I: pbuilder: network access will be disabled during build I: Current time: Wed Jul 14 16:32:53 +14 2021 I: pbuilder-time-stamp: 1626229973 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bullseye-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [tnseq-transit_3.2.1-1.dsc] I: copying [./tnseq-transit_3.2.1.orig.tar.gz] I: copying [./tnseq-transit_3.2.1-1.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/tmp/dpkg-verify-sig.m2Y_6mrt/trustedkeys.kbx': General error gpgv: Signature made Fri Dec 25 08:30:31 2020 +14 gpgv: using RSA key 3E99A526F5DCC0CBBF1CEEA600BAE74B343369F1 gpgv: issuer "npatra974@gmail.com" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./tnseq-transit_3.2.1-1.dsc dpkg-source: info: extracting tnseq-transit in tnseq-transit-3.2.1 dpkg-source: info: unpacking tnseq-transit_3.2.1.orig.tar.gz dpkg-source: info: unpacking tnseq-transit_3.2.1-1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying skip_test_requiring_non_existing_input_data.patch I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/21411/tmp/hooks/D01_modify_environment starting debug: Running on virt64b. I: Changing host+domainname to test build reproducibility I: Adding a custom variable just for the fun of it... I: Changing /bin/sh to bash Removing 'diversion of /bin/sh to /bin/sh.distrib by dash' Adding 'diversion of /bin/sh to /bin/sh.distrib by bash' Removing 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by dash' Adding 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by bash' I: Setting pbuilder2's login shell to /bin/bash I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other I: user script /srv/workspace/pbuilder/21411/tmp/hooks/D01_modify_environment finished I: user script /srv/workspace/pbuilder/21411/tmp/hooks/D02_print_environment starting I: set BASH=/bin/sh BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:hostcomplete:interactive_comments:progcomp:promptvars:sourcepath BASH_ALIASES=() BASH_ARGC=() BASH_ARGV=() BASH_CMDS=() BASH_LINENO=([0]="12" [1]="0") BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") BASH_VERSINFO=([0]="5" [1]="1" [2]="4" [3]="1" [4]="release" [5]="arm-unknown-linux-gnueabihf") BASH_VERSION='5.1.4(1)-release' BUILDDIR=/build BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' BUILDUSERNAME=pbuilder2 BUILD_ARCH=armhf DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all,-fixfilepath parallel=4' DIRSTACK=() DISTRIBUTION= EUID=0 FUNCNAME=([0]="Echo" [1]="main") GROUPS=() HOME=/root HOSTNAME=i-capture-the-hostname HOSTTYPE=arm HOST_ARCH=armhf IFS=' ' INVOCATION_ID=df15e9d8e94649e2baadf83c5766ce55 LANG=C LANGUAGE=it_CH:it LC_ALL=C MACHTYPE=arm-unknown-linux-gnueabihf MAIL=/var/mail/root OPTERR=1 OPTIND=1 OSTYPE=linux-gnueabihf PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path PBCURRENTCOMMANDLINEOPERATION=build PBUILDER_OPERATION=build PBUILDER_PKGDATADIR=/usr/share/pbuilder PBUILDER_PKGLIBDIR=/usr/lib/pbuilder PBUILDER_SYSCONFDIR=/etc PIPESTATUS=([0]="0") POSIXLY_CORRECT=y PPID=21411 PS4='+ ' PWD=/ SHELL=/bin/bash SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix SHLVL=3 SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.Gf6Ept2dQX/pbuilderrc_zBBG --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bullseye-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.Gf6Ept2dQX/b2 --logfile b2/build.log --extrapackages usrmerge tnseq-transit_3.2.1-1.dsc' SUDO_GID=113 SUDO_UID=107 SUDO_USER=jenkins TERM=unknown TZ=/usr/share/zoneinfo/Etc/GMT-14 UID=0 USER=root _='I: set' http_proxy=http://10.0.0.15:8000/ I: uname -a Linux i-capture-the-hostname 5.10.0-7-arm64 #1 SMP Debian 5.10.40-1 (2021-05-28) aarch64 GNU/Linux I: ls -l /bin total 3580 -rwxr-xr-x 1 root root 816764 Jun 22 16:26 bash -rwxr-xr-x 3 root root 26052 Jul 21 2020 bunzip2 -rwxr-xr-x 3 root root 26052 Jul 21 2020 bzcat lrwxrwxrwx 1 root root 6 Jul 21 2020 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Jul 21 2020 bzdiff lrwxrwxrwx 1 root root 6 Jul 21 2020 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Sep 5 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 21 2020 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Jul 21 2020 bzgrep -rwxr-xr-x 3 root root 26052 Jul 21 2020 bzip2 -rwxr-xr-x 1 root root 9636 Jul 21 2020 bzip2recover lrwxrwxrwx 1 root root 6 Jul 21 2020 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 21 2020 bzmore -rwxr-xr-x 1 root root 26668 Sep 23 2020 cat -rwxr-xr-x 1 root root 43104 Sep 23 2020 chgrp -rwxr-xr-x 1 root root 38984 Sep 23 2020 chmod -rwxr-xr-x 1 root root 43112 Sep 23 2020 chown -rwxr-xr-x 1 root root 92616 Sep 23 2020 cp -rwxr-xr-x 1 root root 75524 Dec 11 2020 dash -rwxr-xr-x 1 root root 75880 Sep 23 2020 date -rwxr-xr-x 1 root root 55436 Sep 23 2020 dd -rwxr-xr-x 1 root root 59912 Sep 23 2020 df -rwxr-xr-x 1 root root 96764 Sep 23 2020 dir -rwxr-xr-x 1 root root 55012 Feb 8 04:38 dmesg lrwxrwxrwx 1 root root 8 Nov 8 2019 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Nov 8 2019 domainname -> hostname -rwxr-xr-x 1 root root 22508 Sep 23 2020 echo -rwxr-xr-x 1 root root 28 Nov 10 2020 egrep -rwxr-xr-x 1 root root 22496 Sep 23 2020 false -rwxr-xr-x 1 root root 28 Nov 10 2020 fgrep -rwxr-xr-x 1 root root 47492 Feb 8 04:38 findmnt -rwsr-xr-x 1 root root 26076 Feb 27 06:12 fusermount -rwxr-xr-x 1 root root 124508 Nov 10 2020 grep -rwxr-xr-x 2 root root 2346 Mar 3 13:30 gunzip -rwxr-xr-x 1 root root 6376 Mar 3 13:30 gzexe -rwxr-xr-x 1 root root 64212 Mar 3 13:30 gzip -rwxr-xr-x 1 root root 13784 Nov 8 2019 hostname -rwxr-xr-x 1 root root 43180 Sep 23 2020 ln -rwxr-xr-x 1 root root 35068 Feb 8 2020 login -rwxr-xr-x 1 root root 96764 Sep 23 2020 ls -rwxr-xr-x 1 root root 99940 Feb 8 04:38 lsblk -rwxr-xr-x 1 root root 51408 Sep 23 2020 mkdir -rwxr-xr-x 1 root root 43184 Sep 23 2020 mknod -rwxr-xr-x 1 root root 30780 Sep 23 2020 mktemp -rwxr-xr-x 1 root root 34408 Feb 8 04:38 more -rwsr-xr-x 1 root root 34400 Feb 8 04:38 mount -rwxr-xr-x 1 root root 9824 Feb 8 04:38 mountpoint -rwxr-xr-x 1 root root 88524 Sep 23 2020 mv lrwxrwxrwx 1 root root 8 Nov 8 2019 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 19 05:38 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 26652 Sep 23 2020 pwd lrwxrwxrwx 1 root root 4 Jun 22 16:26 rbash -> bash -rwxr-xr-x 1 root root 30740 Sep 23 2020 readlink -rwxr-xr-x 1 root root 43104 Sep 23 2020 rm -rwxr-xr-x 1 root root 30732 Sep 23 2020 rmdir -rwxr-xr-x 1 root root 14144 Sep 28 2020 run-parts -rwxr-xr-x 1 root root 76012 Dec 23 2018 sed lrwxrwxrwx 1 root root 4 Jul 14 16:33 sh -> bash lrwxrwxrwx 1 root root 4 Jul 13 23:25 sh.distrib -> dash -rwxr-xr-x 1 root root 22532 Sep 23 2020 sleep -rwxr-xr-x 1 root root 55360 Sep 23 2020 stty -rwsr-xr-x 1 root root 46704 Feb 8 04:38 su -rwxr-xr-x 1 root root 22532 Sep 23 2020 sync -rwxr-xr-x 1 root root 340872 Feb 17 23:55 tar -rwxr-xr-x 1 root root 9808 Sep 28 2020 tempfile -rwxr-xr-x 1 root root 67696 Sep 23 2020 touch -rwxr-xr-x 1 root root 22496 Sep 23 2020 true -rwxr-xr-x 1 root root 9636 Feb 27 06:12 ulockmgr_server -rwsr-xr-x 1 root root 22108 Feb 8 04:38 umount -rwxr-xr-x 1 root root 22520 Sep 23 2020 uname -rwxr-xr-x 2 root root 2346 Mar 3 13:30 uncompress -rwxr-xr-x 1 root root 96764 Sep 23 2020 vdir -rwxr-xr-x 1 root root 38512 Feb 8 04:38 wdctl lrwxrwxrwx 1 root root 8 Nov 8 2019 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Mar 3 13:30 zcat -rwxr-xr-x 1 root root 1678 Mar 3 13:30 zcmp -rwxr-xr-x 1 root root 5880 Mar 3 13:30 zdiff -rwxr-xr-x 1 root root 29 Mar 3 13:30 zegrep -rwxr-xr-x 1 root root 29 Mar 3 13:30 zfgrep -rwxr-xr-x 1 root root 2081 Mar 3 13:30 zforce -rwxr-xr-x 1 root root 7585 Mar 3 13:30 zgrep -rwxr-xr-x 1 root root 2206 Mar 3 13:30 zless -rwxr-xr-x 1 root root 1842 Mar 3 13:30 zmore -rwxr-xr-x 1 root root 4553 Mar 3 13:30 znew I: user script /srv/workspace/pbuilder/21411/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: armhf Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), dh-python, python3-dev, python3-setuptools, python3-numpy, python3-scipy, python3-pil, python3-matplotlib, python3-statsmodels, python3-pubsub, bwa dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19398 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on dh-python; however: Package dh-python is not installed. pbuilder-satisfydepends-dummy depends on python3-dev; however: Package python3-dev is not installed. pbuilder-satisfydepends-dummy depends on python3-setuptools; however: Package python3-setuptools is not installed. pbuilder-satisfydepends-dummy depends on python3-numpy; however: Package python3-numpy is not installed. pbuilder-satisfydepends-dummy depends on python3-scipy; however: Package python3-scipy is not installed. pbuilder-satisfydepends-dummy depends on python3-pil; however: Package python3-pil is not installed. pbuilder-satisfydepends-dummy depends on python3-matplotlib; however: Package python3-matplotlib is not installed. pbuilder-satisfydepends-dummy depends on python3-statsmodels; however: Package python3-statsmodels is not installed. pbuilder-satisfydepends-dummy depends on python3-pubsub; however: Package python3-pubsub is not installed. pbuilder-satisfydepends-dummy depends on bwa; however: Package bwa is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} bwa{a} debhelper{a} dh-autoreconf{a} dh-python{a} dh-strip-nondeterminism{a} dwz{a} file{a} fonts-lyx{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libblas3{a} libbrotli1{a} libbsd0{a} libdebhelper-perl{a} libdeflate0{a} libelf1{a} libexpat1{a} libexpat1-dev{a} libfile-stripnondeterminism-perl{a} libfreetype6{a} libgfortran5{a} libicu67{a} libimagequant0{a} libjbig0{a} libjpeg62-turbo{a} libjs-jquery{a} libjs-jquery-ui{a} libjs-sphinxdoc{a} libjs-underscore{a} liblapack3{a} liblbfgsb0{a} liblcms2-2{a} libmagic-mgc{a} libmagic1{a} libmd0{a} libmpdec3{a} libpipeline1{a} libpng16-16{a} libpython3-dev{a} libpython3-stdlib{a} libpython3.9{a} libpython3.9-dev{a} libpython3.9-minimal{a} libpython3.9-stdlib{a} libreadline8{a} libsigsegv2{a} libsub-override-perl{a} libtiff5{a} libtool{a} libuchardet0{a} libwebp6{a} libwebpdemux2{a} libwebpmux3{a} libxau6{a} libxcb1{a} libxdmcp6{a} libxml2{a} m4{a} mailcap{a} man-db{a} media-types{a} mime-support{a} po-debconf{a} python-matplotlib-data{a} python3{a} python3-cycler{a} python3-dateutil{a} python3-decorator{a} python3-dev{a} python3-distutils{a} python3-kiwisolver{a} python3-lib2to3{a} python3-matplotlib{a} python3-minimal{a} python3-numpy{a} python3-pandas{a} python3-pandas-lib{a} python3-patsy{a} python3-pil{a} python3-pkg-resources{a} python3-pubsub{a} python3-pyparsing{a} python3-scipy{a} python3-setuptools{a} python3-six{a} python3-statsmodels{a} python3-statsmodels-lib{a} python3-tz{a} python3.9{a} python3.9-dev{a} python3.9-minimal{a} readline-common{a} sensible-utils{a} ttf-bitstream-vera{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl javascript-common libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx python3-bottleneck python3-bs4 python3-colorama python3-cvxopt python3-html5lib python3-jinja2 python3-joblib python3-lxml python3-numexpr python3-odf python3-olefile python3-openpyxl python3-tables python3-tk python3-xlwt wget 0 packages upgraded, 103 newly installed, 0 to remove and 0 not upgraded. Need to get 69.0 MB of archives. After unpacking 251 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bullseye/main armhf bsdextrautils armhf 2.36.1-7 [138 kB] Get: 2 http://deb.debian.org/debian bullseye/main armhf libuchardet0 armhf 0.0.7-1 [65.0 kB] Get: 3 http://deb.debian.org/debian bullseye/main armhf groff-base armhf 1.22.4-6 [847 kB] Get: 4 http://deb.debian.org/debian bullseye/main armhf libpipeline1 armhf 1.5.3-1 [30.1 kB] Get: 5 http://deb.debian.org/debian bullseye/main armhf man-db armhf 2.9.4-2 [1319 kB] Get: 6 http://deb.debian.org/debian bullseye/main armhf libpython3.9-minimal armhf 3.9.2-1 [790 kB] Get: 7 http://deb.debian.org/debian bullseye/main armhf libexpat1 armhf 2.2.10-2 [76.3 kB] Get: 8 http://deb.debian.org/debian bullseye/main armhf python3.9-minimal armhf 3.9.2-1 [1630 kB] Get: 9 http://deb.debian.org/debian bullseye/main armhf python3-minimal armhf 3.9.2-3 [38.2 kB] Get: 10 http://deb.debian.org/debian bullseye/main armhf media-types all 4.0.0 [30.3 kB] Get: 11 http://deb.debian.org/debian bullseye/main armhf mailcap all 3.69 [31.7 kB] Get: 12 http://deb.debian.org/debian bullseye/main armhf mime-support all 3.66 [10.9 kB] Get: 13 http://deb.debian.org/debian bullseye/main armhf libmpdec3 armhf 2.5.1-1 [74.9 kB] Get: 14 http://deb.debian.org/debian bullseye/main armhf readline-common all 8.1-1 [73.7 kB] Get: 15 http://deb.debian.org/debian bullseye/main armhf libreadline8 armhf 8.1-1 [147 kB] Get: 16 http://deb.debian.org/debian bullseye/main armhf libpython3.9-stdlib armhf 3.9.2-1 [1608 kB] Get: 17 http://deb.debian.org/debian bullseye/main armhf python3.9 armhf 3.9.2-1 [466 kB] Get: 18 http://deb.debian.org/debian bullseye/main armhf libpython3-stdlib armhf 3.9.2-3 [21.4 kB] Get: 19 http://deb.debian.org/debian bullseye/main armhf python3 armhf 3.9.2-3 [37.9 kB] Get: 20 http://deb.debian.org/debian bullseye/main armhf sensible-utils all 0.0.14 [14.8 kB] Get: 21 http://deb.debian.org/debian bullseye/main armhf libmagic-mgc armhf 1:5.39-3 [273 kB] Get: 22 http://deb.debian.org/debian bullseye/main armhf libmagic1 armhf 1:5.39-3 [117 kB] Get: 23 http://deb.debian.org/debian bullseye/main armhf file armhf 1:5.39-3 [68.1 kB] Get: 24 http://deb.debian.org/debian bullseye/main armhf gettext-base armhf 0.21-4 [171 kB] Get: 25 http://deb.debian.org/debian bullseye/main armhf libsigsegv2 armhf 2.13-1 [34.0 kB] Get: 26 http://deb.debian.org/debian bullseye/main armhf m4 armhf 1.4.18-5 [192 kB] Get: 27 http://deb.debian.org/debian bullseye/main armhf autoconf all 2.69-14 [313 kB] Get: 28 http://deb.debian.org/debian bullseye/main armhf autotools-dev all 20180224.1+nmu1 [77.1 kB] Get: 29 http://deb.debian.org/debian bullseye/main armhf automake all 1:1.16.3-2 [814 kB] Get: 30 http://deb.debian.org/debian bullseye/main armhf autopoint all 0.21-4 [510 kB] Get: 31 http://deb.debian.org/debian bullseye/main armhf bwa armhf 0.7.17-6+b1 [197 kB] Get: 32 http://deb.debian.org/debian bullseye/main armhf libdebhelper-perl all 13.3.4 [189 kB] Get: 33 http://deb.debian.org/debian bullseye/main armhf libtool all 2.4.6-15 [513 kB] Get: 34 http://deb.debian.org/debian bullseye/main armhf dh-autoreconf all 20 [17.1 kB] Get: 35 http://deb.debian.org/debian bullseye/main armhf libarchive-zip-perl all 1.68-1 [104 kB] Get: 36 http://deb.debian.org/debian bullseye/main armhf libsub-override-perl all 0.09-2 [10.2 kB] Get: 37 http://deb.debian.org/debian bullseye/main armhf libfile-stripnondeterminism-perl all 1.11.0-1 [25.6 kB] Get: 38 http://deb.debian.org/debian bullseye/main armhf dh-strip-nondeterminism all 1.11.0-1 [15.3 kB] Get: 39 http://deb.debian.org/debian bullseye/main armhf libelf1 armhf 0.183-1 [161 kB] Get: 40 http://deb.debian.org/debian bullseye/main armhf dwz armhf 0.13+20210201-1 [179 kB] Get: 41 http://deb.debian.org/debian bullseye/main armhf libicu67 armhf 67.1-7 [8319 kB] Get: 42 http://deb.debian.org/debian bullseye/main armhf libxml2 armhf 2.9.10+dfsg-6.7 [602 kB] Get: 43 http://deb.debian.org/debian bullseye/main armhf gettext armhf 0.21-4 [1243 kB] Get: 44 http://deb.debian.org/debian bullseye/main armhf intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 45 http://deb.debian.org/debian bullseye/main armhf po-debconf all 1.0.21+nmu1 [248 kB] Get: 46 http://deb.debian.org/debian bullseye/main armhf debhelper all 13.3.4 [1049 kB] Get: 47 http://deb.debian.org/debian bullseye/main armhf python3-lib2to3 all 3.9.2-1 [77.8 kB] Get: 48 http://deb.debian.org/debian bullseye/main armhf python3-distutils all 3.9.2-1 [143 kB] Get: 49 http://deb.debian.org/debian bullseye/main armhf dh-python all 4.20201102+nmu1 [99.4 kB] Get: 50 http://deb.debian.org/debian bullseye/main armhf fonts-lyx all 2.3.6-1 [205 kB] Get: 51 http://deb.debian.org/debian bullseye/main armhf libblas3 armhf 3.9.0-3 [109 kB] Get: 52 http://deb.debian.org/debian bullseye/main armhf libbrotli1 armhf 1.0.9-2+b2 [262 kB] Get: 53 http://deb.debian.org/debian bullseye/main armhf libmd0 armhf 1.0.3-3 [27.4 kB] Get: 54 http://deb.debian.org/debian bullseye/main armhf libbsd0 armhf 0.11.3-1 [103 kB] Get: 55 http://deb.debian.org/debian bullseye/main armhf libdeflate0 armhf 1.7-1 [43.1 kB] Get: 56 http://deb.debian.org/debian bullseye/main armhf libexpat1-dev armhf 2.2.10-2 [123 kB] Get: 57 http://deb.debian.org/debian bullseye/main armhf libpng16-16 armhf 1.6.37-3 [277 kB] Get: 58 http://deb.debian.org/debian bullseye/main armhf libfreetype6 armhf 2.10.4+dfsg-1 [357 kB] Get: 59 http://deb.debian.org/debian bullseye/main armhf libgfortran5 armhf 10.2.1-6 [237 kB] Get: 60 http://deb.debian.org/debian bullseye/main armhf libimagequant0 armhf 2.12.2-1.1 [27.2 kB] Get: 61 http://deb.debian.org/debian bullseye/main armhf libjbig0 armhf 2.1-3.1+b2 [28.4 kB] Get: 62 http://deb.debian.org/debian bullseye/main armhf libjpeg62-turbo armhf 1:2.0.6-4 [123 kB] Get: 63 http://deb.debian.org/debian bullseye/main armhf libjs-jquery all 3.5.1+dfsg+~3.5.5-7 [315 kB] Get: 64 http://deb.debian.org/debian bullseye/main armhf libjs-jquery-ui all 1.12.1+dfsg-8 [232 kB] Get: 65 http://deb.debian.org/debian bullseye/main armhf libjs-underscore all 1.9.1~dfsg-3 [100 kB] Get: 66 http://deb.debian.org/debian bullseye/main armhf libjs-sphinxdoc all 3.4.3-2 [127 kB] Get: 67 http://deb.debian.org/debian bullseye/main armhf liblapack3 armhf 3.9.0-3 [1651 kB] Get: 68 http://deb.debian.org/debian bullseye/main armhf liblbfgsb0 armhf 3.0+dfsg.3-9 [24.9 kB] Get: 69 http://deb.debian.org/debian bullseye/main armhf liblcms2-2 armhf 2.12~rc1-2 [123 kB] Get: 70 http://deb.debian.org/debian bullseye/main armhf libpython3.9 armhf 3.9.2-1 [1447 kB] Get: 71 http://deb.debian.org/debian bullseye/main armhf libpython3.9-dev armhf 3.9.2-1 [3160 kB] Get: 72 http://deb.debian.org/debian bullseye/main armhf libpython3-dev armhf 3.9.2-3 [21.7 kB] Get: 73 http://deb.debian.org/debian bullseye/main armhf libwebp6 armhf 0.6.1-2.1 [226 kB] Get: 74 http://deb.debian.org/debian bullseye/main armhf libtiff5 armhf 4.2.0-1 [271 kB] Get: 75 http://deb.debian.org/debian bullseye/main armhf libwebpdemux2 armhf 0.6.1-2.1 [86.7 kB] Get: 76 http://deb.debian.org/debian bullseye/main armhf libwebpmux3 armhf 0.6.1-2.1 [94.2 kB] Get: 77 http://deb.debian.org/debian bullseye/main armhf libxau6 armhf 1:1.0.9-1 [19.0 kB] Get: 78 http://deb.debian.org/debian bullseye/main armhf libxdmcp6 armhf 1:1.1.2-3 [24.9 kB] Get: 79 http://deb.debian.org/debian bullseye/main armhf libxcb1 armhf 1.14-3 [136 kB] Get: 80 http://deb.debian.org/debian bullseye/main armhf ttf-bitstream-vera all 1.10-8.1 [223 kB] Get: 81 http://deb.debian.org/debian bullseye/main armhf python-matplotlib-data all 3.3.4-1 [4153 kB] Get: 82 http://deb.debian.org/debian bullseye/main armhf python3-six all 1.16.0-1 [17.1 kB] Get: 83 http://deb.debian.org/debian bullseye/main armhf python3-cycler all 0.10.0-3 [8084 B] Get: 84 http://deb.debian.org/debian bullseye/main armhf python3-dateutil all 2.8.1-5 [81.7 kB] Get: 85 http://deb.debian.org/debian bullseye/main armhf python3-decorator all 4.4.2-2 [15.8 kB] Get: 86 http://deb.debian.org/debian bullseye/main armhf zlib1g-dev armhf 1:1.2.11.dfsg-2 [185 kB] Get: 87 http://deb.debian.org/debian bullseye/main armhf python3.9-dev armhf 3.9.2-1 [515 kB] Get: 88 http://deb.debian.org/debian bullseye/main armhf python3-dev armhf 3.9.2-3 [24.8 kB] Get: 89 http://deb.debian.org/debian bullseye/main armhf python3-kiwisolver armhf 1.3.1-1+b1 [46.7 kB] Get: 90 http://deb.debian.org/debian bullseye/main armhf python3-pyparsing all 2.4.7-1 [109 kB] Get: 91 http://deb.debian.org/debian bullseye/main armhf python3-pkg-resources all 52.0.0-4 [190 kB] Get: 92 http://deb.debian.org/debian bullseye/main armhf python3-numpy armhf 1:1.19.5-1 [2981 kB] Get: 93 http://deb.debian.org/debian bullseye/main armhf python3-pil armhf 8.1.2+dfsg-0.2 [414 kB] Get: 94 http://deb.debian.org/debian bullseye/main armhf python3-matplotlib armhf 3.3.4-1 [4111 kB] Get: 95 http://deb.debian.org/debian bullseye/main armhf python3-tz all 2021.1-1 [34.8 kB] Get: 96 http://deb.debian.org/debian bullseye/main armhf python3-pandas-lib armhf 1.1.5+dfsg-2 [3026 kB] Get: 97 http://deb.debian.org/debian bullseye/main armhf python3-pandas all 1.1.5+dfsg-2 [2096 kB] Get: 98 http://deb.debian.org/debian bullseye/main armhf python3-patsy all 0.5.1-3 [172 kB] Get: 99 http://deb.debian.org/debian bullseye/main