022 readlink + -rwxr-xr-x 1 root root 72752 Sep 21 2022 rm + -rwxr-xr-x 1 root root 56240 Sep 21 2022 rmdir + -rwxr-xr-x 1 root root 27560 Nov 3 2022 run-parts + -rwxr-xr-x 1 root root 126424 Jan 6 2023 sed + lrwxrwxrwx 1 root root 9 Jun 22 20:31 sh -> /bin/bash + -rwxr-xr-x 1 root root 43888 Sep 21 2022 sleep + -rwxr-xr-x 1 root root 85008 Sep 21 2022 stty + -rwsr-xr-x 1 root root 72000 Mar 24 2023 su + -rwxr-xr-x 1 root root 39824 Sep 21 2022 sync + -rwxr-xr-x 1 root root 531984 Apr 7 2023 tar + -rwxr-xr-x 1 root root 14520 Nov 3 2022 tempfile + -rwxr-xr-x 1 root root 109616 Sep 21 2022 touch + -rwxr-xr-x 1 root root 35664 Sep 21 2022 true + -rwxr-xr-x 1 root root 14568 Mar 23 2023 ulockmgr_server + -rwsr-xr-x 1 root root 35128 Mar 24 2023 umount + -rwxr-xr-x 1 root root 43888 Sep 21 2022 uname + -rwxr-xr-x 2 root root 2346 Apr 10 2022 uncompress + -rwxr-xr-x 1 root root 151344 Sep 21 2022 vdir + -rwxr-xr-x 1 root root 72024 Mar 24 2023 wdctl + lrwxrwxrwx 1 root root 8 Dec 20 2022 ypdomainname -> hostname + -rwxr-xr-x 1 root root 1984 Apr 10 2022 zcat + -rwxr-xr-x 1 root root 1678 Apr 10 2022 zcmp + -rwxr-xr-x 1 root root 6460 Apr 10 2022 zdiff + -rwxr-xr-x 1 root root 29 Apr 10 2022 zegrep + -rwxr-xr-x 1 root root 29 Apr 10 2022 zfgrep + -rwxr-xr-x 1 root root 2081 Apr 10 2022 zforce + -rwxr-xr-x 1 root root 8103 Apr 10 2022 zgrep + -rwxr-xr-x 1 root root 2206 Apr 10 2022 zless + -rwxr-xr-x 1 root root 1842 Apr 10 2022 zmore + -rwxr-xr-x 1 root root 4577 Apr 10 2022 znew +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy @@ -269,7 +301,7 @@ Get: 54 http://deb.debian.org/debian bookworm/main amd64 libtbb-dev amd64 2021.8.0-1 [191 kB] Get: 55 http://deb.debian.org/debian bookworm/main amd64 libtest-deep-perl all 1.204-1 [52.9 kB] Get: 56 http://deb.debian.org/debian bookworm/main amd64 zlib1g-dev amd64 1:1.2.13.dfsg-1 [916 kB] -Fetched 26.2 MB in 0s (76.5 MB/s) +Fetched 26.2 MB in 5s (5013 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package liblocale-gettext-perl. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19596 files and directories currently installed.) @@ -509,8 +541,19 @@ Writing extended state information... Building tag database... -> Finished parsing the build-deps +Reading package lists... +Building dependency tree... +Reading state information... +usrmerge is already the newest version (35). +0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package -I: Running cd /build/bowtie-1.3.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../bowtie_1.3.1-1_source.changes +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/A99_set_merged_usr starting +Re-configuring usrmerge... +removed '/etc/unsupported-skip-usrmerge-conversion' +The system has been successfully converted. +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/A99_set_merged_usr finished +hostname: Name or service not known +I: Running cd /build/bowtie-1.3.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../bowtie_1.3.1-1_source.changes dpkg-buildpackage: info: source package bowtie dpkg-buildpackage: info: source version 1.3.1-1 dpkg-buildpackage: info: source distribution unstable @@ -523,7 +566,7 @@ make[1]: Entering directory '/build/bowtie-1.3.1' rm -f .bowtie* dh_auto_clean - make -j15 clean + make -j16 clean make[2]: Entering directory '/build/bowtie-1.3.1' rm -f bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-build-s-debug bowtie-build-l-debug bowtie-align-s-debug bowtie-align-l-debug bowtie-inspect-s-debug bowtie-inspect-l-debug \ bowtie_prof \ @@ -637,10 +680,10 @@ ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -652,10 +695,10 @@ ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 -# reads with at least one alignment: 3 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -668,10 +711,10 @@ ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -682,10 +725,10 @@ ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -711,10 +754,10 @@ ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 -# reads with at least one alignment: 3 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -728,14 +771,14 @@ ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 @@ -743,10 +786,10 @@ ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 @@ -756,13 +799,13 @@ AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 0 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) -# reads that failed to align: 0 (0.00%) -No alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" +0 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 0 (0.00%) +No alignments Cline multiread 2 (fw:1, sam:1) References: >0 @@ -771,14 +814,14 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 @@ -786,15 +829,15 @@ ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 +2 +# reads with at least one alignment: 2 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 @@ -818,10 +861,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -849,10 +892,10 @@ ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -863,10 +906,10 @@ ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 @@ -889,14 +932,14 @@ AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 @@ -904,10 +947,10 @@ ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -920,10 +963,10 @@ ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -935,10 +978,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -980,10 +1023,10 @@ ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 @@ -1007,10 +1050,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1021,10 +1064,10 @@ ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1052,10 +1095,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1067,10 +1110,10 @@ ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 @@ -1097,10 +1140,10 @@ ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 @@ -1124,10 +1167,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1139,9 +1182,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -1153,15 +1196,15 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 @@ -1169,10 +1212,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1270,15 +1313,15 @@ ./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 @@ -1286,10 +1329,10 @@ ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -1301,10 +1344,10 @@ ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 @@ -1332,10 +1375,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1347,10 +1390,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1362,10 +1405,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1377,10 +1420,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1392,10 +1435,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1408,9 +1451,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1423,9 +1466,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted - +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1436,15 +1479,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 @@ -1452,8 +1495,8 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) +@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @@ -1468,9 +1511,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: @HD VN:1.0 SO:unsorted -0 (0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1481,15 +1524,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 @@ -1497,10 +1540,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1527,10 +1570,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 @@ -1542,10 +1585,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 @@ -1572,10 +1615,10 @@ ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1586,15 +1629,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 @@ -1617,10 +1660,10 @@ ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1631,30 +1674,30 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 @@ -1676,15 +1719,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 @@ -1693,11 +1736,11 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments -@SQ SN:0 LN:25 -@PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" +Reported 1@PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" + paired-end alignments r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) @@ -1707,10 +1750,10 @@ ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1737,10 +1780,10 @@ ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1754,8 +1797,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -@HD VN:1.0 SO:unsorted Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1767,10 +1810,10 @@ ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1797,10 +1840,10 @@ ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1826,15 +1869,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments -@HD VN:1.0 SO:unsorted +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 @@ -1842,10 +1885,10 @@ ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -1856,15 +1899,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments +# reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 @@ -1873,10 +1916,10 @@ ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -1888,10 +1931,10 @@ ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 @@ -1904,14 +1947,14 @@ ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 @@ -1935,13 +1978,13 @@ ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -@SQ SN:0 LN:24 -@PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:24 +@PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 @@ -1964,11 +2007,11 @@ ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) @@ -1993,10 +2036,10 @@ ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 @@ -2022,10 +2065,10 @@ ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 @@ -2038,11 +2081,11 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 alignments -@HD VN:1.0 SO:unsorted +Reported @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 +1 alignments Checking edits 2 (fw:1, sam:1) References: >0 @@ -2051,10 +2094,10 @@ ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -2080,8 +2123,8 @@ ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) +@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @@ -2094,10 +2137,10 @@ ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -2123,10 +2166,10 @@ ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -2138,10 +2181,10 @@ ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -2183,9 +2226,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) -# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads that failed to align: 0 (0.00%) Reported 3 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2198,10 +2241,10 @@ ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2212,10 +2255,10 @@ ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2228,8 +2271,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 alignments +Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2302,10 +2345,10 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted - +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2317,10 +2360,10 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2335,8 +2378,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1@HD VN:1.0 SO:unsorted - paired-end alignments +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2348,10 +2391,10 @@ ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2362,15 +2405,15 @@ AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) -# reads that failed to align: 1 (100.00%) -No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 +# reads processed: 1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Fastq 7 (fw:1, sam:1) References: >0 @@ -2379,10 +2422,10 @@ ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -2393,10 +2436,10 @@ ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 @@ -2419,14 +2462,14 @@ AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 @@ -2436,8 +2479,8 @@ # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -2 alignments +Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2466,9 +2509,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2496,10 +2539,10 @@ ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 @@ -2510,10 +2553,10 @@ ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 @@ -2524,10 +2567,10 @@ ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) @@ -2538,9 +2581,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2551,10 +2594,10 @@ ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 -# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2567,10 +2610,10 @@ ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 @@ -2582,10 +2625,10 @@ ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2597,10 +2640,10 @@ ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted -0.00%) +# reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 @@ -2759,9 +2802,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) No alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) @@ -2772,9 +2815,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted - +# reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2786,9 +2829,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) -# reads that failed to align: @HD VN:1.0 SO:unsorted -0 (0.00%) +# reads that failed to align: 0 (0.00%) Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 @@ -2801,10 +2844,10 @@ ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2817,9 +2860,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted - +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 @@ -2847,10 +2890,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2862,10 +2905,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2878,9 +2921,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0@HD VN:1.0 SO:unsorted - (0.00%) +# reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2894,8 +2937,8 @@ # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments@HD VN:1.0 SO:unsorted - +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2907,10 +2950,10 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2922,10 +2965,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2937,10 +2980,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2967,10 +3010,10 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) -Reported @HD VN:1.0 SO:unsorted -1 paired-end alignments +Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -2982,10 +3025,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3012,10 +3055,10 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted -%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3027,10 +3070,10 @@ ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 @@ -3041,15 +3084,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 0 (0.00%) -# reads that failed to align: 1 (100.00%) -No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 +# reads processed: 1 +# reads with at least one alignment: 0 (0.00%) +# reads that failed to align: 1 (100.00%) +No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 @@ -3161,15 +3204,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 @@ -3191,15 +3234,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: @HD VN:1.0 SO:unsorted +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 -1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 @@ -3297,14 +3340,14 @@ ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments -@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 @@ -3371,15 +3414,15 @@ AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. -# reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 +# reads processed: 1 +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 @@ -3418,14 +3461,14 @@ ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) +Reported 2 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 -100.00%) -# reads that failed to align: 0 (0.00%) -Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 @@ -3465,11 +3508,11 @@ ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) @@ -3479,11 +3522,11 @@ ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) @@ -3581,13 +3624,13 @@ ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) -# reads that failed to align: 0 (0.00%) -Reported 1 alignments -@HD VN:1.0 SO:unsorted +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 +100.00%) +# reads that failed to align: 0 (0.00%) +Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 @@ -3595,11 +3638,11 @@ ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) -# reads that failed to align: 0 (0.00%)@SQ SN:0 LN:8 - +# reads with at least one alignment: 1 (100.00%) +# reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted +@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) @@ -3610,10 +3653,10 @@ ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (100.00%) +# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted +100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments -@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -3624,10 +3667,10 @@ ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 @@ -3639,9 +3682,9 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) +@HD VN:1.0 SO:unsorted Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" @@ -3653,10 +3696,10 @@ ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 -# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted -100.00%) +# reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -3669,9 +3712,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -3683,9 +3726,9 @@ Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) -@HD VN:1.0 SO:unsorted # reads that failed to align: 0 (0.00%) Reported 1 alignments +@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/build/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 @@ -3747,7 +3790,7 @@ find . -name .cvsignore -delete make[1]: Leaving directory '/build/bowtie-1.3.1' dh_auto_install -Nbowtie - make -j15 install DESTDIR=/build/bowtie-1.3.1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" + make -j16 install DESTDIR=/build/bowtie-1.3.1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/bowtie-1.3.1' mkdir -p /build/bowtie-1.3.1/debian/tmp/usr/local/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ @@ -3799,9 +3842,9 @@ dh_gencontrol dh_md5sums dh_builddeb +dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.1-1_all.deb'. dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.1-1_amd64.deb'. dpkg-deb: building package 'bowtie' in '../bowtie_1.3.1-1_amd64.deb'. -dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.1-1_all.deb'. dpkg-genbuildinfo --build=binary -O../bowtie_1.3.1-1_amd64.buildinfo dpkg-genchanges --build=binary -O../bowtie_1.3.1-1_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) @@ -3809,12 +3852,14 @@ dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/B01_cleanup starting +I: user script /srv/workspace/pbuilder/903529/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env -I: removing directory /srv/workspace/pbuilder/2759864 and its subdirectories -I: Current time: Sat May 20 12:07:53 -12 2023 -I: pbuilder-time-stamp: 1684627673 +I: removing directory /srv/workspace/pbuilder/903529 and its subdirectories +I: Current time: Sat Jun 22 21:14:26 +14 2024 +I: pbuilder-time-stamp: 1719040466