armhf python3-pubsub all 4.0.3-4 [46.6 kB] Get: 100 http://deb.debian.org/debian bullseye/main armhf python3-scipy armhf 1.6.0-2 [11.3 MB] Get: 101 http://deb.debian.org/debian bullseye/main armhf python3-setuptools all 52.0.0-4 [366 kB] Get: 102 http://deb.debian.org/debian bullseye/main armhf python3-statsmodels-lib armhf 0.12.2-1 [1192 kB] Get: 103 http://deb.debian.org/debian bullseye/main armhf python3-statsmodels all 0.12.2-1 [4455 kB] Fetched 69.0 MB in 6s (10.7 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package bsdextrautils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19398 files and directories currently installed.) Preparing to unpack .../0-bsdextrautils_2.36.1-7_armhf.deb ... Unpacking bsdextrautils (2.36.1-7) ... Selecting previously unselected package libuchardet0:armhf. Preparing to unpack .../1-libuchardet0_0.0.7-1_armhf.deb ... Unpacking libuchardet0:armhf (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../2-groff-base_1.22.4-6_armhf.deb ... Unpacking groff-base (1.22.4-6) ... Selecting previously unselected package libpipeline1:armhf. Preparing to unpack .../3-libpipeline1_1.5.3-1_armhf.deb ... Unpacking libpipeline1:armhf (1.5.3-1) ... Selecting previously unselected package man-db. Preparing to unpack .../4-man-db_2.9.4-2_armhf.deb ... Unpacking man-db (2.9.4-2) ... Selecting previously unselected package libpython3.9-minimal:armhf. Preparing to unpack .../5-libpython3.9-minimal_3.9.2-1_armhf.deb ... Unpacking libpython3.9-minimal:armhf (3.9.2-1) ... Selecting previously unselected package libexpat1:armhf. Preparing to unpack .../6-libexpat1_2.2.10-2_armhf.deb ... Unpacking libexpat1:armhf (2.2.10-2) ... Selecting previously unselected package python3.9-minimal. Preparing to unpack .../7-python3.9-minimal_3.9.2-1_armhf.deb ... Unpacking python3.9-minimal (3.9.2-1) ... Setting up libpython3.9-minimal:armhf (3.9.2-1) ... Setting up libexpat1:armhf (2.2.10-2) ... Setting up python3.9-minimal (3.9.2-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20265 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.9.2-3_armhf.deb ... Unpacking python3-minimal (3.9.2-3) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_4.0.0_all.deb ... Unpacking media-types (4.0.0) ... Selecting previously unselected package mailcap. Preparing to unpack .../2-mailcap_3.69_all.deb ... Unpacking mailcap (3.69) ... Selecting previously unselected package mime-support. Preparing to unpack .../3-mime-support_3.66_all.deb ... Unpacking mime-support (3.66) ... Selecting previously unselected package libmpdec3:armhf. Preparing to unpack .../4-libmpdec3_2.5.1-1_armhf.deb ... Unpacking libmpdec3:armhf (2.5.1-1) ... Selecting previously unselected package readline-common. Preparing to unpack .../5-readline-common_8.1-1_all.deb ... Unpacking readline-common (8.1-1) ... Selecting previously unselected package libreadline8:armhf. Preparing to unpack .../6-libreadline8_8.1-1_armhf.deb ... Unpacking libreadline8:armhf (8.1-1) ... Selecting previously unselected package libpython3.9-stdlib:armhf. Preparing to unpack .../7-libpython3.9-stdlib_3.9.2-1_armhf.deb ... Unpacking libpython3.9-stdlib:armhf (3.9.2-1) ... Selecting previously unselected package python3.9. Preparing to unpack .../8-python3.9_3.9.2-1_armhf.deb ... Unpacking python3.9 (3.9.2-1) ... Selecting previously unselected package libpython3-stdlib:armhf. Preparing to unpack .../9-libpython3-stdlib_3.9.2-3_armhf.deb ... Unpacking libpython3-stdlib:armhf (3.9.2-3) ... Setting up python3-minimal (3.9.2-3) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20710 files and directories currently installed.) Preparing to unpack .../00-python3_3.9.2-3_armhf.deb ... Unpacking python3 (3.9.2-3) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.14_all.deb ... Unpacking sensible-utils (0.0.14) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.39-3_armhf.deb ... Unpacking libmagic-mgc (1:5.39-3) ... Selecting previously unselected package libmagic1:armhf. Preparing to unpack .../03-libmagic1_1%3a5.39-3_armhf.deb ... Unpacking libmagic1:armhf (1:5.39-3) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.39-3_armhf.deb ... Unpacking file (1:5.39-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.21-4_armhf.deb ... Unpacking gettext-base (0.21-4) ... Selecting previously unselected package libsigsegv2:armhf. Preparing to unpack .../06-libsigsegv2_2.13-1_armhf.deb ... Unpacking libsigsegv2:armhf (2.13-1) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-5_armhf.deb ... Unpacking m4 (1.4.18-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../08-autoconf_2.69-14_all.deb ... Unpacking autoconf (2.69-14) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../09-autotools-dev_20180224.1+nmu1_all.deb ... Unpacking autotools-dev (20180224.1+nmu1) ... Selecting previously unselected package automake. Preparing to unpack .../10-automake_1%3a1.16.3-2_all.deb ... Unpacking automake (1:1.16.3-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../11-autopoint_0.21-4_all.deb ... Unpacking autopoint (0.21-4) ... Selecting previously unselected package bwa. Preparing to unpack .../12-bwa_0.7.17-6+b1_armhf.deb ... Unpacking bwa (0.7.17-6+b1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../13-libdebhelper-perl_13.3.4_all.deb ... Unpacking libdebhelper-perl (13.3.4) ... Selecting previously unselected package libtool. Preparing to unpack .../14-libtool_2.4.6-15_all.deb ... Unpacking libtool (2.4.6-15) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../15-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../16-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../17-libsub-override-perl_0.09-2_all.deb ... Unpacking libsub-override-perl (0.09-2) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../18-libfile-stripnondeterminism-perl_1.11.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.11.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../19-dh-strip-nondeterminism_1.11.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.11.0-1) ... Selecting previously unselected package libelf1:armhf. Preparing to unpack .../20-libelf1_0.183-1_armhf.deb ... Unpacking libelf1:armhf (0.183-1) ... Selecting previously unselected package dwz. Preparing to unpack .../21-dwz_0.13+20210201-1_armhf.deb ... Unpacking dwz (0.13+20210201-1) ... Selecting previously unselected package libicu67:armhf. Preparing to unpack .../22-libicu67_67.1-7_armhf.deb ... Unpacking libicu67:armhf (67.1-7) ... Selecting previously unselected package libxml2:armhf. Preparing to unpack .../23-libxml2_2.9.10+dfsg-6.7_armhf.deb ... Unpacking libxml2:armhf (2.9.10+dfsg-6.7) ... Selecting previously unselected package gettext. Preparing to unpack .../24-gettext_0.21-4_armhf.deb ... Unpacking gettext (0.21-4) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../25-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../26-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../27-debhelper_13.3.4_all.deb ... Unpacking debhelper (13.3.4) ... Selecting previously unselected package python3-lib2to3. Preparing to unpack .../28-python3-lib2to3_3.9.2-1_all.deb ... Unpacking python3-lib2to3 (3.9.2-1) ... Selecting previously unselected package python3-distutils. Preparing to unpack .../29-python3-distutils_3.9.2-1_all.deb ... Unpacking python3-distutils (3.9.2-1) ... Selecting previously unselected package dh-python. Preparing to unpack .../30-dh-python_4.20201102+nmu1_all.deb ... Unpacking dh-python (4.20201102+nmu1) ... Selecting previously unselected package fonts-lyx. Preparing to unpack .../31-fonts-lyx_2.3.6-1_all.deb ... Unpacking fonts-lyx (2.3.6-1) ... Selecting previously unselected package libblas3:armhf. Preparing to unpack .../32-libblas3_3.9.0-3_armhf.deb ... Unpacking libblas3:armhf (3.9.0-3) ... Selecting previously unselected package libbrotli1:armhf. Preparing to unpack .../33-libbrotli1_1.0.9-2+b2_armhf.deb ... Unpacking libbrotli1:armhf (1.0.9-2+b2) ... Selecting previously unselected package libmd0:armhf. Preparing to unpack .../34-libmd0_1.0.3-3_armhf.deb ... Unpacking libmd0:armhf (1.0.3-3) ... Selecting previously unselected package libbsd0:armhf. Preparing to unpack .../35-libbsd0_0.11.3-1_armhf.deb ... Unpacking libbsd0:armhf (0.11.3-1) ... Selecting previously unselected package libdeflate0:armhf. Preparing to unpack .../36-libdeflate0_1.7-1_armhf.deb ... Unpacking libdeflate0:armhf (1.7-1) ... Selecting previously unselected package libexpat1-dev:armhf. Preparing to unpack .../37-libexpat1-dev_2.2.10-2_armhf.deb ... Unpacking libexpat1-dev:armhf (2.2.10-2) ... Selecting previously unselected package libpng16-16:armhf. Preparing to unpack .../38-libpng16-16_1.6.37-3_armhf.deb ... Unpacking libpng16-16:armhf (1.6.37-3) ... Selecting previously unselected package libfreetype6:armhf. Preparing to unpack .../39-libfreetype6_2.10.4+dfsg-1_armhf.deb ... Unpacking libfreetype6:armhf (2.10.4+dfsg-1) ... Selecting previously unselected package libgfortran5:armhf. Preparing to unpack .../40-libgfortran5_10.2.1-6_armhf.deb ... Unpacking libgfortran5:armhf (10.2.1-6) ... Selecting previously unselected package libimagequant0:armhf. Preparing to unpack .../41-libimagequant0_2.12.2-1.1_armhf.deb ... Unpacking libimagequant0:armhf (2.12.2-1.1) ... Selecting previously unselected package libjbig0:armhf. Preparing to unpack .../42-libjbig0_2.1-3.1+b2_armhf.deb ... Unpacking libjbig0:armhf (2.1-3.1+b2) ... Selecting previously unselected package libjpeg62-turbo:armhf. Preparing to unpack .../43-libjpeg62-turbo_1%3a2.0.6-4_armhf.deb ... Unpacking libjpeg62-turbo:armhf (1:2.0.6-4) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../44-libjs-jquery_3.5.1+dfsg+~3.5.5-7_all.deb ... Unpacking libjs-jquery (3.5.1+dfsg+~3.5.5-7) ... Selecting previously unselected package libjs-jquery-ui. Preparing to unpack .../45-libjs-jquery-ui_1.12.1+dfsg-8_all.deb ... Unpacking libjs-jquery-ui (1.12.1+dfsg-8) ... Selecting previously unselected package libjs-underscore. Preparing to unpack .../46-libjs-underscore_1.9.1~dfsg-3_all.deb ... Unpacking libjs-underscore (1.9.1~dfsg-3) ... Selecting previously unselected package libjs-sphinxdoc. Preparing to unpack .../47-libjs-sphinxdoc_3.4.3-2_all.deb ... Unpacking libjs-sphinxdoc (3.4.3-2) ... Selecting previously unselected package liblapack3:armhf. Preparing to unpack .../48-liblapack3_3.9.0-3_armhf.deb ... Unpacking liblapack3:armhf (3.9.0-3) ... Selecting previously unselected package liblbfgsb0:armhf. Preparing to unpack .../49-liblbfgsb0_3.0+dfsg.3-9_armhf.deb ... Unpacking liblbfgsb0:armhf (3.0+dfsg.3-9) ... Selecting previously unselected package liblcms2-2:armhf. Preparing to unpack .../50-liblcms2-2_2.12~rc1-2_armhf.deb ... Unpacking liblcms2-2:armhf (2.12~rc1-2) ... Selecting previously unselected package libpython3.9:armhf. Preparing to unpack .../51-libpython3.9_3.9.2-1_armhf.deb ... Unpacking libpython3.9:armhf (3.9.2-1) ... Selecting previously unselected package libpython3.9-dev:armhf. Preparing to unpack .../52-libpython3.9-dev_3.9.2-1_armhf.deb ... Unpacking libpython3.9-dev:armhf (3.9.2-1) ... Selecting previously unselected package libpython3-dev:armhf. Preparing to unpack .../53-libpython3-dev_3.9.2-3_armhf.deb ... Unpacking libpython3-dev:armhf (3.9.2-3) ... Selecting previously unselected package libwebp6:armhf. Preparing to unpack .../54-libwebp6_0.6.1-2.1_armhf.deb ... Unpacking libwebp6:armhf (0.6.1-2.1) ... Selecting previously unselected package libtiff5:armhf. Preparing to unpack .../55-libtiff5_4.2.0-1_armhf.deb ... Unpacking libtiff5:armhf (4.2.0-1) ... Selecting previously unselected package libwebpdemux2:armhf. Preparing to unpack .../56-libwebpdemux2_0.6.1-2.1_armhf.deb ... Unpacking libwebpdemux2:armhf (0.6.1-2.1) ... Selecting previously unselected package libwebpmux3:armhf. Preparing to unpack .../57-libwebpmux3_0.6.1-2.1_armhf.deb ... Unpacking libwebpmux3:armhf (0.6.1-2.1) ... Selecting previously unselected package libxau6:armhf. Preparing to unpack .../58-libxau6_1%3a1.0.9-1_armhf.deb ... Unpacking libxau6:armhf (1:1.0.9-1) ... Selecting previously unselected package libxdmcp6:armhf. Preparing to unpack .../59-libxdmcp6_1%3a1.1.2-3_armhf.deb ... Unpacking libxdmcp6:armhf (1:1.1.2-3) ... Selecting previously unselected package libxcb1:armhf. Preparing to unpack .../60-libxcb1_1.14-3_armhf.deb ... Unpacking libxcb1:armhf (1.14-3) ... Selecting previously unselected package ttf-bitstream-vera. Preparing to unpack .../61-ttf-bitstream-vera_1.10-8.1_all.deb ... Unpacking ttf-bitstream-vera (1.10-8.1) ... Selecting previously unselected package python-matplotlib-data. Preparing to unpack .../62-python-matplotlib-data_3.3.4-1_all.deb ... Unpacking python-matplotlib-data (3.3.4-1) ... Selecting previously unselected package python3-six. Preparing to unpack .../63-python3-six_1.16.0-1_all.deb ... Unpacking python3-six (1.16.0-1) ... Selecting previously unselected package python3-cycler. Preparing to unpack .../64-python3-cycler_0.10.0-3_all.deb ... Unpacking python3-cycler (0.10.0-3) ... Selecting previously unselected package python3-dateutil. Preparing to unpack .../65-python3-dateutil_2.8.1-5_all.deb ... Unpacking python3-dateutil (2.8.1-5) ... Selecting previously unselected package python3-decorator. Preparing to unpack .../66-python3-decorator_4.4.2-2_all.deb ... Unpacking python3-decorator (4.4.2-2) ... Selecting previously unselected package zlib1g-dev:armhf. Preparing to unpack .../67-zlib1g-dev_1%3a1.2.11.dfsg-2_armhf.deb ... Unpacking zlib1g-dev:armhf (1:1.2.11.dfsg-2) ... Selecting previously unselected package python3.9-dev. Preparing to unpack .../68-python3.9-dev_3.9.2-1_armhf.deb ... Unpacking python3.9-dev (3.9.2-1) ... Selecting previously unselected package python3-dev. Preparing to unpack .../69-python3-dev_3.9.2-3_armhf.deb ... Unpacking python3-dev (3.9.2-3) ... Selecting previously unselected package python3-kiwisolver. Preparing to unpack .../70-python3-kiwisolver_1.3.1-1+b1_armhf.deb ... Unpacking python3-kiwisolver (1.3.1-1+b1) ... Selecting previously unselected package python3-pyparsing. Preparing to unpack .../71-python3-pyparsing_2.4.7-1_all.deb ... Unpacking python3-pyparsing (2.4.7-1) ... Selecting previously unselected package python3-pkg-resources. Preparing to unpack .../72-python3-pkg-resources_52.0.0-4_all.deb ... Unpacking python3-pkg-resources (52.0.0-4) ... Selecting previously unselected package python3-numpy. Preparing to unpack .../73-python3-numpy_1%3a1.19.5-1_armhf.deb ... Unpacking python3-numpy (1:1.19.5-1) ... Selecting previously unselected package python3-pil:armhf. Preparing to unpack .../74-python3-pil_8.1.2+dfsg-0.2_armhf.deb ... Unpacking python3-pil:armhf (8.1.2+dfsg-0.2) ... Selecting previously unselected package python3-matplotlib. Preparing to unpack .../75-python3-matplotlib_3.3.4-1_armhf.deb ... Unpacking python3-matplotlib (3.3.4-1) ... Selecting previously unselected package python3-tz. Preparing to unpack .../76-python3-tz_2021.1-1_all.deb ... Unpacking python3-tz (2021.1-1) ... Selecting previously unselected package python3-pandas-lib:armhf. Preparing to unpack .../77-python3-pandas-lib_1.1.5+dfsg-2_armhf.deb ... Unpacking python3-pandas-lib:armhf (1.1.5+dfsg-2) ... Selecting previously unselected package python3-pandas. Preparing to unpack .../78-python3-pandas_1.1.5+dfsg-2_all.deb ... Unpacking python3-pandas (1.1.5+dfsg-2) ... Selecting previously unselected package python3-patsy. Preparing to unpack .../79-python3-patsy_0.5.1-3_all.deb ... Unpacking python3-patsy (0.5.1-3) ... Selecting previously unselected package python3-pubsub. Preparing to unpack .../80-python3-pubsub_4.0.3-4_all.deb ... Unpacking python3-pubsub (4.0.3-4) ... Selecting previously unselected package python3-scipy. Preparing to unpack .../81-python3-scipy_1.6.0-2_armhf.deb ... Unpacking python3-scipy (1.6.0-2) ... Selecting previously unselected package python3-setuptools. Preparing to unpack .../82-python3-setuptools_52.0.0-4_all.deb ... Unpacking python3-setuptools (52.0.0-4) ... Selecting previously unselected package python3-statsmodels-lib:armhf. Preparing to unpack .../83-python3-statsmodels-lib_0.12.2-1_armhf.deb ... Unpacking python3-statsmodels-lib:armhf (0.12.2-1) ... Selecting previously unselected package python3-statsmodels. Preparing to unpack .../84-python3-statsmodels_0.12.2-1_all.deb ... Unpacking python3-statsmodels (0.12.2-1) ... Setting up media-types (4.0.0) ... Setting up libpipeline1:armhf (1.5.3-1) ... Setting up liblcms2-2:armhf (2.12~rc1-2) ... Setting up libxau6:armhf (1:1.0.9-1) ... Setting up ttf-bitstream-vera (1.10-8.1) ... Setting up bsdextrautils (2.36.1-7) ... update-alternatives: using /usr/bin/write.ul to provide /usr/bin/write (write) in auto mode Setting up libicu67:armhf (67.1-7) ... Setting up libmagic-mgc (1:5.39-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up bwa (0.7.17-6+b1) ... Setting up fonts-lyx (2.3.6-1) ... Setting up libdebhelper-perl (13.3.4) ... Setting up libbrotli1:armhf (1.0.9-2+b2) ... Setting up libmagic1:armhf (1:5.39-3) ... Setting up libdeflate0:armhf (1.7-1) ... Setting up gettext-base (0.21-4) ... Setting up file (1:5.39-3) ... Setting up libjbig0:armhf (2.1-3.1+b2) ... Setting up autotools-dev (20180224.1+nmu1) ... Setting up libblas3:armhf (3.9.0-3) ... update-alternatives: using /usr/lib/arm-linux-gnueabihf/blas/libblas.so.3 to provide /usr/lib/arm-linux-gnueabihf/libblas.so.3 (libblas.so.3-arm-linux-gnueabihf) in auto mode Setting up libexpat1-dev:armhf (2.2.10-2) ... Setting up libjpeg62-turbo:armhf (1:2.0.6-4) ... Setting up libsigsegv2:armhf (2.13-1) ... Setting up libimagequant0:armhf (2.12.2-1.1) ... Setting up libpng16-16:armhf (1.6.37-3) ... Setting up autopoint (0.21-4) ... Setting up libwebp6:armhf (0.6.1-2.1) ... Setting up libgfortran5:armhf (10.2.1-6) ... Setting up zlib1g-dev:armhf (1:1.2.11.dfsg-2) ... Setting up libmd0:armhf (1.0.3-3) ... Setting up sensible-utils (0.0.14) ... Setting up libuchardet0:armhf (0.0.7-1) ... Setting up libmpdec3:armhf (2.5.1-1) ... Setting up libsub-override-perl (0.09-2) ... Setting up libtiff5:armhf (4.2.0-1) ... Setting up libjs-jquery (3.5.1+dfsg+~3.5.5-7) ... Setting up python-matplotlib-data (3.3.4-1) ... Setting up libwebpmux3:armhf (0.6.1-2.1) ... Setting up libbsd0:armhf (0.11.3-1) ... Setting up mailcap (3.69) ... Setting up libelf1:armhf (0.183-1) ... Setting up readline-common (8.1-1) ... Setting up libxml2:armhf (2.9.10+dfsg-6.7) ... Setting up libjs-underscore (1.9.1~dfsg-3) ... Setting up libfile-stripnondeterminism-perl (1.11.0-1) ... Setting up libxdmcp6:armhf (1:1.1.2-3) ... Setting up liblapack3:armhf (3.9.0-3) ... update-alternatives: using /usr/lib/arm-linux-gnueabihf/lapack/liblapack.so.3 to provide /usr/lib/arm-linux-gnueabihf/liblapack.so.3 (liblapack.so.3-arm-linux-gnueabihf) in auto mode Setting up libxcb1:armhf (1.14-3) ... Setting up gettext (0.21-4) ... Setting up mime-support (3.66) ... Setting up libtool (2.4.6-15) ... Setting up libwebpdemux2:armhf (0.6.1-2.1) ... Setting up libreadline8:armhf (8.1-1) ... Setting up m4 (1.4.18-5) ... Setting up intltool-debian (0.35.0+20060710.5) ... Setting up libjs-jquery-ui (1.12.1+dfsg-8) ... Setting up libfreetype6:armhf (2.10.4+dfsg-1) ... Setting up libjs-sphinxdoc (3.4.3-2) ... Setting up autoconf (2.69-14) ... Setting up dh-strip-nondeterminism (1.11.0-1) ... Setting up dwz (0.13+20210201-1) ... Setting up groff-base (1.22.4-6) ... Setting up libpython3.9-stdlib:armhf (3.9.2-1) ... Setting up libpython3-stdlib:armhf (3.9.2-3) ... Setting up liblbfgsb0:armhf (3.0+dfsg.3-9) ... Setting up automake (1:1.16.3-2) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up po-debconf (1.0.21+nmu1) ... Setting up man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. Setting up dh-autoreconf (20) ... Setting up libpython3.9:armhf (3.9.2-1) ... Setting up python3.9 (3.9.2-1) ... Setting up libpython3.9-dev:armhf (3.9.2-1) ... Setting up debhelper (13.3.4) ... Setting up python3 (3.9.2-3) ... Setting up python3-tz (2021.1-1) ... Setting up python3-six (1.16.0-1) ... Setting up python3-pil:armhf (8.1.2+dfsg-0.2) ... Setting up python3-decorator (4.4.2-2) ... Setting up python3-pyparsing (2.4.7-1) ... Setting up python3-cycler (0.10.0-3) ... Setting up python3-kiwisolver (1.3.1-1+b1) ... Setting up python3-pubsub (4.0.3-4) ... Setting up python3.9-dev (3.9.2-1) ... Setting up python3-dateutil (2.8.1-5) ... Setting up python3-lib2to3 (3.9.2-1) ... Setting up python3-pkg-resources (52.0.0-4) ... Setting up python3-distutils (3.9.2-1) ... Setting up dh-python (4.20201102+nmu1) ... Setting up libpython3-dev:armhf (3.9.2-3) ... Setting up python3-setuptools (52.0.0-4) ... Setting up python3-dev (3.9.2-3) ... Setting up python3-numpy (1:1.19.5-1) ... Setting up python3-statsmodels-lib:armhf (0.12.2-1) ... Setting up python3-matplotlib (3.3.4-1) ... Setting up python3-scipy (1.6.0-2) ... Setting up python3-pandas-lib:armhf (1.1.5+dfsg-2) ... Setting up python3-patsy (0.5.1-3) ... Setting up python3-pandas (1.1.5+dfsg-2) ... Setting up python3-statsmodels (0.12.2-1) ... Processing triggers for libc-bin (2.31-12) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... The following additional packages will be installed: libfile-find-rule-perl libnumber-compare-perl libtext-glob-perl The following NEW packages will be installed: libfile-find-rule-perl libnumber-compare-perl libtext-glob-perl usrmerge 0 upgraded, 4 newly installed, 0 to remove and 0 not upgraded. Need to get 59.5 kB of archives. After this operation, 157 kB of additional disk space will be used. Get:1 http://deb.debian.org/debian bullseye/main armhf libnumber-compare-perl all 0.03-1.1 [6956 B] Get:2 http://deb.debian.org/debian bullseye/main armhf libtext-glob-perl all 0.11-1 [8888 B] Get:3 http://deb.debian.org/debian bullseye/main armhf libfile-find-rule-perl all 0.34-1 [30.6 kB] Get:4 http://deb.debian.org/debian bullseye/main armhf usrmerge all 25 [13.0 kB] debconf: delaying package configuration, since apt-utils is not installed Fetched 59.5 kB in 0s (446 kB/s) Selecting previously unselected package libnumber-compare-perl. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 28532 files and directories currently installed.) Preparing to unpack .../libnumber-compare-perl_0.03-1.1_all.deb ... Unpacking libnumber-compare-perl (0.03-1.1) ... Selecting previously unselected package libtext-glob-perl. Preparing to unpack .../libtext-glob-perl_0.11-1_all.deb ... Unpacking libtext-glob-perl (0.11-1) ... Selecting previously unselected package libfile-find-rule-perl. Preparing to unpack .../libfile-find-rule-perl_0.34-1_all.deb ... Unpacking libfile-find-rule-perl (0.34-1) ... Selecting previously unselected package usrmerge. Preparing to unpack .../archives/usrmerge_25_all.deb ... Unpacking usrmerge (25) ... Setting up libtext-glob-perl (0.11-1) ... Setting up libnumber-compare-perl (0.03-1.1) ... Setting up libfile-find-rule-perl (0.34-1) ... Setting up usrmerge (25) ... The system has been successfully converted. Processing triggers for man-db (2.9.4-2) ... Not building database; man-db/auto-update is not 'true'. I: Building the package hostname: Name or service not known I: Running cd /build/tnseq-transit-3.2.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../tnseq-transit_3.2.1-1_source.changes dpkg-buildpackage: info: source package tnseq-transit dpkg-buildpackage: info: source version 3.2.1-1 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Nilesh Patra dpkg-source --before-build . dpkg-buildpackage: info: host architecture armhf debian/rules clean dh clean --with python3 --buildsystem=pybuild debian/rules override_dh_auto_clean make[1]: ingresso nella directory «/build/tnseq-transit-3.2.1» dh_auto_clean I: pybuild base:232: python3.9 setup.py clean running clean removing '/build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build' (and everything under it) 'build/bdist.linux-armhf' does not exist -- can't clean it 'build/scripts-3.9' does not exist -- can't clean it rm -rf tests_invalid_data rm -rf tnseq_transit.egg-info make[1]: uscita dalla directory «/build/tnseq-transit-3.2.1» dh_autoreconf_clean -O--buildsystem=pybuild dh_clean -O--buildsystem=pybuild debian/rules binary dh binary --with python3 --buildsystem=pybuild dh_update_autotools_config -O--buildsystem=pybuild dh_autoreconf -O--buildsystem=pybuild debian/rules override_dh_auto_configure make[1]: ingresso nella directory «/build/tnseq-transit-3.2.1» mkdir -p tests_invalid_data mv tests/H37Rv.fna tests_invalid_data dh_auto_configure I: pybuild base:232: python3.9 setup.py config running config make[1]: uscita dalla directory «/build/tnseq-transit-3.2.1» dh_auto_build -O--buildsystem=pybuild I: pybuild base:232: /usr/bin/python3 setup.py build running build running build_py creating /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp copying src/pytpp/tpp_gui.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp copying src/pytpp/tpp_tools.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp copying src/pytpp/__main__.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp copying src/pytpp/__init__.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp creating /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/trash.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/stat_tools.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/norm_tools.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/fileDisplay.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/view_trash.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/draw_trash.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/qcDisplay.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/images.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/transit_gui.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/transit_tools.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/__main__.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/__init__.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit copying src/pytransit/tnseq_tools.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit creating /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/convert copying src/pytransit/convert/base.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/convert copying src/pytransit/convert/__init__.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/convert copying src/pytransit/convert/gff_to_prot_table.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/convert creating /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/rankproduct.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/anova.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/base.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/gi.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/example.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/corrplot.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/tn5gaps.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/normalize.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/tnseq_stats.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/binomial.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/heatmap.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/utest.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/griffin.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/pathway_enrichment.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/gumbel.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/__init__.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/hmm.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/zinb.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/resampling.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis copying src/pytransit/analysis/norm.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis creating /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export copying src/pytransit/export/base.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export copying src/pytransit/export/igv.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export copying src/pytransit/export/prot_table.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export copying src/pytransit/export/mean_counts.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export copying src/pytransit/export/__init__.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export copying src/pytransit/export/combined_wig.py -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export running egg_info creating tnseq_transit.egg-info writing tnseq_transit.egg-info/PKG-INFO writing dependency_links to tnseq_transit.egg-info/dependency_links.txt writing entry points to tnseq_transit.egg-info/entry_points.txt writing requirements to tnseq_transit.egg-info/requires.txt writing top-level names to tnseq_transit.egg-info/top_level.txt writing manifest file 'tnseq_transit.egg-info/SOURCES.txt' reading manifest file 'tnseq_transit.egg-info/SOURCES.txt' reading manifest template 'MANIFEST.in' warning: no files found matching 'VERSION' warning: no files found matching '*.html' under directory 'src/pytransit/doc/build/html' warning: no files found matching '*.png' under directory 'src/pytransit/doc/build/html/_images' warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_modules' warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_static' writing manifest file 'tnseq_transit.egg-info/SOURCES.txt' creating /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/COG_roles.dat -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/GO_associated_Rvs-3-11-18.txt -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/GO_associated_Rvs.csv -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/GO_term_names.dat -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/GO_terms_for_each_Rv.obo-3-11-18.txt -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/H37Rv.sanger_associated_RVS.csv -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/H37Rv_COG_roles.dat -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/H37Rv_GO_terms.txt -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/H37Rv_sanger_roles.dat -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/README.md -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/cholesterol_H37Rv_merged.wig -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/cholesterol_H37Rv_rep1.wig -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/cholesterol_H37Rv_rep2.wig -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/cholesterol_H37Rv_rep3.wig -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/cholesterol_glycerol_combined.dat -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/gene_ontology.1_2.3-11-18.obo -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/glycerol_H37Rv_merged.wig -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/glycerol_H37Rv_rep1.wig -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/glycerol_H37Rv_rep2.wig -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/samples_metadata_cg.txt -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/samples_metadata_cg_covar.txt -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/samples_metadata_cg_interactions.txt -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/sanger_roles.dat -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data copying src/pytransit/data/smeg_GO_terms.txt -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data creating /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/BCG.fna -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/BCG.prot_table -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/H37Rv.fna -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/H37Rv.prot_table -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/H37RvBD.fna -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/H37RvBD.prot_table -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/H37RvBD_mod3.prot_table -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/H37RvMA2.fna -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/H37RvMA2.prot_table -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/genomes.html -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/mc2_155_tamu.fna -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes copying src/pytransit/genomes/mc2_155_tamu.prot_table -> /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes debian/rules override_dh_auto_test make[1]: ingresso nella directory «/build/tnseq-transit-3.2.1» dh_auto_test -- --system=custom --test-args="PYTHONPATH=tests {interpreter} -m unittest -v tests/*.py" I: pybuild base:232: PYTHONPATH=tests python3.9 -m unittest -v tests/*.py /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:648: SyntaxWarning: "is" with a literal. Did you mean "=="? if vars.num_replicons is 1: /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:651: SyntaxWarning: "is" with a literal. Did you mean "=="? elif len(vars.replicon_ids) is 1 and vars.replicon_ids[0].strip() == 'auto': test_Binomial (tests.test_analysis_methods.TestMethods) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.prot_table' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.prot_table' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.prot_table' mode='r' encoding='UTF-8'> for line in open(self.annotation): ResourceWarning: Enable tracemalloc to get the object allocation traceback #################### tests.test_analysis_methods.TestMethods.test_Binomial #################### [binomial] Starting Binomial Method [binomial] Getting Data [binomial] Setting Parameters [binomial] Setting Initial Values [binomial] Running Binomial Method... 0.2% [binomial] Running Binomial Method... 0.3% [binomial] Running Binomial Method... 0.4% [binomial] Running Binomial Method... 0.5% [binomial] Running Binomial Method... 0.5% [binomial] Running Binomial Method... 0.6% [binomial] Running Binomial Method... 0.7% [binomial] Running Binomial Method... 0.8% [binomial] Running Binomial Method... 0.9% [binomial] Running Binomial Method... 1.0% [binomial] Running Binomial Method... 1.1% [binomial] Running Binomial Method... 1.2% [binomial] Running Binomial Method... 1.3% [binomial] Running Binomial Method... 1.4% [binomial] Running Binomial Method... 1.5% [binomial] Running Binomial Method... 1.5% [binomial] Running Binomial Method... 1.6% [binomial] Running Binomial Method... 1.7% [binomial] Running Binomial Method... 1.8% [binomial] Running Binomial Method... 1.9% [binomial] Running Binomial Method... 2.0% [binomial] Running Binomial Method... 2.1% [binomial] Running Binomial Method... 2.2% [binomial] Running Binomial Method... 2.3% [binomial] Running Binomial Method... 2.4% [binomial] Running Binomial Method... 2.5% [binomial] Running Binomial Method... 2.5% [binomial] Running Binomial Method... 2.6% [binomial] Running Binomial Method... 2.7% [binomial] Running Binomial Method... 2.8% [binomial] Running Binomial Method... 2.9% [binomial] Running Binomial Method... 3.0% [binomial] Running Binomial Method... 3.1% [binomial] Running Binomial Method... 3.2% [binomial] Running Binomial Method... 3.3% [binomial] Running Binomial Method... 3.4% [binomial] Running Binomial Method... 3.5% [binomial] Running Binomial Method... 3.5% [binomial] Running Binomial Method... 3.6% [binomial] Running Binomial Method... 3.7% [binomial] Running Binomial Method... 3.8% [binomial] Running Binomial Method... 3.9% [binomial] Running Binomial Method... 4.0% [binomial] Running Binomial Method... 4.1% [binomial] Running Binomial Method... 4.2% [binomial] Running Binomial Method... 4.3% [binomial] Running Binomial Method... 4.4% [binomial] Running Binomial Method... 4.5% [binomial] Running Binomial Method... 4.5% [binomial] Running Binomial Method... 4.6% [binomial] Running Binomial Method... 4.7% [binomial] Running Binomial Method... 4.8% [binomial] Running Binomial Method... 4.9% [binomial] Running Binomial Method... 5.0% [binomial] Running Binomial Method... 5.1% [binomial] Running Binomial Method... 5.2% [binomial] Running Binomial Method... 5.3% [binomial] Running Binomial Method... 5.4% [binomial] Running Binomial Method... 5.5% [binomial] Running Binomial Method... 5.5% [binomial] Running Binomial Method... 5.6% [binomial] Running Binomial Method... 5.7% [binomial] Running Binomial Method... 5.8% [binomial] Running Binomial Method... 5.9% [binomial] Running Binomial Method... 6.0% [binomial] Running Binomial Method... 6.1% [binomial] Running Binomial Method... 6.2% [binomial] Running Binomial Method... 6.3% [binomial] Running Binomial Method... 6.4% [binomial] Running Binomial Method... 6.5% [binomial] Running Binomial Method... 6.5% [binomial] Running Binomial Method... 6.6% [binomial] Running Binomial Method... 6.7% [binomial] Running Binomial Method... 6.8% [binomial] Running Binomial Method... 6.9% [binomial] Running Binomial Method... 7.0% [binomial] Running Binomial Method... 7.1% [binomial] Running Binomial Method... 7.2% [binomial] Running Binomial Method... 7.3% [binomial] Running Binomial Method... 7.4% [binomial] Running Binomial Method... 7.5% [binomial] Running Binomial Method... 7.5% [binomial] Running Binomial Method... 7.6% [binomial] Running Binomial Method... 7.7% [binomial] Running Binomial Method... 7.8% [binomial] Running Binomial Method... 7.9% [binomial] Running Binomial Method... 8.0% [binomial] Running Binomial Method... 8.1% [binomial] Running Binomial Method... 8.2% [binomial] Running Binomial Method... 8.3% [binomial] Running Binomial Method... 8.4% [binomial] Running Binomial Method... 8.5% [binomial] Running Binomial Method... 8.5% [binomial] Running Binomial Method... 8.6% [binomial] Running Binomial Method... 8.7% [binomial] Running Binomial Method... 8.8% [binomial] Running Binomial Method... 8.9% [binomial] Running Binomial Method... 9.0% [binomial] Running Binomial Method... 9.1% [binomial] Running Binomial Method... 9.2% [binomial] Running Binomial Method... 9.3% [binomial] Running Binomial Method... 9.4% [binomial] Running Binomial Method... 9.5% [binomial] Running Binomial Method... 9.5% [binomial] Running Binomial Method... 9.6% [binomial] Running Binomial Method... 9.7% [binomial] Running Binomial Method... 9.8% [binomial] Running Binomial Method... 9.9% [binomial] Running Binomial Method... 10.0% [binomial] Running Binomial Method... 10.1% [binomial] Running Binomial Method... 10.2% [binomial] Running Binomial Method... 10.3% [binomial] Running Binomial Method... 10.4% [binomial] Running Binomial Method... 10.5% [binomial] Running Binomial Method... 10.5% [binomial] Running Binomial Method... 10.6% [binomial] Running Binomial Method... 10.7% [binomial] Running Binomial Method... 10.8% [binomial] Running Binomial Method... 10.9% [binomial] Running Binomial Method... 11.0% [binomial] Running Binomial Method... 11.1% [binomial] Running Binomial Method... 11.2% [binomial] Running Binomial Method... 11.3% [binomial] Running Binomial Method... 11.4% [binomial] Running Binomial Method... 11.5% [binomial] Running Binomial Method... 11.5% [binomial] Running Binomial Method... 11.6% [binomial] Running Binomial Method... 11.7% [binomial] Running Binomial Method... 11.8% [binomial] Running Binomial Method... 11.9% [binomial] Running Binomial Method... 12.0% [binomial] Running Binomial Method... 12.1% [binomial] Running Binomial Method... 12.2% [binomial] Running Binomial Method... 12.3% [binomial] Running Binomial Method... 12.4% [binomial] Running Binomial Method... 12.5% [binomial] Running Binomial Method... 12.5% [binomial] Running Binomial Method... 12.6% [binomial] Running Binomial Method... 12.7% [binomial] Running Binomial Method... 12.8% [binomial] Running Binomial Method... 12.9% [binomial] Running Binomial Method... 13.0% [binomial] Running Binomial Method... 13.1% [binomial] Running Binomial Method... 13.2% [binomial] Running Binomial Method... 13.3% [binomial] Running Binomial Method... 13.4% [binomial] Running Binomial Method... 13.5% [binomial] Running Binomial Method... 13.5% [binomial] Running Binomial Method... 13.6% [binomial] Running Binomial Method... 13.7% [binomial] Running Binomial Method... 13.8% [binomial] Running Binomial Method... 13.9% [binomial] Running Binomial Method... 14.0% [binomial] Running Binomial Method... 14.1% [binomial] Running Binomial Method... 14.2% [binomial] Running Binomial Method... 14.3% [binomial] Running Binomial Method... 14.4% [binomial] Running Binomial Method... 14.5% [binomial] Running Binomial Method... 14.5% [binomial] Running Binomial Method... 14.6% [binomial] Running Binomial Method... 14.7% [binomial] Running Binomial Method... 14.8% [binomial] Running Binomial Method... 14.9% [binomial] Running Binomial Method... 15.0% [binomial] Running Binomial Method... 15.1% [binomial] Running Binomial Method... 15.2% [binomial] Running Binomial Method... 15.3% [binomial] Running Binomial Method... 15.4% [binomial] Running Binomial Method... 15.5% [binomial] Running Binomial Method... 15.5% [binomial] Running Binomial Method... 15.6% [binomial] Running Binomial Method... 15.7% [binomial] Running Binomial Method... 15.8% [binomial] Running Binomial Method... 15.9% [binomial] Running Binomial Method... 16.0% [binomial] Running Binomial Method... 16.1% [binomial] Running Binomial Method... 16.2% [binomial] Running Binomial Method... 16.3% [binomial] Running Binomial Method... 16.4% [binomial] Running Binomial Method... 16.5% [binomial] Running Binomial Method... 16.5% [binomial] Running Binomial Method... 16.6% [binomial] Running Binomial Method... 16.7% [binomial] Running Binomial Method... 16.8% [binomial] Running Binomial Method... 16.9% [binomial] Running Binomial Method... 17.0% [binomial] Running Binomial Method... 17.1% [binomial] Running Binomial Method... 17.2% [binomial] Running Binomial Method... 17.3% [binomial] Running Binomial Method... 17.4% [binomial] Running Binomial Method... 17.5% [binomial] Running Binomial Method... 17.5% [binomial] Running Binomial Method... 17.6% [binomial] Running Binomial Method... 17.7% [binomial] Running Binomial Method... 17.8% [binomial] Running Binomial Method... 17.9% [binomial] Running Binomial Method... 18.0% [binomial] Running Binomial Method... 18.1% [binomial] Running Binomial Method... 18.2% [binomial] Running Binomial Method... 18.3% [binomial] Running Binomial Method... 18.4% [binomial] Running Binomial Method... 18.5% [binomial] Running Binomial Method... 18.5% [binomial] Running Binomial Method... 18.6% [binomial] Running Binomial Method... 18.7% [binomial] Running Binomial Method... 18.8% [binomial] Running Binomial Method... 18.9% [binomial] Running Binomial Method... 19.0% [binomial] Running Binomial Method... 19.1% [binomial] Running Binomial Method... 19.2% [binomial] Running Binomial Method... 19.3% [binomial] Running Binomial Method... 19.4% [binomial] Running Binomial Method... 19.5% [binomial] Running Binomial Method... 19.5% [binomial] Running Binomial Method... 19.6% [binomial] Running Binomial Method... 19.7% [binomial] Running Binomial Method... 19.8% [binomial] Running Binomial Method... 19.9% [binomial] Running Binomial Method... 20.0% [binomial] Running Binomial Method... 20.1% [binomial] Running Binomial Method... 20.2% [binomial] Running Binomial Method... 20.3% [binomial] Running Binomial Method... 20.4% [binomial] Running Binomial Method... 20.5% [binomial] Running Binomial Method... 20.5% [binomial] Running Binomial Method... 20.6% [binomial] Running Binomial Method... 20.7% [binomial] Running Binomial Method... 20.8% [binomial] Running Binomial Method... 20.9% [binomial] Running Binomial Method... 21.0% [binomial] Running Binomial Method... 21.1% [binomial] Running Binomial Method... 21.2% [binomial] Running Binomial Method... 21.3% [binomial] Running Binomial Method... 21.4% [binomial] Running Binomial Method... 21.5% [binomial] Running Binomial Method... 21.5% [binomial] Running Binomial Method... 21.6% [binomial] Running Binomial Method... 21.7% [binomial] Running Binomial Method... 21.8% [binomial] Running Binomial Method... 21.9% [binomial] Running Binomial Method... 22.0% [binomial] Running Binomial Method... 22.1% [binomial] Running Binomial Method... 22.2% [binomial] Running Binomial Method... 22.3% [binomial] Running Binomial Method... 22.4% [binomial] Running Binomial Method... 22.5% [binomial] Running Binomial Method... 22.5% [binomial] Running Binomial Method... 22.6% [binomial] Running Binomial Method... 22.7% [binomial] Running Binomial Method... 22.8% [binomial] Running Binomial Method... 22.9% [binomial] Running Binomial Method... 23.0% [binomial] Running Binomial Method... 23.1% [binomial] Running Binomial Method... 23.2% [binomial] Running Binomial Method... 23.3% [binomial] Running Binomial Method... 23.4% [binomial] Running Binomial Method... 23.5% [binomial] Running Binomial Method... 23.5% [binomial] Running Binomial Method... 23.6% [binomial] Running Binomial Method... 23.7% [binomial] Running Binomial Method... 23.8% [binomial] Running Binomial Method... 23.9% [binomial] Running Binomial Method... 24.0% [binomial] Running Binomial Method... 24.1% [binomial] Running Binomial Method... 24.2% [binomial] Running Binomial Method... 24.3% [binomial] Running Binomial Method... 24.4% [binomial] Running Binomial Method... 24.5% [binomial] Running Binomial Method... 24.5% [binomial] Running Binomial Method... 24.6% [binomial] Running Binomial Method... 24.7% [binomial] Running Binomial Method... 24.8% [binomial] Running Binomial Method... 24.9% [binomial] Running Binomial Method... 25.0% [binomial] Running Binomial Method... 25.1% [binomial] Running Binomial Method... 25.2% [binomial] Running Binomial Method... 25.3% [binomial] Running Binomial Method... 25.4% [binomial] Running Binomial Method... 25.5% [binomial] Running Binomial Method... 25.5% [binomial] Running Binomial Method... 25.6% [binomial] Running Binomial Method... 25.7% [binomial] Running Binomial Method... 25.8% [binomial] Running Binomial Method... 25.9% [binomial] Running Binomial Method... 26.0% [binomial] Running Binomial Method... 26.1% [binomial] Running Binomial Method... 26.2% [binomial] Running Binomial Method... 26.3% [binomial] Running Binomial Method... 26.4% [binomial] Running Binomial Method... 26.5% [binomial] Running Binomial Method... 26.5% [binomial] Running Binomial Method... 26.6% [binomial] Running Binomial Method... 26.7% [binomial] Running Binomial Method... 26.8% [binomial] Running Binomial Method... 26.9% [binomial] Running Binomial Method... 27.0% [binomial] Running Binomial Method... 27.1% [binomial] Running Binomial Method... 27.2% [binomial] Running Binomial Method... 27.3% [binomial] Running Binomial Method... 27.4% [binomial] Running Binomial Method... 27.5% [binomial] Running Binomial Method... 27.5% [binomial] Running Binomial Method... 27.6% [binomial] Running Binomial Method... 27.7% [binomial] Running Binomial Method... 27.8% [binomial] Running Binomial Method... 27.9% [binomial] Running Binomial Method... 28.0% [binomial] Running Binomial Method... 28.1% [binomial] Running Binomial Method... 28.2% [binomial] Running Binomial Method... 28.3% [binomial] Running Binomial Method... 28.4% [binomial] Running Binomial Method... 28.5% [binomial] Running Binomial Method... 28.5% [binomial] Running Binomial Method... 28.6% [binomial] Running Binomial Method... 28.7% [binomial] Running Binomial Method... 28.8% [binomial] Running Binomial Method... 28.9% [binomial] Running Binomial Method... 29.0% [binomial] Running Binomial Method... 29.1% [binomial] Running Binomial Method... 29.2% [binomial] Running Binomial Method... 29.3% [binomial] Running Binomial Method... 29.4% [binomial] Running Binomial Method... 29.5% [binomial] Running Binomial Method... 29.5% [binomial] Running Binomial Method... 29.6% [binomial] Running Binomial Method... 29.7% [binomial] Running Binomial Method... 29.8% [binomial] Running Binomial Method... 29.9% [binomial] Running Binomial Method... 30.0% [binomial] Running Binomial Method... 30.1% [binomial] Running Binomial Method... 30.2% [binomial] Running Binomial Method... 30.3% [binomial] Running Binomial Method... 30.4% [binomial] Running Binomial Method... 30.5% [binomial] Running Binomial Method... 30.5% [binomial] Running Binomial Method... 30.6% [binomial] Running Binomial Method... 30.7% [binomial] Running Binomial Method... 30.8% [binomial] Running Binomial Method... 30.9% [binomial] Running Binomial Method... 31.0% [binomial] Running Binomial Method... 31.1% [binomial] Running Binomial Method... 31.2% [binomial] Running Binomial Method... 31.3% [binomial] Running Binomial Method... 31.4% [binomial] Running Binomial Method... 31.5% [binomial] Running Binomial Method... 31.5% [binomial] Running Binomial Method... 31.6% [binomial] Running Binomial Method... 31.7% [binomial] Running Binomial Method... 31.8% [binomial] Running Binomial Method... 31.9% [binomial] Running Binomial Method... 32.0% [binomial] Running Binomial Method... 32.1% [binomial] Running Binomial Method... 32.2% [binomial] Running Binomial Method... 32.3% [binomial] Running Binomial Method... 32.4% [binomial] Running Binomial Method... 32.5% [binomial] Running Binomial Method... 32.5% [binomial] Running Binomial Method... 32.6% [binomial] Running Binomial Method... 32.7% [binomial] Running Binomial Method... 32.8% [binomial] Running Binomial Method... 32.9% [binomial] Running Binomial Method... 33.0% [binomial] Running Binomial Method... 33.1% [binomial] Running Binomial Method... 33.2% [binomial] Running Binomial Method... 33.3% [binomial] Running Binomial Method... 33.4% [binomial] Running Binomial Method... 33.5% [binomial] Running Binomial Method... 33.5% [binomial] Running Binomial Method... 33.6% [binomial] Running Binomial Method... 33.7% [binomial] Running Binomial Method... 33.8% [binomial] Running Binomial Method... 33.9% [binomial] Running Binomial Method... 34.0% [binomial] Running Binomial Method... 34.1% [binomial] Running Binomial Method... 34.2% [binomial] Running Binomial Method... 34.3% [binomial] Running Binomial Method... 34.4% [binomial] Running Binomial Method... 34.5% [binomial] Running Binomial Method... 34.5% [binomial] Running Binomial Method... 34.6% [binomial] Running Binomial Method... 34.7% [binomial] Running Binomial Method... 34.8% [binomial] Running Binomial Method... 34.9% [binomial] Running Binomial Method... 35.0% [binomial] Running Binomial Method... 35.1% [binomial] Running Binomial Method... 35.2% [binomial] Running Binomial Method... 35.3% [binomial] Running Binomial Method... 35.4% [binomial] Running Binomial Method... 35.5% [binomial] Running Binomial Method... 35.5% [binomial] Running Binomial Method... 35.6% [binomial] Running Binomial Method... 35.7% [binomial] Running Binomial Method... 35.8% [binomial] Running Binomial Method... 35.9% [binomial] Running Binomial Method... 36.0% [binomial] Running Binomial Method... 36.1% [binomial] Running Binomial Method... 36.2% [binomial] Running Binomial Method... 36.3% [binomial] Running Binomial Method... 36.4% [binomial] Running Binomial Method... 36.5% [binomial] Running Binomial Method... 36.5% [binomial] Running Binomial Method... 36.6% [binomial] Running Binomial Method... 36.7% [binomial] Running Binomial Method... 36.8% [binomial] Running Binomial Method... 36.9% [binomial] Running Binomial Method... 37.0% [binomial] Running Binomial Method... 37.1% [binomial] Running Binomial Method... 37.2% [binomial] Running Binomial Method... 37.3% [binomial] Running Binomial Method... 37.4% [binomial] Running Binomial Method... 37.5% [binomial] Running Binomial Method... 37.5% [binomial] Running Binomial Method... 37.6% [binomial] Running Binomial Method... 37.7% [binomial] Running Binomial Method... 37.8% [binomial] Running Binomial Method... 37.9% [binomial] Running Binomial Method... 38.0% [binomial] Running Binomial Method... 38.1% [binomial] Running Binomial Method... 38.2% [binomial] Running Binomial Method... 38.3% [binomial] Running Binomial Method... 38.4% [binomial] Running Binomial Method... 38.5% [binomial] Running Binomial Method... 38.5% [binomial] Running Binomial Method... 38.6% [binomial] Running Binomial Method... 38.7% [binomial] Running Binomial Method... 38.8% [binomial] Running Binomial Method... 38.9% [binomial] Running Binomial Method... 39.0% [binomial] Running Binomial Method... 39.1% [binomial] Running Binomial Method... 39.2% [binomial] Running Binomial Method... 39.3% [binomial] Running Binomial Method... 39.4% [binomial] Running Binomial Method... 39.5% [binomial] Running Binomial Method... 39.5% [binomial] Running Binomial Method... 39.6% [binomial] Running Binomial Method... 39.7% [binomial] Running Binomial Method... 39.8% [binomial] Running Binomial Method... 39.9% [binomial] Running Binomial Method... 40.0% [binomial] Running Binomial Method... 40.1% [binomial] Running Binomial Method... 40.2% [binomial] Running Binomial Method... 40.3% [binomial] Running Binomial Method... 40.4% [binomial] Running Binomial Method... 40.5% [binomial] Running Binomial Method... 40.5% [binomial] Running Binomial Method... 40.6% [binomial] Running Binomial Method... 40.7% [binomial] Running Binomial Method... 40.8% [binomial] Running Binomial Method... 40.9% [binomial] Running Binomial Method... 41.0% [binomial] Running Binomial Method... 41.1% [binomial] Running Binomial Method... 41.2% [binomial] Running Binomial Method... 41.3% [binomial] Running Binomial Method... 41.4% [binomial] Running Binomial Method... 41.5% [binomial] Running Binomial Method... 41.5% [binomial] Running Binomial Method... 41.6% [binomial] Running Binomial Method... 41.7% [binomial] Running Binomial Method... 41.8% [binomial] Running Binomial Method... 41.9% [binomial] Running Binomial Method... 42.0% [binomial] Running Binomial Method... 42.1% [binomial] Running Binomial Method... 42.2% [binomial] Running Binomial Method... 42.3% [binomial] Running Binomial Method... 42.4% [binomial] Running Binomial Method... 42.5% [binomial] Running Binomial Method... 42.5% [binomial] Running Binomial Method... 42.6% [binomial] Running Binomial Method... 42.7% [binomial] Running Binomial Method... 42.8% [binomial] Running Binomial Method... 42.9% [binomial] Running Binomial Method... 43.0% [binomial] Running Binomial Method... 43.1% [binomial] Running Binomial Method... 43.2% [binomial] Running Binomial Method... 43.3% [binomial] Running Binomial Method... 43.4% [binomial] Running Binomial Method... 43.5% [binomial] Running Binomial Method... 43.5% [binomial] Running Binomial Method... 43.6% [binomial] Running Binomial Method... 43.7% [binomial] Running Binomial Method... 43.8% [binomial] Running Binomial Method... 43.9% [binomial] Running Binomial Method... 44.0% [binomial] Running Binomial Method... 44.1% [binomial] Running Binomial Method... 44.2% [binomial] Running Binomial Method... 44.3% [binomial] Running Binomial Method... 44.4% [binomial] Running Binomial Method... 44.5% [binomial] Running Binomial Method... 44.5% [binomial] Running Binomial Method... 44.6% [binomial] Running Binomial Method... 44.7% [binomial] Running Binomial Method... 44.8% [binomial] Running Binomial Method... 44.9% [binomial] Running Binomial Method... 45.0% [binomial] Running Binomial Method... 45.1% [binomial] Running Binomial Method... 45.2% [binomial] Running Binomial Method... 45.3% [binomial] Running Binomial Method... 45.4% [binomial] Running Binomial Method... 45.5% [binomial] Running Binomial Method... 45.5% [binomial] Running Binomial Method... 45.6% [binomial] Running Binomial Method... 45.7% [binomial] Running Binomial Method... 45.8% [binomial] Running Binomial Method... 45.9% [binomial] Running Binomial Method... 46.0% [binomial] Running Binomial Method... 46.1% [binomial] Running Binomial Method... 46.2% [binomial] Running Binomial Method... 46.3% [binomial] Running Binomial Method... 46.4% [binomial] Running Binomial Method... 46.5% [binomial] Running Binomial Method... 46.5% [binomial] Running Binomial Method... 46.6% [binomial] Running Binomial Method... 46.7% [binomial] Running Binomial Method... 46.8% [binomial] Running Binomial Method... 46.9% [binomial] Running Binomial Method... 47.0% [binomial] Running Binomial Method... 47.1% [binomial] Running Binomial Method... 47.2% [binomial] Running Binomial Method... 47.3% [binomial] Running Binomial Method... 47.4% [binomial] Running Binomial Method... 47.5% [binomial] Running Binomial Method... 47.5% [binomial] Running Binomial Method... 47.6% [binomial] Running Binomial Method... 47.7% [binomial] Running Binomial Method... 47.8% [binomial] Running Binomial Method... 47.9% [binomial] Running Binomial Method... 48.0% [binomial] Running Binomial Method... 48.1% [binomial] Running Binomial Method... 48.2% [binomial] Running Binomial Method... 48.3% [binomial] Running Binomial Method... 48.4% [binomial] Running Binomial Method... 48.5% [binomial] Running Binomial Method... 48.5% [binomial] Running Binomial Method... 48.6% [binomial] Running Binomial Method... 48.7% [binomial] Running Binomial Method... 48.8% [binomial] Running Binomial Method... 48.9% [binomial] Running Binomial Method... 49.0% [binomial] Running Binomial Method... 49.1% [binomial] Running Binomial Method... 49.2% [binomial] Running Binomial Method... 49.3% [binomial] Running Binomial Method... 49.4% [binomial] Running Binomial Method... 49.5% [binomial] Running Binomial Method... 49.5% [binomial] Running Binomial Method... 49.6% [binomial] Running Binomial Method... 49.7% [binomial] Running Binomial Method... 49.8% [binomial] Running Binomial Method... 49.9% [binomial] Running Binomial Method... 50.0% [binomial] Running Binomial Method... 50.1% [binomial] Running Binomial Method... 50.2% [binomial] Running Binomial Method... 50.3% [binomial] Running Binomial Method... 50.4% [binomial] Running Binomial Method... 50.5% [binomial] Running Binomial Method... 50.5% [binomial] Running Binomial Method... 50.6% [binomial] Running Binomial Method... 50.7% [binomial] Running Binomial Method... 50.8% [binomial] Running Binomial Method... 50.9% [binomial] Running Binomial Method... 51.0% [binomial] Running Binomial Method... 51.1% [binomial] Running Binomial Method... 51.2% [binomial] Running Binomial Method... 51.3% [binomial] Running Binomial Method... 51.4% [binomial] Running Binomial Method... 51.5% [binomial] Running Binomial Method... 51.5% [binomial] Running Binomial Method... 51.6% [binomial] Running Binomial Method... 51.7% [binomial] Running Binomial Method... 51.8% [binomial] Running Binomial Method... 51.9% [binomial] Running Binomial Method... 52.0% [binomial] Running Binomial Method... 52.1% [binomial] Running Binomial Method... 52.2% [binomial] Running Binomial Method... 52.3% [binomial] Running Binomial Method... 52.4% [binomial] Running Binomial Method... 52.5% [binomial] Running Binomial Method... 52.5% [binomial] Running Binomial Method... 52.6% [binomial] Running Binomial Method... 52.7% [binomial] Running Binomial Method... 52.8% [binomial] Running Binomial Method... 52.9% [binomial] Running Binomial Method... 53.0% [binomial] Running Binomial Method... 53.1% [binomial] Running Binomial Method... 53.2% [binomial] Running Binomial Method... 53.3% [binomial] Running Binomial Method... 53.4% [binomial] Running Binomial Method... 53.5% [binomial] Running Binomial Method... 53.5% [binomial] Running Binomial Method... 53.6% [binomial] Running Binomial Method... 53.7% [binomial] Running Binomial Method... 53.8% [binomial] Running Binomial Method... 53.9% [binomial] Running Binomial Method... 54.0% [binomial] Running Binomial Method... 54.1% [binomial] Running Binomial Method... 54.2% [binomial] Running Binomial Method... 54.3% [binomial] Running Binomial Method... 54.4% [binomial] Running Binomial Method... 54.5% [binomial] Running Binomial Method... 54.5% [binomial] Running Binomial Method... 54.6% [binomial] Running Binomial Method... 54.7% [binomial] Running Binomial Method... 54.8% [binomial] Running Binomial Method... 54.9% [binomial] Running Binomial Method... 55.0% [binomial] Running Binomial Method... 55.1% [binomial] Running Binomial Method... 55.2% [binomial] Running Binomial Method... 55.3% [binomial] Running Binomial Method... 55.4% [binomial] Running Binomial Method... 55.5% [binomial] Running Binomial Method... 55.5% [binomial] Running Binomial Method... 55.6% [binomial] Running Binomial Method... 55.7% [binomial] Running Binomial Method... 55.8% [binomial] Running Binomial Method... 55.9% [binomial] Running Binomial Method... 56.0% [binomial] Running Binomial Method... 56.1% [binomial] Running Binomial Method... 56.2% [binomial] Running Binomial Method... 56.3% [binomial] Running Binomial Method... 56.4% [binomial] Running Binomial Method... 56.5% [binomial] Running Binomial Method... 56.5% [binomial] Running Binomial Method... 56.6% [binomial] Running Binomial Method... 56.7% [binomial] Running Binomial Method... 56.8% [binomial] Running Binomial Method... 56.9% [binomial] Running Binomial Method... 57.0% [binomial] Running Binomial Method... 57.1% [binomial] Running Binomial Method... 57.2% [binomial] Running Binomial Method... 57.3% [binomial] Running Binomial Method... 57.4% [binomial] Running Binomial Method... 57.5% [binomial] Running Binomial Method... 57.5% [binomial] Running Binomial Method... 57.6% [binomial] Running Binomial Method... 57.7% [binomial] Running Binomial Method... 57.8% [binomial] Running Binomial Method... 57.9% [binomial] Running Binomial Method... 58.0% [binomial] Running Binomial Method... 58.1% [binomial] Running Binomial Method... 58.2% [binomial] Running Binomial Method... 58.3% [binomial] Running Binomial Method... 58.4% [binomial] Running Binomial Method... 58.5% [binomial] Running Binomial Method... 58.5% [binomial] Running Binomial Method... 58.6% [binomial] Running Binomial Method... 58.7% [binomial] Running Binomial Method... 58.8% [binomial] Running Binomial Method... 58.9% [binomial] Running Binomial Method... 59.0% [binomial] Running Binomial Method... 59.1% [binomial] Running Binomial Method... 59.2% [binomial] Running Binomial Method... 59.3% [binomial] Running Binomial Method... 59.4% [binomial] Running Binomial Method... 59.5% [binomial] Running Binomial Method... 59.5% [binomial] Running Binomial Method... 59.6% [binomial] Running Binomial Method... 59.7% [binomial] Running Binomial Method... 59.8% [binomial] Running Binomial Method... 59.9% [binomial] Running Binomial Method... 60.0% [binomial] Running Binomial Method... 60.1% [binomial] Running Binomial Method... 60.2% [binomial] Running Binomial Method... 60.3% [binomial] Running Binomial Method... 60.4% [binomial] Running Binomial Method... 60.5% [binomial] Running Binomial Method... 60.5% [binomial] Running Binomial Method... 60.6% [binomial] Running Binomial Method... 60.7% [binomial] Running Binomial Method... 60.8% [binomial] Running Binomial Method... 60.9% [binomial] Running Binomial Method... 61.0% [binomial] Running Binomial Method... 61.1% [binomial] Running Binomial Method... 61.2% [binomial] Running Binomial Method... 61.3% [binomial] Running Binomial Method... 61.4% [binomial] Running Binomial Method... 61.5% [binomial] Running Binomial Method... 61.5% [binomial] Running Binomial Method... 61.6% [binomial] Running Binomial Method... 61.7% [binomial] Running Binomial Method... 61.8% [binomial] Running Binomial Method... 61.9% [binomial] Running Binomial Method... 62.0% [binomial] Running Binomial Method... 62.1% [binomial] Running Binomial Method... 62.2% [binomial] Running Binomial Method... 62.3% [binomial] Running Binomial Method... 62.4% [binomial] Running Binomial Method... 62.5% [binomial] Running Binomial Method... 62.5% [binomial] Running Binomial Method... 62.6% [binomial] Running Binomial Method... 62.7% [binomial] Running Binomial Method... 62.8% [binomial] Running Binomial Method... 62.9% [binomial] Running Binomial Method... 63.0% [binomial] Running Binomial Method... 63.1% [binomial] Running Binomial Method... 63.2% [binomial] Running Binomial Method... 63.3% [binomial] Running Binomial Method... 63.4% [binomial] Running Binomial Method... 63.5% [binomial] Running Binomial Method... 63.5% [binomial] Running Binomial Method... 63.6% [binomial] Running Binomial Method... 63.7% [binomial] Running Binomial Method... 63.8% [binomial] Running Binomial Method... 63.9% [binomial] Running Binomial Method... 64.0% [binomial] Running Binomial Method... 64.1% [binomial] Running Binomial Method... 64.2% [binomial] Running Binomial Method... 64.3% [binomial] Running Binomial Method... 64.4% [binomial] Running Binomial Method... 64.5% [binomial] Running Binomial Method... 64.5% [binomial] Running Binomial Method... 64.6% [binomial] Running Binomial Method... 64.7% [binomial] Running Binomial Method... 64.8% [binomial] Running Binomial Method... 64.9% [binomial] Running Binomial Method... 65.0% [binomial] Running Binomial Method... 65.1% [binomial] Running Binomial Method... 65.2% [binomial] Running Binomial Method... 65.3% [binomial] Running Binomial Method... 65.4% [binomial] Running Binomial Method... 65.5% [binomial] Running Binomial Method... 65.5% [binomial] Running Binomial Method... 65.6% [binomial] Running Binomial Method... 65.7% [binomial] Running Binomial Method... 65.8% [binomial] Running Binomial Method... 65.9% [binomial] Running Binomial Method... 66.0% [binomial] Running Binomial Method... 66.1% [binomial] Running Binomial Method... 66.2% [binomial] Running Binomial Method... 66.3% [binomial] Running Binomial Method... 66.4% [binomial] Running Binomial Method... 66.5% [binomial] Running Binomial Method... 66.5% [binomial] Running Binomial Method... 66.6% [binomial] Running Binomial Method... 66.7% [binomial] Running Binomial Method... 66.8% [binomial] Running Binomial Method... 66.9% [binomial] Running Binomial Method... 67.0% [binomial] Running Binomial Method... 67.1% [binomial] Running Binomial Method... 67.2% [binomial] Running Binomial Method... 67.3% [binomial] Running Binomial Method... 67.4% [binomial] Running Binomial Method... 67.5% [binomial] Running Binomial Method... 67.5% [binomial] Running Binomial Method... 67.6% [binomial] Running Binomial Method... 67.7% [binomial] Running Binomial Method... 67.8% [binomial] Running Binomial Method... 67.9% [binomial] Running Binomial Method... 68.0% [binomial] Running Binomial Method... 68.1% [binomial] Running Binomial Method... 68.2% [binomial] Running Binomial Method... 68.3% [binomial] Running Binomial Method... 68.4% [binomial] Running Binomial Method... 68.5% [binomial] Running Binomial Method... 68.5% [binomial] Running Binomial Method... 68.6% [binomial] Running Binomial Method... 68.7% [binomial] Running Binomial Method... 68.8% [binomial] Running Binomial Method... 68.9% [binomial] Running Binomial Method... 69.0% [binomial] Running Binomial Method... 69.1% [binomial] Running Binomial Method... 69.2% [binomial] Running Binomial Method... 69.3% [binomial] Running Binomial Method... 69.4% [binomial] Running Binomial Method... 69.5% [binomial] Running Binomial Method... 69.5% [binomial] Running Binomial Method... 69.6% [binomial] Running Binomial Method... 69.7% [binomial] Running Binomial Method... 69.8% [binomial] Running Binomial Method... 69.9% [binomial] Running Binomial Method... 70.0% [binomial] Running Binomial Method... 70.1% [binomial] Running Binomial Method... 70.2% [binomial] Running Binomial Method... 70.3% [binomial] Running Binomial Method... 70.4% [binomial] Running Binomial Method... 70.5% [binomial] Running Binomial Method... 70.5% [binomial] Running Binomial Method... 70.6% [binomial] Running Binomial Method... 70.7% [binomial] Running Binomial Method... 70.8% [binomial] Running Binomial Method... 70.9% [binomial] Running Binomial Method... 71.0% [binomial] Running Binomial Method... 71.1% [binomial] Running Binomial Method... 71.2% [binomial] Running Binomial Method... 71.3% [binomial] Running Binomial Method... 71.4% [binomial] Running Binomial Method... 71.5% [binomial] Running Binomial Method... 71.5% [binomial] Running Binomial Method... 71.6% [binomial] Running Binomial Method... 71.7% [binomial] Running Binomial Method... 71.8% [binomial] Running Binomial Method... 71.9% [binomial] Running Binomial Method... 72.0% [binomial] Running Binomial Method... 72.1% [binomial] Running Binomial Method... 72.2% [binomial] Running Binomial Method... 72.3% [binomial] Running Binomial Method... 72.4% [binomial] Running Binomial Method... 72.5% [binomial] Running Binomial Method... 72.5% [binomial] Running Binomial Method... 72.6% [binomial] Running Binomial Method... 72.7% [binomial] Running Binomial Method... 72.8% [binomial] Running Binomial Method... 72.9% [binomial] Running Binomial Method... 73.0% [binomial] Running Binomial Method... 73.1% [binomial] Running Binomial Method... 73.2% [binomial] Running Binomial Method... 73.3% [binomial] Running Binomial Method... 73.4% [binomial] Running Binomial Method... 73.5% [binomial] Running Binomial Method... 73.5% [binomial] Running Binomial Method... 73.6% [binomial] Running Binomial Method... 73.7% [binomial] Running Binomial Method... 73.8% [binomial] Running Binomial Method... 73.9% [binomial] Running Binomial Method... 74.0% [binomial] Running Binomial Method... 74.1% [binomial] Running Binomial Method... 74.2% [binomial] Running Binomial Method... 74.3% [binomial] Running Binomial Method... 74.4% [binomial] Running Binomial Method... 74.5% [binomial] Running Binomial Method... 74.5% [binomial] Running Binomial Method... 74.6% [binomial] Running Binomial Method... 74.7% [binomial] Running Binomial Method... 74.8% [binomial] Running Binomial Method... 74.9% [binomial] Running Binomial Method... 75.0% [binomial] Running Binomial Method... 75.1% [binomial] Running Binomial Method... 75.2% [binomial] Running Binomial Method... 75.3% [binomial] Running Binomial Method... 75.4% [binomial] Running Binomial Method... 75.5% [binomial] Running Binomial Method... 75.5% [binomial] Running Binomial Method... 75.6% [binomial] Running Binomial Method... 75.7% [binomial] Running Binomial Method... 75.8% [binomial] Running Binomial Method... 75.9% [binomial] Running Binomial Method... 76.0% [binomial] Running Binomial Method... 76.1% [binomial] Running Binomial Method... 76.2% [binomial] Running Binomial Method... 76.3% [binomial] Running Binomial Method... 76.4% [binomial] Running Binomial Method... 76.5% [binomial] Running Binomial Method... 76.5% [binomial] Running Binomial Method... 76.6% [binomial] Running Binomial Method... 76.7% [binomial] Running Binomial Method... 76.8% [binomial] Running Binomial Method... 76.9% [binomial] Running Binomial Method... 77.0% [binomial] Running Binomial Method... 77.1% [binomial] Running Binomial Method... 77.2% [binomial] Running Binomial Method... 77.3% [binomial] Running Binomial Method... 77.4% [binomial] Running Binomial Method... 77.5% [binomial] Running Binomial Method... 77.5% [binomial] Running Binomial Method... 77.6% [binomial] Running Binomial Method... 77.7% [binomial] Running Binomial Method... 77.8% [binomial] Running Binomial Method... 77.9% [binomial] Running Binomial Method... 78.0% [binomial] Running Binomial Method... 78.1% [binomial] Running Binomial Method... 78.2% [binomial] Running Binomial Method... 78.3% [binomial] Running Binomial Method... 78.4% [binomial] Running Binomial Method... 78.5% [binomial] Running Binomial Method... 78.5% [binomial] Running Binomial Method... 78.6% [binomial] Running Binomial Method... 78.7% [binomial] Running Binomial Method... 78.8% [binomial] Running Binomial Method... 78.9% [binomial] Running Binomial Method... 79.0% [binomial] Running Binomial Method... 79.1% [binomial] Running Binomial Method... 79.2% [binomial] Running Binomial Method... 79.3% [binomial] Running Binomial Method... 79.4% [binomial] Running Binomial Method... 79.5% [binomial] Running Binomial Method... 79.5% [binomial] Running Binomial Method... 79.6% [binomial] Running Binomial Method... 79.7% [binomial] Running Binomial Method... 79.8% [binomial] Running Binomial Method... 79.9% [binomial] Running Binomial Method... 80.0% [binomial] Running Binomial Method... 80.1% [binomial] Running Binomial Method... 80.2% [binomial] Running Binomial Method... 80.3% [binomial] Running Binomial Method... 80.4% [binomial] Running Binomial Method... 80.5% [binomial] Running Binomial Method... 80.5% [binomial] Running Binomial Method... 80.6% [binomial] Running Binomial Method... 80.7% [binomial] Running Binomial Method... 80.8% [binomial] Running Binomial Method... 80.9% [binomial] Running Binomial Method... 81.0% [binomial] Running Binomial Method... 81.1% [binomial] Running Binomial Method... 81.2% [binomial] Running Binomial Method... 81.3% [binomial] Running Binomial Method... 81.4% [binomial] Running Binomial Method... 81.5% [binomial] Running Binomial Method... 81.5% [binomial] Running Binomial Method... 81.6% [binomial] Running Binomial Method... 81.7% [binomial] Running Binomial Method... 81.8% [binomial] Running Binomial Method... 81.9% [binomial] Running Binomial Method... 82.0% [binomial] Running Binomial Method... 82.1% [binomial] Running Binomial Method... 82.2% [binomial] Running Binomial Method... 82.3% [binomial] Running Binomial Method... 82.4% [binomial] Running Binomial Method... 82.5% [binomial] Running Binomial Method... 82.5% [binomial] Running Binomial Method... 82.6% [binomial] Running Binomial Method... 82.7% [binomial] Running Binomial Method... 82.8% [binomial] Running Binomial Method... 82.9% [binomial] Running Binomial Method... 83.0% [binomial] Running Binomial Method... 83.1% [binomial] Running Binomial Method... 83.2% [binomial] Running Binomial Method... 83.3% [binomial] Running Binomial Method... 83.4% [binomial] Running Binomial Method... 83.5% [binomial] Running Binomial Method... 83.5% [binomial] Running Binomial Method... 83.6% [binomial] Running Binomial Method... 83.7% [binomial] Running Binomial Method... 83.8% [binomial] Running Binomial Method... 83.9% [binomial] Running Binomial Method... 84.0% [binomial] Running Binomial Method... 84.1% [binomial] Running Binomial Method... 84.2% [binomial] Running Binomial Method... 84.3% [binomial] Running Binomial Method... 84.4% [binomial] Running Binomial Method... 84.5% [binomial] Running Binomial Method... 84.5% [binomial] Running Binomial Method... 84.6% [binomial] Running Binomial Method... 84.7% [binomial] Running Binomial Method... 84.8% [binomial] Running Binomial Method... 84.9% [binomial] Running Binomial Method... 85.0% [binomial] Running Binomial Method... 85.1% [binomial] Running Binomial Method... 85.2% [binomial] Running Binomial Method... 85.3% [binomial] Running Binomial Method... 85.4% [binomial] Running Binomial Method... 85.5% [binomial] Running Binomial Method... 85.5% [binomial] Running Binomial Method... 85.6% [binomial] Running Binomial Method... 85.7% [binomial] Running Binomial Method... 85.8% [binomial] Running Binomial Method... 85.9% [binomial] Running Binomial Method... 86.0% [binomial] Running Binomial Method... 86.1% [binomial] Running Binomial Method... 86.2% [binomial] Running Binomial Method... 86.3% [binomial] Running Binomial Method... 86.4% [binomial] Running Binomial Method... 86.5% [binomial] Running Binomial Method... 86.5% [binomial] Running Binomial Method... 86.6% [binomial] Running Binomial Method... 86.7% [binomial] Running Binomial Method... 86.8% [binomial] Running Binomial Method... 86.9% [binomial] Running Binomial Method... 87.0% [binomial] Running Binomial Method... 87.1% [binomial] Running Binomial Method... 87.2% [binomial] Running Binomial Method... 87.3% [binomial] Running Binomial Method... 87.4% [binomial] Running Binomial Method... 87.5% [binomial] Running Binomial Method... 87.5% [binomial] Running Binomial Method... 87.6% [binomial] Running Binomial Method... 87.7% [binomial] Running Binomial Method... 87.8% [binomial] Running Binomial Method... 87.9% [binomial] Running Binomial Method... 88.0% [binomial] Running Binomial Method... 88.1% [binomial] Running Binomial Method... 88.2% [binomial] Running Binomial Method... 88.3% [binomial] Running Binomial Method... 88.4% [binomial] Running Binomial Method... 88.5% [binomial] Running Binomial Method... 88.5% [binomial] Running Binomial Method... 88.6% [binomial] Running Binomial Method... 88.7% [binomial] Running Binomial Method... 88.8% [binomial] Running Binomial Method... 88.9% [binomial] Running Binomial Method... 89.0% [binomial] Running Binomial Method... 89.1% [binomial] Running Binomial Method... 89.2% [binomial] Running Binomial Method... 89.3% [binomial] Running Binomial Method... 89.4% [binomial] Running Binomial Method... 89.5% [binomial] Running Binomial Method... 89.5% [binomial] Running Binomial Method... 89.6% [binomial] Running Binomial Method... 89.7% [binomial] Running Binomial Method... 89.8% [binomial] Running Binomial Method... 89.9% [binomial] Running Binomial Method... 90.0% [binomial] Running Binomial Method... 90.1% [binomial] Running Binomial Method... 90.2% [binomial] Running Binomial Method... 90.3% [binomial] Running Binomial Method... 90.4% [binomial] Running Binomial Method... 90.5% [binomial] Running Binomial Method... 90.5% [binomial] Running Binomial Method... 90.6% [binomial] Running Binomial Method... 90.7% [binomial] Running Binomial Method... 90.8% [binomial] Running Binomial Method... 90.9% [binomial] Running Binomial Method... 91.0% [binomial] Running Binomial Method... 91.1% [binomial] Running Binomial Method... 91.2% [binomial] Running Binomial Method... 91.3% [binomial] Running Binomial Method... 91.4% [binomial] Running Binomial Method... 91.5% [binomial] Running Binomial Method... 91.5% [binomial] Running Binomial Method... 91.6% [binomial] Running Binomial Method... 91.7% [binomial] Running Binomial Method... 91.8% [binomial] Running Binomial Method... 91.9% [binomial] Running Binomial Method... 92.0% [binomial] Running Binomial Method... 92.1% [binomial] Running Binomial Method... 92.2% [binomial] Running Binomial Method... 92.3% [binomial] Running Binomial Method... 92.4% [binomial] Running Binomial Method... 92.5% [binomial] Running Binomial Method... 92.5% [binomial] Running Binomial Method... 92.6% [binomial] Running Binomial Method... 92.7% [binomial] Running Binomial Method... 92.8% [binomial] Running Binomial Method... 92.9% [binomial] Running Binomial Method... 93.0% [binomial] Running Binomial Method... 93.1% [binomial] Running Binomial Method... 93.2% [binomial] Running Binomial Method... 93.3% [binomial] Running Binomial Method... 93.4% [binomial] Running Binomial Method... 93.5% [binomial] Running Binomial Method... 93.5% [binomial] Running Binomial Method... 93.6% [binomial] Running Binomial Method... 93.7% [binomial] Running Binomial Method... 93.8% [binomial] Running Binomial Method... 93.9% [binomial] Running Binomial Method... 94.0% [binomial] Running Binomial Method... 94.1% [binomial] Running Binomial Method... 94.2% [binomial] Running Binomial Method... 94.3% [binomial] Running Binomial Method... 94.4% [binomial] Running Binomial Method... 94.5% [binomial] Running Binomial Method... 94.5% [binomial] Running Binomial Method... 94.6% [binomial] Running Binomial Method... 94.7% [binomial] Running Binomial Method... 94.8% [binomial] Running Binomial Method... 94.9% [binomial] Running Binomial Method... 95.0% [binomial] Running Binomial Method... 95.1% [binomial] Running Binomial Method... 95.2% [binomial] Running Binomial Method... 95.3% [binomial] Running Binomial Method... 95.4% [binomial] Running Binomial Method... 95.5% [binomial] Running Binomial Method... 95.5% [binomial] Running Binomial Method... 95.6% [binomial] Running Binomial Method... 95.7% [binomial] Running Binomial Method... 95.8% [binomial] Running Binomial Method... 95.9% [binomial] Running Binomial Method... 96.0% [binomial] Running Binomial Method... 96.1% [binomial] Running Binomial Method... 96.2% [binomial] Running Binomial Method... 96.3% [binomial] Running Binomial Method... 96.4% [binomial] Running Binomial Method... 96.5% [binomial] Running Binomial Method... 96.5% [binomial] Running Binomial Method... 96.6% [binomial] Running Binomial Method... 96.7% [binomial] Running Binomial Method... 96.8% [binomial] Running Binomial Method... 96.9% [binomial] Running Binomial Method... 97.0% [binomial] Running Binomial Method... 97.1% [binomial] Running Binomial Method... 97.2% [binomial] Running Binomial Method... 97.3% [binomial] Running Binomial Method... 97.4% [binomial] Running Binomial Method... 97.5% [binomial] Running Binomial Method... 97.5% [binomial] Running Binomial Method... 97.6% [binomial] Running Binomial Method... 97.7% [binomial] Running Binomial Method... 97.8% [binomial] Running Binomial Method... 97.9% [binomial] Running Binomial Method... 98.0% [binomial] Running Binomial Method... 98.1% [binomial] Running Binomial Method... 98.2% [binomial] Running Binomial Method... 98.3% [binomial] Running Binomial Method... 98.4% [binomial] Running Binomial Method... 98.5% [binomial] Running Binomial Method... 98.5% [binomial] Running Binomial Method... 98.6% [binomial] Running Binomial Method... 98.7% [binomial] Running Binomial Method... 98.8% [binomial] Running Binomial Method... 98.9% [binomial] Running Binomial Method... 99.0% [binomial] Running Binomial Method... 99.1% [binomial] Running Binomial Method... 99.2% [binomial] Running Binomial Method... 99.3% [binomial] Running Binomial Method... 99.4% [binomial] Running Binomial Method... 99.5% [binomial] Running Binomial Method... 99.5% [binomial] Running Binomial Method... 99.6% [binomial] Running Binomial Method... 99.7% [binomial] Running Binomial Method... 99.8% [binomial] Running Binomial Method... 99.9% [binomial] Running Binomial Method... 100.0% ok test_GI (tests.test_analysis_methods.TestMethods) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback [binomial] [binomial] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [binomial] Finished Binomial Method Removing output file... #################### tests.test_analysis_methods.TestMethods.test_GI #################### [gi] Starting Genetic Interactions Method [gi] Getting Data [gi] Normalizing using: TTR [gi] Running GI Method... 2% [gi] Running Export Method... 0.0% [gi] Running GI Method... 4% [gi] Running Export Method... 2.0% [gi] Running GI Method... 6% [gi] Running Export Method... 4.0% [gi] Running GI Method... 8% [gi] Running Export Method... 6.0% [gi] Running GI Method... 10% [gi] Running Export Method... 8.0% [gi] Running GI Method... 12% [gi] Running Export Method... 10.0% [gi] Running GI Method... 14% [gi] Running Export Method... 12.0% [gi] Running GI Method... 16% [gi] Running Export Method... 14.0% [gi] Running GI Method... 18% [gi] Running Export Method... 16.0% [gi] Running GI Method... 20% [gi] Running Export Method... 18.0% [gi] Running GI Method... 22% [gi] Running Export Method... 20.0% [gi] Running GI Method... 24% [gi] Running Export Method... 22.0% [gi] Running GI Method... 25% [gi] Running Export Method... 24.0% [gi] Running GI Method... 27% [gi] Running Export Method... 26.0% [gi] Running GI Method... 29% [gi] Running Export Method... 28.0% [gi] Running GI Method... 31% [gi] Running Export Method... 30.0% [gi] Running GI Method... 33% [gi] Running Export Method... 32.0% [gi] Running GI Method... 35% [gi] Running Export Method... 34.0% [gi] Running GI Method... 37% [gi] Running Export Method... 36.0% [gi] Running GI Method... 39% [gi] Running Export Method... 38.0% [gi] Running GI Method... 41% [gi] Running Export Method... 40.0% [gi] Running GI Method... 43% [gi] Running Export Method... 42.0% [gi] Running GI Method... 45% [gi] Running Export Method... 44.0% [gi] Running GI Method... 47% [gi] Running Export Method... 46.0% [gi] Running GI Method... 49% [gi] Running Export Method... 48.0% [gi] Running GI Method... 51% [gi] Running Export Method... 50.0% [gi] Running GI Method... 53% [gi] Running Export Method... 52.0% [gi] Running GI Method... 55% [gi] Running Export Method... 54.0% [gi] Running GI Method... 57% [gi] Running Export Method... 56.0% [gi] Running GI Method... 59% [gi] Running Export Method... 58.0% [gi] Running GI Method... 61% [gi] Running Export Method... 60.0% [gi] Running GI Method... 63% [gi] Running Export Method... 62.0% [gi] Running GI Method... 65% [gi] Running Export Method... 64.0% [gi] Running GI Method... 67% [gi] Running Export Method... 66.0% [gi] Running GI Method... 69% [gi] Running Export Method... 68.0% [gi] Running GI Method... 71% [gi] Running Export Method... 70.0% [gi] Running GI Method... 73% [gi] Running Export Method... 72.0% [gi] Running GI Method... 75% [gi] Running Export Method... 74.0% [gi] Running GI Method... 76% [gi] Running Export Method... 76.0% [gi] Running GI Method... 78% [gi] Running Export Method... 78.0% [gi] Running GI Method... 80% [gi] Running Export Method... 80.0% [gi] Running GI Method... 82% [gi] Running Export Method... 82.0% [gi] Running GI Method... 84% [gi] Running Export Method... 84.0% [gi] Running GI Method... 86% [gi] Running Export Method... 86.0% [gi] Running GI Method... 88% [gi] Running Export Method... 88.0% [gi] Running GI Method... 90% [gi] Running Export Method... 90.0% [gi] Running GI Method... 92% [gi] Running Export Method... 92.0% [gi] Running GI Method... 94% [gi] Running Export Method... 94.0% [gi] Running GI Method... 96% [gi] Running Export Method... 96.0% [gi] Running GI Method... 98% [gi] Running Export Method... 98.0% [gi] Running GI Method... 100% [gi] Running Export Method... 100.0% /usr/lib/python3.9/unittest/case.py:550: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/testoutput.txt' mode='w' encoding='UTF-8'> method() ResourceWarning: Enable tracemalloc to get the object allocation traceback ok test_Griffin (tests.test_analysis_methods.TestMethods) ... [gi] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [gi] Finished Genetic Interactions Method Removing output file... #################### tests.test_analysis_methods.TestMethods.test_Griffin #################### [griffin] Starting Griffin Method [griffin] Getting Data [griffin] Running Griffin Method... 2.0% [griffin] Running Griffin Method... 3.9% [griffin] Running Griffin Method... 5.9% [griffin] Running Griffin Method... 7.8% [griffin] Running Griffin Method... 9.8% [griffin] Running Griffin Method... 11.8% [griffin] Running Griffin Method... 13.7% [griffin] Running Griffin Method... 15.7% [griffin] Running Griffin Method... 17.6% [griffin] Running Griffin Method... 19.6% [griffin] Running Griffin Method... 21.6% [griffin] Running Griffin Method... 23.5% [griffin] Running Griffin Method... 25.5% [griffin] Running Griffin Method... 27.5% [griffin] Running Griffin Method... 29.4% [griffin] Running Griffin Method... 31.4% [griffin] Running Griffin Method... 33.3% [griffin] Running Griffin Method... 35.3% [griffin] Running Griffin Method... 37.3% [griffin] Running Griffin Method... 39.2% [griffin] Running Griffin Method... 41.2% [griffin] Running Griffin Method... 43.1% [griffin] Running Griffin Method... 45.1% [griffin] Running Griffin Method... 47.1% [griffin] Running Griffin Method... 49.0% [griffin] Running Griffin Method... 51.0% [griffin] Running Griffin Method... 52.9% [griffin] Running Griffin Method... 54.9% [griffin] Running Griffin Method... 56.9% [griffin] Running Griffin Method... 58.8% [griffin] Running Griffin Method... 60.8% [griffin] Running Griffin Method... 62.7% [griffin] Running Griffin Method... 64.7% [griffin] Running Griffin Method... 66.7% [griffin] Running Griffin Method... 68.6% [griffin] Running Griffin Method... 70.6% [griffin] Running Griffin Method... 72.5% [griffin] Running Griffin Method... 74.5% [griffin] Running Griffin Method... 76.5% [griffin] Running Griffin Method... 78.4% [griffin] Running Griffin Method... 80.4% [griffin] Running Griffin Method... 82.4% [griffin] Running Griffin Method... 84.3% [griffin] Running Griffin Method... 86.3% [griffin] Running Griffin Method... 88.2% [griffin] Running Griffin Method... 90.2% [griffin] Running Griffin Method... 92.2% [griffin] Running Griffin Method... 94.1% [griffin] Running Griffin Method... 96.1% [griffin] Running Griffin Method... 98.0% [griffin] Running Griffin Method... 100.0% ok test_Gumbel (tests.test_analysis_methods.TestMethods) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/analysis/gumbel.py:498: DeprecationWarning: scipy.exp is deprecated and will be removed in SciPy 2.0.0, use numpy.exp instead pval = 1 - scipy.exp(scipy.stats.gumbel_r.logcdf(r,u,B)) /build/tnseq-transit-3.2.1/tests/../src/pytransit/analysis/gumbel.py:522: DeprecationWarning: scipy.exp is deprecated and will be removed in SciPy 2.0.0, use numpy.exp instead h0 = ((scipy.exp(scipy.stats.gumbel_r.logpdf(R,mu,sigma))) * scipy.stats.norm.pdf(S, mu_s*R, sigma_s) * (1-w1)) [griffin] [griffin] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [griffin] Finished Griffin Method Removing output file... #################### tests.test_analysis_methods.TestMethods.test_Gumbel #################### [gumbel] Reading Annotation [gumbel] Getting Data [gumbel] Doing Regression [gumbel] Setting Initial Class [gumbel] Running Gumbel Method... 0.2% [gumbel] Running Gumbel Method... 0.3% [gumbel] Running Gumbel Method... 0.4% [gumbel] Running Gumbel Method... 0.5% [gumbel] Running Gumbel Method... 0.5% [gumbel] Running Gumbel Method... 0.6% [gumbel] Running Gumbel Method... 0.7% [gumbel] Running Gumbel Method... 0.8% [gumbel] Running Gumbel Method... 0.9% [gumbel] Running Gumbel Method... 1.0% [gumbel] Running Gumbel Method... 1.1% [gumbel] Running Gumbel Method... 1.2% [gumbel] Running Gumbel Method... 1.3% [gumbel] Running Gumbel Method... 1.4% [gumbel] Running Gumbel Method... 1.5% [gumbel] Running Gumbel Method... 1.5% [gumbel] Running Gumbel Method... 1.6% [gumbel] Running Gumbel Method... 1.7% [gumbel] Running Gumbel Method... 1.8% [gumbel] Running Gumbel Method... 1.9% [gumbel] Running Gumbel Method... 2.0% [gumbel] Running Gumbel Method... 2.1% [gumbel] Running Gumbel Method... 2.2% [gumbel] Running Gumbel Method... 2.3% [gumbel] Running Gumbel Method... 2.4% [gumbel] Running Gumbel Method... 2.5% [gumbel] Running Gumbel Method... 2.5% [gumbel] Running Gumbel Method... 2.6% [gumbel] Running Gumbel Method... 2.7% [gumbel] Running Gumbel Method... 2.8% [gumbel] Running Gumbel Method... 2.9% [gumbel] Running Gumbel Method... 3.0% [gumbel] Running Gumbel Method... 3.1% [gumbel] Running Gumbel Method... 3.2% [gumbel] Running Gumbel Method... 3.3% [gumbel] Running Gumbel Method... 3.4% [gumbel] Running Gumbel Method... 3.5% [gumbel] Running Gumbel Method... 3.5% [gumbel] Running Gumbel Method... 3.6% [gumbel] Running Gumbel Method... 3.7% [gumbel] Running Gumbel Method... 3.8% [gumbel] Running Gumbel Method... 3.9% [gumbel] Running Gumbel Method... 4.0% [gumbel] Running Gumbel Method... 4.1% [gumbel] Running Gumbel Method... 4.2% [gumbel] Running Gumbel Method... 4.3% [gumbel] Running Gumbel Method... 4.4% [gumbel] Running Gumbel Method... 4.5% [gumbel] Running Gumbel Method... 4.5% [gumbel] Running Gumbel Method... 4.6% [gumbel] Running Gumbel Method... 4.7% [gumbel] Running Gumbel Method... 4.8% [gumbel] Running Gumbel Method... 4.9% [gumbel] Running Gumbel Method... 5.0% [gumbel] Running Gumbel Method... 5.1% [gumbel] Running Gumbel Method... 5.2% [gumbel] Running Gumbel Method... 5.3% [gumbel] Running Gumbel Method... 5.4% [gumbel] Running Gumbel Method... 5.5% [gumbel] Running Gumbel Method... 5.5% [gumbel] Running Gumbel Method... 5.6% [gumbel] Running Gumbel Method... 5.7% [gumbel] Running Gumbel Method... 5.8% [gumbel] Running Gumbel Method... 5.9% [gumbel] Running Gumbel Method... 6.0% [gumbel] Running Gumbel Method... 6.1% [gumbel] Running Gumbel Method... 6.2% [gumbel] Running Gumbel Method... 6.3% [gumbel] Running Gumbel Method... 6.4% [gumbel] Running Gumbel Method... 6.5% [gumbel] Running Gumbel Method... 6.5% [gumbel] Running Gumbel Method... 6.6% [gumbel] Running Gumbel Method... 6.7% [gumbel] Running Gumbel Method... 6.8% [gumbel] Running Gumbel Method... 6.9% [gumbel] Running Gumbel Method... 7.0% [gumbel] Running Gumbel Method... 7.1% [gumbel] Running Gumbel Method... 7.2% [gumbel] Running Gumbel Method... 7.3% [gumbel] Running Gumbel Method... 7.4% [gumbel] Running Gumbel Method... 7.5% [gumbel] Running Gumbel Method... 7.5% [gumbel] Running Gumbel Method... 7.6% [gumbel] Running Gumbel Method... 7.7% [gumbel] Running Gumbel Method... 7.8% [gumbel] Running Gumbel Method... 7.9% [gumbel] Running Gumbel Method... 8.0% [gumbel] Running Gumbel Method... 8.1% [gumbel] Running Gumbel Method... 8.2% [gumbel] Running Gumbel Method... 8.3% [gumbel] Running Gumbel Method... 8.4% [gumbel] Running Gumbel Method... 8.5% [gumbel] Running Gumbel Method... 8.5% [gumbel] Running Gumbel Method... 8.6% [gumbel] Running Gumbel Method... 8.7% [gumbel] Running Gumbel Method... 8.8% [gumbel] Running Gumbel Method... 8.9% [gumbel] Running Gumbel Method... 9.0% [gumbel] Running Gumbel Method... 9.1% [gumbel] Running Gumbel Method... 9.2% [gumbel] Running Gumbel Method... 9.3% [gumbel] Running Gumbel Method... 9.4% [gumbel] Running Gumbel Method... 9.5% [gumbel] Running Gumbel Method... 9.5% [gumbel] Running Gumbel Method... 9.6% [gumbel] Running Gumbel Method... 9.7% [gumbel] Running Gumbel Method... 9.8% [gumbel] Running Gumbel Method... 9.9% [gumbel] Running Gumbel Method... 10.0% [gumbel] Running Gumbel Method... 10.1% [gumbel] Running Gumbel Method... 10.2% [gumbel] Running Gumbel Method... 10.3% [gumbel] Running Gumbel Method... 10.4% [gumbel] Running Gumbel Method... 10.5% [gumbel] Running Gumbel Method... 10.5% [gumbel] Running Gumbel Method... 10.6% [gumbel] Running Gumbel Method... 10.7% [gumbel] Running Gumbel Method... 10.8% [gumbel] Running Gumbel Method... 10.9% [gumbel] Running Gumbel Method... 11.0% [gumbel] Running Gumbel Method... 11.1% [gumbel] Running Gumbel Method... 11.2% [gumbel] Running Gumbel Method... 11.3% [gumbel] Running Gumbel Method... 11.4% [gumbel] Running Gumbel Method... 11.5% [gumbel] Running Gumbel Method... 11.5% [gumbel] Running Gumbel Method... 11.6% [gumbel] Running Gumbel Method... 11.7% [gumbel] Running Gumbel Method... 11.8% [gumbel] Running Gumbel Method... 11.9% [gumbel] Running Gumbel Method... 12.0% [gumbel] Running Gumbel Method... 12.1% [gumbel] Running Gumbel Method... 12.2% [gumbel] Running Gumbel Method... 12.3% [gumbel] Running Gumbel Method... 12.4% [gumbel] Running Gumbel Method... 12.5% [gumbel] Running Gumbel Method... 12.5% [gumbel] Running Gumbel Method... 12.6% [gumbel] Running Gumbel Method... 12.7% [gumbel] Running Gumbel Method... 12.8% [gumbel] Running Gumbel Method... 12.9% [gumbel] Running Gumbel Method... 13.0% [gumbel] Running Gumbel Method... 13.1% [gumbel] Running Gumbel Method... 13.2% [gumbel] Running Gumbel Method... 13.3% [gumbel] Running Gumbel Method... 13.4% [gumbel] Running Gumbel Method... 13.5% [gumbel] Running Gumbel Method... 13.5% [gumbel] Running Gumbel Method... 13.6% [gumbel] Running Gumbel Method... 13.7% [gumbel] Running Gumbel Method... 13.8% [gumbel] Running Gumbel Method... 13.9% [gumbel] Running Gumbel Method... 14.0% [gumbel] Running Gumbel Method... 14.1% [gumbel] Running Gumbel Method... 14.2% [gumbel] Running Gumbel Method... 14.3% [gumbel] Running Gumbel Method... 14.4% [gumbel] Running Gumbel Method... 14.5% [gumbel] Running Gumbel Method... 14.5% [gumbel] Running Gumbel Method... 14.6% [gumbel] Running Gumbel Method... 14.7% [gumbel] Running Gumbel Method... 14.8% [gumbel] Running Gumbel Method... 14.9% [gumbel] Running Gumbel Method... 15.0% [gumbel] Running Gumbel Method... 15.1% [gumbel] Running Gumbel Method... 15.2% [gumbel] Running Gumbel Method... 15.3% [gumbel] Running Gumbel Method... 15.4% [gumbel] Running Gumbel Method... 15.5% [gumbel] Running Gumbel Method... 15.5% [gumbel] Running Gumbel Method... 15.6% [gumbel] Running Gumbel Method... 15.7% [gumbel] Running Gumbel Method... 15.8% [gumbel] Running Gumbel Method... 15.9% [gumbel] Running Gumbel Method... 16.0% [gumbel] Running Gumbel Method... 16.1% [gumbel] Running Gumbel Method... 16.2% [gumbel] Running Gumbel Method... 16.3% [gumbel] Running Gumbel Method... 16.4% [gumbel] Running Gumbel Method... 16.5% [gumbel] Running Gumbel Method... 16.5% [gumbel] Running Gumbel Method... 16.6% [gumbel] Running Gumbel Method... 16.7% [gumbel] Running Gumbel Method... 16.8% [gumbel] Running Gumbel Method... 16.9% [gumbel] Running Gumbel Method... 17.0% [gumbel] Running Gumbel Method... 17.1% [gumbel] Running Gumbel Method... 17.2% [gumbel] Running Gumbel Method... 17.3% [gumbel] Running Gumbel Method... 17.4% [gumbel] Running Gumbel Method... 17.5% [gumbel] Running Gumbel Method... 17.5% [gumbel] Running Gumbel Method... 17.6% [gumbel] Running Gumbel Method... 17.7% [gumbel] Running Gumbel Method... 17.8% [gumbel] Running Gumbel Method... 17.9% [gumbel] Running Gumbel Method... 18.0% [gumbel] Running Gumbel Method... 18.1% [gumbel] Running Gumbel Method... 18.2% [gumbel] Running Gumbel Method... 18.3% [gumbel] Running Gumbel Method... 18.4% [gumbel] Running Gumbel Method... 18.5% [gumbel] Running Gumbel Method... 18.5% [gumbel] Running Gumbel Method... 18.6% [gumbel] Running Gumbel Method... 18.7% [gumbel] Running Gumbel Method... 18.8% [gumbel] Running Gumbel Method... 18.9% [gumbel] Running Gumbel Method... 19.0% [gumbel] Running Gumbel Method... 19.1% [gumbel] Running Gumbel Method... 19.2% [gumbel] Running Gumbel Method... 19.3% [gumbel] Running Gumbel Method... 19.4% [gumbel] Running Gumbel Method... 19.5% [gumbel] Running Gumbel Method... 19.5% [gumbel] Running Gumbel Method... 19.6% [gumbel] Running Gumbel Method... 19.7% [gumbel] Running Gumbel Method... 19.8% [gumbel] Running Gumbel Method... 19.9% [gumbel] Running Gumbel Method... 20.0% [gumbel] Running Gumbel Method... 20.1% [gumbel] Running Gumbel Method... 20.2% [gumbel] Running Gumbel Method... 20.3% [gumbel] Running Gumbel Method... 20.4% [gumbel] Running Gumbel Method... 20.5% [gumbel] Running Gumbel Method... 20.5% [gumbel] Running Gumbel Method... 20.6% [gumbel] Running Gumbel Method... 20.7% [gumbel] Running Gumbel Method... 20.8% [gumbel] Running Gumbel Method... 20.9% [gumbel] Running Gumbel Method... 21.0% [gumbel] Running Gumbel Method... 21.1% [gumbel] Running Gumbel Method... 21.2% [gumbel] Running Gumbel Method... 21.3% [gumbel] Running Gumbel Method... 21.4% [gumbel] Running Gumbel Method... 21.5% [gumbel] Running Gumbel Method... 21.5% [gumbel] Running Gumbel Method... 21.6% [gumbel] Running Gumbel Method... 21.7% [gumbel] Running Gumbel Method... 21.8% [gumbel] Running Gumbel Method... 21.9% [gumbel] Running Gumbel Method... 22.0% [gumbel] Running Gumbel Method... 22.1% [gumbel] Running Gumbel Method... 22.2% [gumbel] Running Gumbel Method... 22.3% [gumbel] Running Gumbel Method... 22.4% [gumbel] Running Gumbel Method... 22.5% [gumbel] Running Gumbel Method... 22.5% [gumbel] Running Gumbel Method... 22.6% [gumbel] Running Gumbel Method... 22.7% [gumbel] Running Gumbel Method... 22.8% [gumbel] Running Gumbel Method... 22.9% [gumbel] Running Gumbel Method... 23.0% [gumbel] Running Gumbel Method... 23.1% [gumbel] Running Gumbel Method... 23.2% [gumbel] Running Gumbel Method... 23.3% [gumbel] Running Gumbel Method... 23.4% [gumbel] Running Gumbel Method... 23.5% [gumbel] Running Gumbel Method... 23.5% [gumbel] Running Gumbel Method... 23.6% [gumbel] Running Gumbel Method... 23.7% [gumbel] Running Gumbel Method... 23.8% [gumbel] Running Gumbel Method... 23.9% [gumbel] Running Gumbel Method... 24.0% [gumbel] Running Gumbel Method... 24.1% [gumbel] Running Gumbel Method... 24.2% [gumbel] Running Gumbel Method... 24.3% [gumbel] Running Gumbel Method... 24.4% [gumbel] Running Gumbel Method... 24.5% [gumbel] Running Gumbel Method... 24.5% [gumbel] Running Gumbel Method... 24.6% [gumbel] Running Gumbel Method... 24.7% [gumbel] Running Gumbel Method... 24.8% [gumbel] Running Gumbel Method... 24.9% [gumbel] Running Gumbel Method... 25.0% [gumbel] Running Gumbel Method... 25.1% [gumbel] Running Gumbel Method... 25.2% [gumbel] Running Gumbel Method... 25.3% [gumbel] Running Gumbel Method... 25.4% [gumbel] Running Gumbel Method... 25.5% [gumbel] Running Gumbel Method... 25.5% [gumbel] Running Gumbel Method... 25.6% [gumbel] Running Gumbel Method... 25.7% [gumbel] Running Gumbel Method... 25.8% [gumbel] Running Gumbel Method... 25.9% [gumbel] Running Gumbel Method... 26.0% [gumbel] Running Gumbel Method... 26.1% [gumbel] Running Gumbel Method... 26.2% [gumbel] Running Gumbel Method... 26.3% [gumbel] Running Gumbel Method... 26.4% [gumbel] Running Gumbel Method... 26.5% [gumbel] Running Gumbel Method... 26.5% [gumbel] Running Gumbel Method... 26.6% [gumbel] Running Gumbel Method... 26.7% [gumbel] Running Gumbel Method... 26.8% [gumbel] Running Gumbel Method... 26.9% [gumbel] Running Gumbel Method... 27.0% [gumbel] Running Gumbel Method... 27.1% [gumbel] Running Gumbel Method... 27.2% [gumbel] Running Gumbel Method... 27.3% [gumbel] Running Gumbel Method... 27.4% [gumbel] Running Gumbel Method... 27.5% [gumbel] Running Gumbel Method... 27.5% [gumbel] Running Gumbel Method... 27.6% [gumbel] Running Gumbel Method... 27.7% [gumbel] Running Gumbel Method... 27.8% [gumbel] Running Gumbel Method... 27.9% [gumbel] Running Gumbel Method... 28.0% [gumbel] Running Gumbel Method... 28.1% [gumbel] Running Gumbel Method... 28.2% [gumbel] Running Gumbel Method... 28.3% [gumbel] Running Gumbel Method... 28.4% [gumbel] Running Gumbel Method... 28.5% [gumbel] Running Gumbel Method... 28.5% [gumbel] Running Gumbel Method... 28.6% [gumbel] Running Gumbel Method... 28.7% [gumbel] Running Gumbel Method... 28.8% [gumbel] Running Gumbel Method... 28.9% [gumbel] Running Gumbel Method... 29.0% [gumbel] Running Gumbel Method... 29.1% [gumbel] Running Gumbel Method... 29.2% [gumbel] Running Gumbel Method... 29.3% [gumbel] Running Gumbel Method... 29.4% [gumbel] Running Gumbel Method... 29.5% [gumbel] Running Gumbel Method... 29.5% [gumbel] Running Gumbel Method... 29.6% [gumbel] Running Gumbel Method... 29.7% [gumbel] Running Gumbel Method... 29.8% [gumbel] Running Gumbel Method... 29.9% [gumbel] Running Gumbel Method... 30.0% [gumbel] Running Gumbel Method... 30.1% [gumbel] Running Gumbel Method... 30.2% [gumbel] Running Gumbel Method... 30.3% [gumbel] Running Gumbel Method... 30.4% [gumbel] Running Gumbel Method... 30.5% [gumbel] Running Gumbel Method... 30.5% [gumbel] Running Gumbel Method... 30.6% [gumbel] Running Gumbel Method... 30.7% [gumbel] Running Gumbel Method... 30.8% [gumbel] Running Gumbel Method... 30.9% [gumbel] Running Gumbel Method... 31.0% [gumbel] Running Gumbel Method... 31.1% [gumbel] Running Gumbel Method... 31.2% [gumbel] Running Gumbel Method... 31.3% [gumbel] Running Gumbel Method... 31.4% [gumbel] Running Gumbel Method... 31.5% [gumbel] Running Gumbel Method... 31.5% [gumbel] Running Gumbel Method... 31.6% [gumbel] Running Gumbel Method... 31.7% [gumbel] Running Gumbel Method... 31.8% [gumbel] Running Gumbel Method... 31.9% [gumbel] Running Gumbel Method... 32.0% [gumbel] Running Gumbel Method... 32.1% [gumbel] Running Gumbel Method... 32.2% [gumbel] Running Gumbel Method... 32.3% [gumbel] Running Gumbel Method... 32.4% [gumbel] Running Gumbel Method... 32.5% [gumbel] Running Gumbel Method... 32.5% [gumbel] Running Gumbel Method... 32.6% [gumbel] Running Gumbel Method... 32.7% [gumbel] Running Gumbel Method... 32.8% [gumbel] Running Gumbel Method... 32.9% [gumbel] Running Gumbel Method... 33.0% [gumbel] Running Gumbel Method... 33.1% [gumbel] Running Gumbel Method... 33.2% [gumbel] Running Gumbel Method... 33.3% [gumbel] Running Gumbel Method... 33.4% [gumbel] Running Gumbel Method... 33.5% [gumbel] Running Gumbel Method... 33.5% [gumbel] Running Gumbel Method... 33.6% [gumbel] Running Gumbel Method... 33.7% [gumbel] Running Gumbel Method... 33.8% [gumbel] Running Gumbel Method... 33.9% [gumbel] Running Gumbel Method... 34.0% [gumbel] Running Gumbel Method... 34.1% [gumbel] Running Gumbel Method... 34.2% [gumbel] Running Gumbel Method... 34.3% [gumbel] Running Gumbel Method... 34.4% [gumbel] Running Gumbel Method... 34.5% [gumbel] Running Gumbel Method... 34.5% [gumbel] Running Gumbel Method... 34.6% [gumbel] Running Gumbel Method... 34.7% [gumbel] Running Gumbel Method... 34.8% [gumbel] Running Gumbel Method... 34.9% [gumbel] Running Gumbel Method... 35.0% [gumbel] Running Gumbel Method... 35.1% [gumbel] Running Gumbel Method... 35.2% [gumbel] Running Gumbel Method... 35.3% [gumbel] Running Gumbel Method... 35.4% [gumbel] Running Gumbel Method... 35.5% [gumbel] Running Gumbel Method... 35.5% [gumbel] Running Gumbel Method... 35.6% [gumbel] Running Gumbel Method... 35.7% [gumbel] Running Gumbel Method... 35.8% [gumbel] Running Gumbel Method... 35.9% [gumbel] Running Gumbel Method... 36.0% [gumbel] Running Gumbel Method... 36.1% [gumbel] Running Gumbel Method... 36.2% [gumbel] Running Gumbel Method... 36.3% [gumbel] Running Gumbel Method... 36.4% [gumbel] Running Gumbel Method... 36.5% [gumbel] Running Gumbel Method... 36.5% [gumbel] Running Gumbel Method... 36.6% [gumbel] Running Gumbel Method... 36.7% [gumbel] Running Gumbel Method... 36.8% [gumbel] Running Gumbel Method... 36.9% [gumbel] Running Gumbel Method... 37.0% [gumbel] Running Gumbel Method... 37.1% [gumbel] Running Gumbel Method... 37.2% [gumbel] Running Gumbel Method... 37.3% [gumbel] Running Gumbel Method... 37.4% [gumbel] Running Gumbel Method... 37.5% [gumbel] Running Gumbel Method... 37.5% [gumbel] Running Gumbel Method... 37.6% [gumbel] Running Gumbel Method... 37.7% [gumbel] Running Gumbel Method... 37.8% [gumbel] Running Gumbel Method... 37.9% [gumbel] Running Gumbel Method... 38.0% [gumbel] Running Gumbel Method... 38.1% [gumbel] Running Gumbel Method... 38.2% [gumbel] Running Gumbel Method... 38.3% [gumbel] Running Gumbel Method... 38.4% [gumbel] Running Gumbel Method... 38.5% [gumbel] Running Gumbel Method... 38.5% [gumbel] Running Gumbel Method... 38.6% [gumbel] Running Gumbel Method... 38.7% [gumbel] Running Gumbel Method... 38.8% [gumbel] Running Gumbel Method... 38.9% [gumbel] Running Gumbel Method... 39.0% [gumbel] Running Gumbel Method... 39.1% [gumbel] Running Gumbel Method... 39.2% [gumbel] Running Gumbel Method... 39.3% [gumbel] Running Gumbel Method... 39.4% [gumbel] Running Gumbel Method... 39.5% [gumbel] Running Gumbel Method... 39.5% [gumbel] Running Gumbel Method... 39.6% [gumbel] Running Gumbel Method... 39.7% [gumbel] Running Gumbel Method... 39.8% [gumbel] Running Gumbel Method... 39.9% [gumbel] Running Gumbel Method... 40.0% [gumbel] Running Gumbel Method... 40.1% [gumbel] Running Gumbel Method... 40.2% [gumbel] Running Gumbel Method... 40.3% [gumbel] Running Gumbel Method... 40.4% [gumbel] Running Gumbel Method... 40.5% [gumbel] Running Gumbel Method... 40.5% [gumbel] Running Gumbel Method... 40.6% [gumbel] Running Gumbel Method... 40.7% [gumbel] Running Gumbel Method... 40.8% [gumbel] Running Gumbel Method... 40.9% [gumbel] Running Gumbel Method... 41.0% [gumbel] Running Gumbel Method... 41.1% [gumbel] Running Gumbel Method... 41.2% [gumbel] Running Gumbel Method... 41.3% [gumbel] Running Gumbel Method... 41.4% [gumbel] Running Gumbel Method... 41.5% [gumbel] Running Gumbel Method... 41.5% [gumbel] Running Gumbel Method... 41.6% [gumbel] Running Gumbel Method... 41.7% [gumbel] Running Gumbel Method... 41.8% [gumbel] Running Gumbel Method... 41.9% [gumbel] Running Gumbel Method... 42.0% [gumbel] Running Gumbel Method... 42.1% [gumbel] Running Gumbel Method... 42.2% [gumbel] Running Gumbel Method... 42.3% [gumbel] Running Gumbel Method... 42.4% [gumbel] Running Gumbel Method... 42.5% [gumbel] Running Gumbel Method... 42.5% [gumbel] Running Gumbel Method... 42.6% [gumbel] Running Gumbel Method... 42.7% [gumbel] Running Gumbel Method... 42.8% [gumbel] Running Gumbel Method... 42.9% [gumbel] Running Gumbel Method... 43.0% [gumbel] Running Gumbel Method... 43.1% [gumbel] Running Gumbel Method... 43.2% [gumbel] Running Gumbel Method... 43.3% [gumbel] Running Gumbel Method... 43.4% [gumbel] Running Gumbel Method... 43.5% [gumbel] Running Gumbel Method... 43.5% [gumbel] Running Gumbel Method... 43.6% [gumbel] Running Gumbel Method... 43.7% [gumbel] Running Gumbel Method... 43.8% [gumbel] Running Gumbel Method... 43.9% [gumbel] Running Gumbel Method... 44.0% [gumbel] Running Gumbel Method... 44.1% [gumbel] Running Gumbel Method... 44.2% [gumbel] Running Gumbel Method... 44.3% [gumbel] Running Gumbel Method... 44.4% [gumbel] Running Gumbel Method... 44.5% [gumbel] Running Gumbel Method... 44.5% [gumbel] Running Gumbel Method... 44.6% [gumbel] Running Gumbel Method... 44.7% [gumbel] Running Gumbel Method... 44.8% [gumbel] Running Gumbel Method... 44.9% [gumbel] Running Gumbel Method... 45.0% [gumbel] Running Gumbel Method... 45.1% [gumbel] Running Gumbel Method... 45.2% [gumbel] Running Gumbel Method... 45.3% [gumbel] Running Gumbel Method... 45.4% [gumbel] Running Gumbel Method... 45.5% [gumbel] Running Gumbel Method... 45.5% [gumbel] Running Gumbel Method... 45.6% [gumbel] Running Gumbel Method... 45.7% [gumbel] Running Gumbel Method... 45.8% [gumbel] Running Gumbel Method... 45.9% [gumbel] Running Gumbel Method... 46.0% [gumbel] Running Gumbel Method... 46.1% [gumbel] Running Gumbel Method... 46.2% [gumbel] Running Gumbel Method... 46.3% [gumbel] Running Gumbel Method... 46.4% [gumbel] Running Gumbel Method... 46.5% [gumbel] Running Gumbel Method... 46.5% [gumbel] Running Gumbel Method... 46.6% [gumbel] Running Gumbel Method... 46.7% [gumbel] Running Gumbel Method... 46.8% [gumbel] Running Gumbel Method... 46.9% [gumbel] Running Gumbel Method... 47.0% [gumbel] Running Gumbel Method... 47.1% [gumbel] Running Gumbel Method... 47.2% [gumbel] Running Gumbel Method... 47.3% [gumbel] Running Gumbel Method... 47.4% [gumbel] Running Gumbel Method... 47.5% [gumbel] Running Gumbel Method... 47.5% [gumbel] Running Gumbel Method... 47.6% [gumbel] Running Gumbel Method... 47.7% [gumbel] Running Gumbel Method... 47.8% [gumbel] Running Gumbel Method... 47.9% [gumbel] Running Gumbel Method... 48.0% [gumbel] Running Gumbel Method... 48.1% [gumbel] Running Gumbel Method... 48.2% [gumbel] Running Gumbel Method... 48.3% [gumbel] Running Gumbel Method... 48.4% [gumbel] Running Gumbel Method... 48.5% [gumbel] Running Gumbel Method... 48.5% [gumbel] Running Gumbel Method... 48.6% [gumbel] Running Gumbel Method... 48.7% [gumbel] Running Gumbel Method... 48.8% [gumbel] Running Gumbel Method... 48.9% [gumbel] Running Gumbel Method... 49.0% [gumbel] Running Gumbel Method... 49.1% [gumbel] Running Gumbel Method... 49.2% [gumbel] Running Gumbel Method... 49.3% [gumbel] Running Gumbel Method... 49.4% [gumbel] Running Gumbel Method... 49.5% [gumbel] Running Gumbel Method... 49.5% [gumbel] Running Gumbel Method... 49.6% [gumbel] Running Gumbel Method... 49.7% [gumbel] Running Gumbel Method... 49.8% [gumbel] Running Gumbel Method... 49.9% [gumbel] Running Gumbel Method... 50.0% [gumbel] Running Gumbel Method... 50.1% [gumbel] Running Gumbel Method... 50.2% [gumbel] Running Gumbel Method... 50.3% [gumbel] Running Gumbel Method... 50.4% [gumbel] Running Gumbel Method... 50.5% [gumbel] Running Gumbel Method... 50.5% [gumbel] Running Gumbel Method... 50.6% [gumbel] Running Gumbel Method... 50.7% [gumbel] Running Gumbel Method... 50.8% [gumbel] Running Gumbel Method... 50.9% [gumbel] Running Gumbel Method... 51.0% [gumbel] Running Gumbel Method... 51.1% [gumbel] Running Gumbel Method... 51.2% [gumbel] Running Gumbel Method... 51.3% [gumbel] Running Gumbel Method... 51.4% [gumbel] Running Gumbel Method... 51.5% [gumbel] Running Gumbel Method... 51.5% [gumbel] Running Gumbel Method... 51.6% [gumbel] Running Gumbel Method... 51.7% [gumbel] Running Gumbel Method... 51.8% [gumbel] Running Gumbel Method... 51.9% [gumbel] Running Gumbel Method... 52.0% [gumbel] Running Gumbel Method... 52.1% [gumbel] Running Gumbel Method... 52.2% [gumbel] Running Gumbel Method... 52.3% [gumbel] Running Gumbel Method... 52.4% [gumbel] Running Gumbel Method... 52.5% [gumbel] Running Gumbel Method... 52.5% [gumbel] Running Gumbel Method... 52.6% [gumbel] Running Gumbel Method... 52.7% [gumbel] Running Gumbel Method... 52.8% [gumbel] Running Gumbel Method... 52.9% [gumbel] Running Gumbel Method... 53.0% [gumbel] Running Gumbel Method... 53.1% [gumbel] Running Gumbel Method... 53.2% [gumbel] Running Gumbel Method... 53.3% [gumbel] Running Gumbel Method... 53.4% [gumbel] Running Gumbel Method... 53.5% [gumbel] Running Gumbel Method... 53.5% [gumbel] Running Gumbel Method... 53.6% [gumbel] Running Gumbel Method... 53.7% [gumbel] Running Gumbel Method... 53.8% [gumbel] Running Gumbel Method... 53.9% [gumbel] Running Gumbel Method... 54.0% [gumbel] Running Gumbel Method... 54.1% [gumbel] Running Gumbel Method... 54.2% [gumbel] Running Gumbel Method... 54.3% [gumbel] Running Gumbel Method... 54.4% [gumbel] Running Gumbel Method... 54.5% [gumbel] Running Gumbel Method... 54.5% [gumbel] Running Gumbel Method... 54.6% [gumbel] Running Gumbel Method... 54.7% [gumbel] Running Gumbel Method... 54.8% [gumbel] Running Gumbel Method... 54.9% [gumbel] Running Gumbel Method... 55.0% [gumbel] Running Gumbel Method... 55.1% [gumbel] Running Gumbel Method... 55.2% [gumbel] Running Gumbel Method... 55.3% [gumbel] Running Gumbel Method... 55.4% [gumbel] Running Gumbel Method... 55.5% [gumbel] Running Gumbel Method... 55.5% [gumbel] Running Gumbel Method... 55.6% [gumbel] Running Gumbel Method... 55.7% [gumbel] Running Gumbel Method... 55.8% [gumbel] Running Gumbel Method... 55.9% [gumbel] Running Gumbel Method... 56.0% [gumbel] Running Gumbel Method... 56.1% [gumbel] Running Gumbel Method... 56.2% [gumbel] Running Gumbel Method... 56.3% [gumbel] Running Gumbel Method... 56.4% [gumbel] Running Gumbel Method... 56.5% [gumbel] Running Gumbel Method... 56.5% [gumbel] Running Gumbel Method... 56.6% [gumbel] Running Gumbel Method... 56.7% [gumbel] Running Gumbel Method... 56.8% [gumbel] Running Gumbel Method... 56.9% [gumbel] Running Gumbel Method... 57.0% [gumbel] Running Gumbel Method... 57.1% [gumbel] Running Gumbel Method... 57.2% [gumbel] Running Gumbel Method... 57.3% [gumbel] Running Gumbel Method... 57.4% [gumbel] Running Gumbel Method... 57.5% [gumbel] Running Gumbel Method... 57.5% [gumbel] Running Gumbel Method... 57.6% [gumbel] Running Gumbel Method... 57.7% [gumbel] Running Gumbel Method... 57.8% [gumbel] Running Gumbel Method... 57.9% [gumbel] Running Gumbel Method... 58.0% [gumbel] Running Gumbel Method... 58.1% [gumbel] Running Gumbel Method... 58.2% [gumbel] Running Gumbel Method... 58.3% [gumbel] Running Gumbel Method... 58.4% [gumbel] Running Gumbel Method... 58.5% [gumbel] Running Gumbel Method... 58.5% [gumbel] Running Gumbel Method... 58.6% [gumbel] Running Gumbel Method... 58.7% [gumbel] Running Gumbel Method... 58.8% [gumbel] Running Gumbel Method... 58.9% [gumbel] Running Gumbel Method... 59.0% [gumbel] Running Gumbel Method... 59.1% [gumbel] Running Gumbel Method... 59.2% [gumbel] Running Gumbel Method... 59.3% [gumbel] Running Gumbel Method... 59.4% [gumbel] Running Gumbel Method... 59.5% [gumbel] Running Gumbel Method... 59.5% [gumbel] Running Gumbel Method... 59.6% [gumbel] Running Gumbel Method... 59.7% [gumbel] Running Gumbel Method... 59.8% [gumbel] Running Gumbel Method... 59.9% [gumbel] Running Gumbel Method... 60.0% [gumbel] Running Gumbel Method... 60.1% [gumbel] Running Gumbel Method... 60.2% [gumbel] Running Gumbel Method... 60.3% [gumbel] Running Gumbel Method... 60.4% [gumbel] Running Gumbel Method... 60.5% [gumbel] Running Gumbel Method... 60.5% [gumbel] Running Gumbel Method... 60.6% [gumbel] Running Gumbel Method... 60.7% [gumbel] Running Gumbel Method... 60.8% [gumbel] Running Gumbel Method... 60.9% [gumbel] Running Gumbel Method... 61.0% [gumbel] Running Gumbel Method... 61.1% [gumbel] Running Gumbel Method... 61.2% [gumbel] Running Gumbel Method... 61.3% [gumbel] Running Gumbel Method... 61.4% [gumbel] Running Gumbel Method... 61.5% [gumbel] Running Gumbel Method... 61.5% [gumbel] Running Gumbel Method... 61.6% [gumbel] Running Gumbel Method... 61.7% [gumbel] Running Gumbel Method... 61.8% [gumbel] Running Gumbel Method... 61.9% [gumbel] Running Gumbel Method... 62.0% [gumbel] Running Gumbel Method... 62.1% [gumbel] Running Gumbel Method... 62.2% [gumbel] Running Gumbel Method... 62.3% [gumbel] Running Gumbel Method... 62.4% [gumbel] Running Gumbel Method... 62.5% [gumbel] Running Gumbel Method... 62.5% [gumbel] Running Gumbel Method... 62.6% [gumbel] Running Gumbel Method... 62.7% [gumbel] Running Gumbel Method... 62.8% [gumbel] Running Gumbel Method... 62.9% [gumbel] Running Gumbel Method... 63.0% [gumbel] Running Gumbel Method... 63.1% [gumbel] Running Gumbel Method... 63.2% [gumbel] Running Gumbel Method... 63.3% [gumbel] Running Gumbel Method... 63.4% [gumbel] Running Gumbel Method... 63.5% [gumbel] Running Gumbel Method... 63.5% [gumbel] Running Gumbel Method... 63.6% [gumbel] Running Gumbel Method... 63.7% [gumbel] Running Gumbel Method... 63.8% [gumbel] Running Gumbel Method... 63.9% [gumbel] Running Gumbel Method... 64.0% [gumbel] Running Gumbel Method... 64.1% [gumbel] Running Gumbel Method... 64.2% [gumbel] Running Gumbel Method... 64.3% [gumbel] Running Gumbel Method... 64.4% [gumbel] Running Gumbel Method... 64.5% [gumbel] Running Gumbel Method... 64.5% [gumbel] Running Gumbel Method... 64.6% [gumbel] Running Gumbel Method... 64.7% [gumbel] Running Gumbel Method... 64.8% [gumbel] Running Gumbel Method... 64.9% [gumbel] Running Gumbel Method... 65.0% [gumbel] Running Gumbel Method... 65.1% [gumbel] Running Gumbel Method... 65.2% [gumbel] Running Gumbel Method... 65.3% [gumbel] Running Gumbel Method... 65.4% [gumbel] Running Gumbel Method... 65.5% [gumbel] Running Gumbel Method... 65.5% [gumbel] Running Gumbel Method... 65.6% [gumbel] Running Gumbel Method... 65.7% [gumbel] Running Gumbel Method... 65.8% [gumbel] Running Gumbel Method... 65.9% [gumbel] Running Gumbel Method... 66.0% [gumbel] Running Gumbel Method... 66.1% [gumbel] Running Gumbel Method... 66.2% [gumbel] Running Gumbel Method... 66.3% [gumbel] Running Gumbel Method... 66.4% [gumbel] Running Gumbel Method... 66.5% [gumbel] Running Gumbel Method... 66.5% [gumbel] Running Gumbel Method... 66.6% [gumbel] Running Gumbel Method... 66.7% [gumbel] Running Gumbel Method... 66.8% [gumbel] Running Gumbel Method... 66.9% [gumbel] Running Gumbel Method... 67.0% [gumbel] Running Gumbel Method... 67.1% [gumbel] Running Gumbel Method... 67.2% [gumbel] Running Gumbel Method... 67.3% [gumbel] Running Gumbel Method... 67.4% [gumbel] Running Gumbel Method... 67.5% [gumbel] Running Gumbel Method... 67.5% [gumbel] Running Gumbel Method... 67.6% [gumbel] Running Gumbel Method... 67.7% [gumbel] Running Gumbel Method... 67.8% [gumbel] Running Gumbel Method... 67.9% [gumbel] Running Gumbel Method... 68.0% [gumbel] Running Gumbel Method... 68.1% [gumbel] Running Gumbel Method... 68.2% [gumbel] Running Gumbel Method... 68.3% [gumbel] Running Gumbel Method... 68.4% [gumbel] Running Gumbel Method... 68.5% [gumbel] Running Gumbel Method... 68.5% [gumbel] Running Gumbel Method... 68.6% [gumbel] Running Gumbel Method... 68.7% [gumbel] Running Gumbel Method... 68.8% [gumbel] Running Gumbel Method... 68.9% [gumbel] Running Gumbel Method... 69.0% [gumbel] Running Gumbel Method... 69.1% [gumbel] Running Gumbel Method... 69.2% [gumbel] Running Gumbel Method... 69.3% [gumbel] Running Gumbel Method... 69.4% [gumbel] Running Gumbel Method... 69.5% [gumbel] Running Gumbel Method... 69.5% [gumbel] Running Gumbel Method... 69.6% [gumbel] Running Gumbel Method... 69.7% [gumbel] Running Gumbel Method... 69.8% [gumbel] Running Gumbel Method... 69.9% [gumbel] Running Gumbel Method... 70.0% [gumbel] Running Gumbel Method... 70.1% [gumbel] Running Gumbel Method... 70.2% [gumbel] Running Gumbel Method... 70.3% [gumbel] Running Gumbel Method... 70.4% [gumbel] Running Gumbel Method... 70.5% [gumbel] Running Gumbel Method... 70.5% [gumbel] Running Gumbel Method... 70.6% [gumbel] Running Gumbel Method... 70.7% [gumbel] Running Gumbel Method... 70.8% [gumbel] Running Gumbel Method... 70.9% [gumbel] Running Gumbel Method... 71.0% [gumbel] Running Gumbel Method... 71.1% [gumbel] Running Gumbel Method... 71.2% [gumbel] Running Gumbel Method... 71.3% [gumbel] Running Gumbel Method... 71.4% [gumbel] Running Gumbel Method... 71.5% [gumbel] Running Gumbel Method... 71.5% [gumbel] Running Gumbel Method... 71.6% [gumbel] Running Gumbel Method... 71.7% [gumbel] Running Gumbel Method... 71.8% [gumbel] Running Gumbel Method... 71.9% [gumbel] Running Gumbel Method... 72.0% [gumbel] Running Gumbel Method... 72.1% [gumbel] Running Gumbel Method... 72.2% [gumbel] Running Gumbel Method... 72.3% [gumbel] Running Gumbel Method... 72.4% [gumbel] Running Gumbel Method... 72.5% [gumbel] Running Gumbel Method... 72.5% [gumbel] Running Gumbel Method... 72.6% [gumbel] Running Gumbel Method... 72.7% [gumbel] Running Gumbel Method... 72.8% [gumbel] Running Gumbel Method... 72.9% [gumbel] Running Gumbel Method... 73.0% [gumbel] Running Gumbel Method... 73.1% [gumbel] Running Gumbel Method... 73.2% [gumbel] Running Gumbel Method... 73.3% [gumbel] Running Gumbel Method... 73.4% [gumbel] Running Gumbel Method... 73.5% [gumbel] Running Gumbel Method... 73.5% [gumbel] Running Gumbel Method... 73.6% [gumbel] Running Gumbel Method... 73.7% [gumbel] Running Gumbel Method... 73.8% [gumbel] Running Gumbel Method... 73.9% [gumbel] Running Gumbel Method... 74.0% [gumbel] Running Gumbel Method... 74.1% [gumbel] Running Gumbel Method... 74.2% [gumbel] Running Gumbel Method... 74.3% [gumbel] Running Gumbel Method... 74.4% [gumbel] Running Gumbel Method... 74.5% [gumbel] Running Gumbel Method... 74.5% [gumbel] Running Gumbel Method... 74.6% [gumbel] Running Gumbel Method... 74.7% [gumbel] Running Gumbel Method... 74.8% [gumbel] Running Gumbel Method... 74.9% [gumbel] Running Gumbel Method... 75.0% [gumbel] Running Gumbel Method... 75.1% [gumbel] Running Gumbel Method... 75.2% [gumbel] Running Gumbel Method... 75.3% [gumbel] Running Gumbel Method... 75.4% [gumbel] Running Gumbel Method... 75.5% [gumbel] Running Gumbel Method... 75.5% [gumbel] Running Gumbel Method... 75.6% [gumbel] Running Gumbel Method... 75.7% [gumbel] Running Gumbel Method... 75.8% [gumbel] Running Gumbel Method... 75.9% [gumbel] Running Gumbel Method... 76.0% [gumbel] Running Gumbel Method... 76.1% [gumbel] Running Gumbel Method... 76.2% [gumbel] Running Gumbel Method... 76.3% [gumbel] Running Gumbel Method... 76.4% [gumbel] Running Gumbel Method... 76.5% [gumbel] Running Gumbel Method... 76.5% [gumbel] Running Gumbel Method... 76.6% [gumbel] Running Gumbel Method... 76.7% [gumbel] Running Gumbel Method... 76.8% [gumbel] Running Gumbel Method... 76.9% [gumbel] Running Gumbel Method... 77.0% [gumbel] Running Gumbel Method... 77.1% [gumbel] Running Gumbel Method... 77.2% [gumbel] Running Gumbel Method... 77.3% [gumbel] Running Gumbel Method... 77.4% [gumbel] Running Gumbel Method... 77.5% [gumbel] Running Gumbel Method... 77.5% [gumbel] Running Gumbel Method... 77.6% [gumbel] Running Gumbel Method... 77.7% [gumbel] Running Gumbel Method... 77.8% [gumbel] Running Gumbel Method... 77.9% [gumbel] Running Gumbel Method... 78.0% [gumbel] Running Gumbel Method... 78.1% [gumbel] Running Gumbel Method... 78.2% [gumbel] Running Gumbel Method... 78.3% [gumbel] Running Gumbel Method... 78.4% [gumbel] Running Gumbel Method... 78.5% [gumbel] Running Gumbel Method... 78.5% [gumbel] Running Gumbel Method... 78.6% [gumbel] Running Gumbel Method... 78.7% [gumbel] Running Gumbel Method... 78.8% [gumbel] Running Gumbel Method... 78.9% [gumbel] Running Gumbel Method... 79.0% [gumbel] Running Gumbel Method... 79.1% [gumbel] Running Gumbel Method... 79.2% [gumbel] Running Gumbel Method... 79.3% [gumbel] Running Gumbel Method... 79.4% [gumbel] Running Gumbel Method... 79.5% [gumbel] Running Gumbel Method... 79.5% [gumbel] Running Gumbel Method... 79.6% [gumbel] Running Gumbel Method... 79.7% [gumbel] Running Gumbel Method... 79.8% [gumbel] Running Gumbel Method... 79.9% [gumbel] Running Gumbel Method... 80.0% [gumbel] Running Gumbel Method... 80.1% [gumbel] Running Gumbel Method... 80.2% [gumbel] Running Gumbel Method... 80.3% [gumbel] Running Gumbel Method... 80.4% [gumbel] Running Gumbel Method... 80.5% [gumbel] Running Gumbel Method... 80.5% [gumbel] Running Gumbel Method... 80.6% [gumbel] Running Gumbel Method... 80.7% [gumbel] Running Gumbel Method... 80.8% [gumbel] Running Gumbel Method... 80.9% [gumbel] Running Gumbel Method... 81.0% [gumbel] Running Gumbel Method... 81.1% [gumbel] Running Gumbel Method... 81.2% [gumbel] Running Gumbel Method... 81.3% [gumbel] Running Gumbel Method... 81.4% [gumbel] Running Gumbel Method... 81.5% [gumbel] Running Gumbel Method... 81.5% [gumbel] Running Gumbel Method... 81.6% [gumbel] Running Gumbel Method... 81.7% [gumbel] Running Gumbel Method... 81.8% [gumbel] Running Gumbel Method... 81.9% [gumbel] Running Gumbel Method... 82.0% [gumbel] Running Gumbel Method... 82.1% [gumbel] Running Gumbel Method... 82.2% [gumbel] Running Gumbel Method... 82.3% [gumbel] Running Gumbel Method... 82.4% [gumbel] Running Gumbel Method... 82.5% [gumbel] Running Gumbel Method... 82.5% [gumbel] Running Gumbel Method... 82.6% [gumbel] Running Gumbel Method... 82.7% [gumbel] Running Gumbel Method... 82.8% [gumbel] Running Gumbel Method... 82.9% [gumbel] Running Gumbel Method... 83.0% [gumbel] Running Gumbel Method... 83.1% [gumbel] Running Gumbel Method... 83.2% [gumbel] Running Gumbel Method... 83.3% [gumbel] Running Gumbel Method... 83.4% [gumbel] Running Gumbel Method... 83.5% [gumbel] Running Gumbel Method... 83.5% [gumbel] Running Gumbel Method... 83.6% [gumbel] Running Gumbel Method... 83.7% [gumbel] Running Gumbel Method... 83.8% [gumbel] Running Gumbel Method... 83.9% [gumbel] Running Gumbel Method... 84.0% [gumbel] Running Gumbel Method... 84.1% [gumbel] Running Gumbel Method... 84.2% [gumbel] Running Gumbel Method... 84.3% [gumbel] Running Gumbel Method... 84.4% [gumbel] Running Gumbel Method... 84.5% [gumbel] Running Gumbel Method... 84.5% [gumbel] Running Gumbel Method... 84.6% [gumbel] Running Gumbel Method... 84.7% [gumbel] Running Gumbel Method... 84.8% [gumbel] Running Gumbel Method... 84.9% [gumbel] Running Gumbel Method... 85.0% [gumbel] Running Gumbel Method... 85.1% [gumbel] Running Gumbel Method... 85.2% [gumbel] Running Gumbel Method... 85.3% [gumbel] Running Gumbel Method... 85.4% [gumbel] Running Gumbel Method... 85.5% [gumbel] Running Gumbel Method... 85.5% [gumbel] Running Gumbel Method... 85.6% [gumbel] Running Gumbel Method... 85.7% [gumbel] Running Gumbel Method... 85.8% [gumbel] Running Gumbel Method... 85.9% [gumbel] Running Gumbel Method... 86.0% [gumbel] Running Gumbel Method... 86.1% [gumbel] Running Gumbel Method... 86.2% [gumbel] Running Gumbel Method... 86.3% [gumbel] Running Gumbel Method... 86.4% [gumbel] Running Gumbel Method... 86.5% [gumbel] Running Gumbel Method... 86.5% [gumbel] Running Gumbel Method... 86.6% [gumbel] Running Gumbel Method... 86.7% [gumbel] Running Gumbel Method... 86.8% [gumbel] Running Gumbel Method... 86.9% [gumbel] Running Gumbel Method... 87.0% [gumbel] Running Gumbel Method... 87.1% [gumbel] Running Gumbel Method... 87.2% [gumbel] Running Gumbel Method... 87.3% [gumbel] Running Gumbel Method... 87.4% [gumbel] Running Gumbel Method... 87.5% [gumbel] Running Gumbel Method... 87.5% [gumbel] Running Gumbel Method... 87.6% [gumbel] Running Gumbel Method... 87.7% [gumbel] Running Gumbel Method... 87.8% [gumbel] Running Gumbel Method... 87.9% [gumbel] Running Gumbel Method... 88.0% [gumbel] Running Gumbel Method... 88.1% [gumbel] Running Gumbel Method... 88.2% [gumbel] Running Gumbel Method... 88.3% [gumbel] Running Gumbel Method... 88.4% [gumbel] Running Gumbel Method... 88.5% [gumbel] Running Gumbel Method... 88.5% [gumbel] Running Gumbel Method... 88.6% [gumbel] Running Gumbel Method... 88.7% [gumbel] Running Gumbel Method... 88.8% [gumbel] Running Gumbel Method... 88.9% [gumbel] Running Gumbel Method... 89.0% [gumbel] Running Gumbel Method... 89.1% [gumbel] Running Gumbel Method... 89.2% [gumbel] Running Gumbel Method... 89.3% [gumbel] Running Gumbel Method... 89.4% [gumbel] Running Gumbel Method... 89.5% [gumbel] Running Gumbel Method... 89.5% [gumbel] Running Gumbel Method... 89.6% [gumbel] Running Gumbel Method... 89.7% [gumbel] Running Gumbel Method... 89.8% [gumbel] Running Gumbel Method... 89.9% [gumbel] Running Gumbel Method... 90.0% [gumbel] Running Gumbel Method... 90.1% [gumbel] Running Gumbel Method... 90.2% [gumbel] Running Gumbel Method... 90.3% [gumbel] Running Gumbel Method... 90.4% [gumbel] Running Gumbel Method... 90.5% [gumbel] Running Gumbel Method... 90.5% [gumbel] Running Gumbel Method... 90.6% [gumbel] Running Gumbel Method... 90.7% [gumbel] Running Gumbel Method... 90.8% [gumbel] Running Gumbel Method... 90.9% [gumbel] Running Gumbel Method... 91.0% [gumbel] Running Gumbel Method... 91.1% [gumbel] Running Gumbel Method... 91.2% [gumbel] Running Gumbel Method... 91.3% [gumbel] Running Gumbel Method... 91.4% [gumbel] Running Gumbel Method... 91.5% [gumbel] Running Gumbel Method... 91.5% [gumbel] Running Gumbel Method... 91.6% [gumbel] Running Gumbel Method... 91.7% [gumbel] Running Gumbel Method... 91.8% [gumbel] Running Gumbel Method... 91.9% [gumbel] Running Gumbel Method... 92.0% [gumbel] Running Gumbel Method... 92.1% [gumbel] Running Gumbel Method... 92.2% [gumbel] Running Gumbel Method... 92.3% [gumbel] Running Gumbel Method... 92.4% [gumbel] Running Gumbel Method... 92.5% [gumbel] Running Gumbel Method... 92.5% [gumbel] Running Gumbel Method... 92.6% [gumbel] Running Gumbel Method... 92.7% [gumbel] Running Gumbel Method... 92.8% [gumbel] Running Gumbel Method... 92.9% [gumbel] Running Gumbel Method... 93.0% [gumbel] Running Gumbel Method... 93.1% [gumbel] Running Gumbel Method... 93.2% [gumbel] Running Gumbel Method... 93.3% [gumbel] Running Gumbel Method... 93.4% [gumbel] Running Gumbel Method... 93.5% [gumbel] Running Gumbel Method... 93.5% [gumbel] Running Gumbel Method... 93.6% [gumbel] Running Gumbel Method... 93.7% [gumbel] Running Gumbel Method... 93.8% [gumbel] Running Gumbel Method... 93.9% [gumbel] Running Gumbel Method... 94.0% [gumbel] Running Gumbel Method... 94.1% [gumbel] Running Gumbel Method... 94.2% [gumbel] Running Gumbel Method... 94.3% [gumbel] Running Gumbel Method... 94.4% [gumbel] Running Gumbel Method... 94.5% [gumbel] Running Gumbel Method... 94.5% [gumbel] Running Gumbel Method... 94.6% [gumbel] Running Gumbel Method... 94.7% [gumbel] Running Gumbel Method... 94.8% [gumbel] Running Gumbel Method... 94.9% [gumbel] Running Gumbel Method... 95.0% [gumbel] Running Gumbel Method... 95.1% [gumbel] Running Gumbel Method... 95.2% [gumbel] Running Gumbel Method... 95.3% [gumbel] Running Gumbel Method... 95.4% [gumbel] Running Gumbel Method... 95.5% [gumbel] Running Gumbel Method... 95.5% [gumbel] Running Gumbel Method... 95.6% [gumbel] Running Gumbel Method... 95.7% [gumbel] Running Gumbel Method... 95.8% [gumbel] Running Gumbel Method... 95.9% [gumbel] Running Gumbel Method... 96.0% [gumbel] Running Gumbel Method... 96.1% [gumbel] Running Gumbel Method... 96.2% [gumbel] Running Gumbel Method... 96.3% [gumbel] Running Gumbel Method... 96.4% [gumbel] Running Gumbel Method... 96.5% [gumbel] Running Gumbel Method... 96.5% [gumbel] Running Gumbel Method... 96.6% [gumbel] Running Gumbel Method... 96.7% [gumbel] Running Gumbel Method... 96.8% [gumbel] Running Gumbel Method... 96.9% [gumbel] Running Gumbel Method... 97.0% [gumbel] Running Gumbel Method... 97.1% [gumbel] Running Gumbel Method... 97.2% [gumbel] Running Gumbel Method... 97.3% [gumbel] Running Gumbel Method... 97.4% [gumbel] Running Gumbel Method... 97.5% [gumbel] Running Gumbel Method... 97.5% [gumbel] Running Gumbel Method... 97.6% [gumbel] Running Gumbel Method... 97.7% [gumbel] Running Gumbel Method... 97.8% [gumbel] Running Gumbel Method... 97.9% [gumbel] Running Gumbel Method... 98.0% [gumbel] Running Gumbel Method... 98.1% [gumbel] Running Gumbel Method... 98.2% [gumbel] Running Gumbel Method... 98.3% [gumbel] Running Gumbel Method... 98.4% [gumbel] Running Gumbel Method... 98.5% [gumbel] Running Gumbel Method... 98.5% [gumbel] Running Gumbel Method... 98.6% [gumbel] Running Gumbel Method... 98.7% [gumbel] Running Gumbel Method... 98.8% [gumbel] Running Gumbel Method... 98.9% [gumbel] Running Gumbel Method... 99.0% [gumbel] Running Gumbel Method... 99.1% [gumbel] Running Gumbel Method... 99.2% [gumbel] Running Gumbel Method... 99.3% [gumbel] Running Gumbel Method... 99.4% [gumbel] Running Gumbel Method... 99.5% [gumbel] Running Gumbel Method... 99.5% [gumbel] Running Gumbel Method... 99.6% [gumbel] Running Gumbel Method... 99.7% [gumbel] Running Gumbel Method... 99.8% [gumbel] Running Gumbel Method... 99.9% [gumbel] Running Gumbel Method... 100.0% ok test_HMM (tests.test_analysis_methods.TestMethods) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/analysis/hmm.py:194: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.wig' mode='r' encoding='UTF-8'> T = len([1 for line in open(ctrldata[0]).readlines() if not line.startswith("#")]) ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback [gumbel] [gumbel] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [gumbel] Finished Gumbel Method Removing output file... #################### tests.test_analysis_methods.TestMethods.test_HMM #################### [hmm] Starting HMM Method [hmm] Getting Data [hmm] Normalizing using: TTR [hmm] Running HMM Method... 2.5% [hmm] Running HMM Method... 5.0% [hmm] Running HMM Method... 7.5% [hmm] Running HMM Method... 10.0% [hmm] Running HMM Method... 12.5% [hmm] Running HMM Method... 15.0% [hmm] Running HMM Method... 17.5% [hmm] Running HMM Method... 20.0% [hmm] Running HMM Method... 22.5% [hmm] Running HMM Method... 25.0% [hmm] Running HMM Method... 27.5% [hmm] Running HMM Method... 30.0% [hmm] Running HMM Method... 32.5% [hmm] Running HMM Method... 35.0% [hmm] Running HMM Method... 37.5% [hmm] Running HMM Method... 40.0% [hmm] Running HMM Method... 42.5% [hmm] Running HMM Method... 45.0% [hmm] Running HMM Method... 47.5% [hmm] Running HMM Method... 50.0% [hmm] Running HMM Method... 50.0% [hmm] Running HMM Method... 52.5% [hmm] Running HMM Method... 55.0% [hmm] Running HMM Method... 57.5% [hmm] Running HMM Method... 60.0% [hmm] Running HMM Method... 62.5% [hmm] Running HMM Method... 65.0% [hmm] Running HMM Method... 67.5% [hmm] Running HMM Method... 70.0% [hmm] Running HMM Method... 72.5% [hmm] Running HMM Method... 75.0% [hmm] Running HMM Method... 77.5% [hmm] Running HMM Method... 80.0% [hmm] Running HMM Method... 82.5% [hmm] Running HMM Method... 85.0% [hmm] Running HMM Method... 87.5% [hmm] Running HMM Method... 90.0% [hmm] Running HMM Method... 92.5% [hmm] Running HMM Method... 95.0% [hmm] Running HMM Method... 97.5% ok test_anova (tests.test_analysis_methods.TestMethods) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:121: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.prot_table' mode='r' encoding='UTF-8'> for line in open(fname): ResourceWarning: Enable tracemalloc to get the object allocation traceback [hmm] [hmm] Finished HMM - Sites Method [hmm] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [hmm] Creating HMM Genes Level Output [hmm] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput_genes.txt [hmm] Finished HMM Method Removing output file... #################### tests.test_analysis_methods.TestMethods.test_anova #################### [anova] Starting Anova analysis [anova] Getting Data [anova] Normalizing using: TTR [anova] Running Anova [anova] Running Anova Method... 2.0% [anova] Running Anova Method... 3.9% [anova] Running Anova Method... 5.9% [anova] Running Anova Method... 7.8% [anova] Running Anova Method... 9.8% [anova] Running Anova Method... 11.8% [anova] Running Anova Method... 13.7% [anova] Running Anova Method... 15.7% [anova] Running Anova Method... 17.6% [anova] Running Anova Method... 19.6% [anova] Running Anova Method... 21.6% [anova] Running Anova Method... 23.5% [anova] Running Anova Method... 25.5% [anova] Running Anova Method... 27.5% [anova] Running Anova Method... 29.4% [anova] Running Anova Method... 31.4% [anova] Running Anova Method... 33.3% [anova] Running Anova Method... 35.3% [anova] Running Anova Method... 37.3% [anova] Running Anova Method... 39.2% [anova] Running Anova Method... 41.2% [anova] Running Anova Method... 43.1% [anova] Running Anova Method... 45.1% [anova] Running Anova Method... 47.1% [anova] Running Anova Method... 49.0% [anova] Running Anova Method... 51.0% [anova] Running Anova Method... 52.9% [anova] Running Anova Method... 54.9% [anova] Running Anova Method... 56.9% [anova] Running Anova Method... 58.8% [anova] Running Anova Method... 60.8% [anova] Running Anova Method... 62.7% [anova] Running Anova Method... 64.7% [anova] Running Anova Method... 66.7% [anova] Running Anova Method... 68.6% [anova] Running Anova Method... 70.6% [anova] Running Anova Method... 72.5% [anova] Running Anova Method... 74.5% [anova] Running Anova Method... 76.5% [anova] Running Anova Method... 78.4% [anova] Running Anova Method... 80.4% [anova] Running Anova Method... 82.4% [anova] Running Anova Method... 84.3% [anova] Running Anova Method... 86.3% [anova] Running Anova Method... 88.2% [anova] Running Anova Method... 90.2% [anova] Running Anova Method... 92.2% [anova] Running Anova Method... 94.1% [anova] Running Anova Method... 96.1% [anova] Running Anova Method... 98.0% [anova] Running Anova Method... 100.0% /build/tnseq-transit-3.2.1/tests/transit_test.py:89: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/testoutput.txt' mode='r' encoding='UTF-8'> for line in open(fname): ResourceWarning: Enable tracemalloc to get the object allocation traceback ok test_resampling (tests.test_analysis_methods.TestMethods) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/glycerol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:910: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep1.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep2.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:927: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/data/cholesterol_H37Rv_rep3.wig' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.prot_table' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.prot_table' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test.prot_table' mode='r' encoding='UTF-8'> for line in open(self.annotation): ResourceWarning: Enable tracemalloc to get the object allocation traceback [anova] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [anova] Finished Anova analysis [anova] Time: 1.8s Removing output file... #################### tests.test_analysis_methods.TestMethods.test_resampling #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: TTR [resampling] Performing LOESS Correction [resampling] Preprocessing Exp data... [resampling] Normalizing using: TTR [resampling] Performing LOESS Correction [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% /build/tnseq-transit-3.2.1/tests/transit_test.py:89: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/testoutput.txt' mode='r' encoding='UTF-8'> for line in open(fname): ResourceWarning: Enable tracemalloc to get the object allocation traceback ok test_resampling_adaptive (tests.test_analysis_methods.TestMethods) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/stat_tools.py:717: VisibleDeprecationWarning: Creating an ndarray from ragged nested sequences (which is a list-or-tuple of lists-or-tuples-or ndarrays with different lengths or shapes) is deprecated. If you meant to do this, you must specify 'dtype=object' when creating the ndarray DATA[K] = numpy.array([L1[K], L2[K]]) /build/tnseq-transit-3.2.1/tests/../src/pytransit/stat_tools.py:515: VisibleDeprecationWarning: Creating an ndarray from ragged nested sequences (which is a list-or-tuple of lists-or-tuples-or ndarrays with different lengths or shapes) is deprecated. If you meant to do this, you must specify 'dtype=object' when creating the ndarray E[L] = numpy.array([perm[:n1], perm[n1:]]) [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_analysis_methods.TestMethods.test_resampling_adaptive #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: TTR [resampling] Preprocessing Exp data... [resampling] Normalizing using: TTR [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_resampling_combined_wig (tests.test_analysis_methods.TestMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_analysis_methods.TestMethods.test_resampling_combined_wig #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: TTR [resampling] Preprocessing Exp data... [resampling] Normalizing using: TTR [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_resampling_histogram (tests.test_analysis_methods.TestMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method 36 34 Removing output file... #################### tests.test_analysis_methods.TestMethods.test_resampling_histogram #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: TTR [resampling] Preprocessing Exp data... [resampling] Normalizing using: TTR [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_resampling_multistrain (tests.test_analysis_methods.TestMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing histogram files Removing output file... #################### tests.test_analysis_methods.TestMethods.test_resampling_multistrain #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Multiple annotation files found [resampling] Mapping ctrl data to /build/tnseq-transit-3.2.1/tests/data/test.prot_table, exp data to /build/tnseq-transit-3.2.1/tests/data/test.prot_table [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: TTR [resampling] Preprocessing Exp data... [resampling] Normalizing using: TTR [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_utest (tests.test_analysis_methods.TestMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing histogram files Removing output file... #################### tests.test_analysis_methods.TestMethods.test_utest #################### [utest] Starting Mann-Whitney U-test Method [utest] Getting Data [utest] Normalizing using: TTR [utest] Running Mann-Whitney U-test Method... 2.0% [utest] Running Mann-Whitney U-test Method... 3.9% [utest] Running Mann-Whitney U-test Method... 5.9% [utest] Running Mann-Whitney U-test Method... 7.8% [utest] Running Mann-Whitney U-test Method... 9.8% [utest] Running Mann-Whitney U-test Method... 11.8% [utest] Running Mann-Whitney U-test Method... 13.7% [utest] Running Mann-Whitney U-test Method... 15.7% [utest] Running Mann-Whitney U-test Method... 17.6% [utest] Running Mann-Whitney U-test Method... 19.6% [utest] Running Mann-Whitney U-test Method... 21.6% [utest] Running Mann-Whitney U-test Method... 23.5% [utest] Running Mann-Whitney U-test Method... 25.5% [utest] Running Mann-Whitney U-test Method... 27.5% [utest] Running Mann-Whitney U-test Method... 29.4% [utest] Running Mann-Whitney U-test Method... 31.4% [utest] Running Mann-Whitney U-test Method... 33.3% [utest] Running Mann-Whitney U-test Method... 35.3% [utest] Running Mann-Whitney U-test Method... 37.3% [utest] Running Mann-Whitney U-test Method... 39.2% [utest] Running Mann-Whitney U-test Method... 41.2% [utest] Running Mann-Whitney U-test Method... 43.1% [utest] Running Mann-Whitney U-test Method... 45.1% [utest] Running Mann-Whitney U-test Method... 47.1% [utest] Running Mann-Whitney U-test Method... 49.0% [utest] Running Mann-Whitney U-test Method... 51.0% [utest] Running Mann-Whitney U-test Method... 52.9% [utest] Running Mann-Whitney U-test Method... 54.9% [utest] Running Mann-Whitney U-test Method... 56.9% [utest] Running Mann-Whitney U-test Method... 58.8% [utest] Running Mann-Whitney U-test Method... 60.8% [utest] Running Mann-Whitney U-test Method... 62.7% [utest] Running Mann-Whitney U-test Method... 64.7% [utest] Running Mann-Whitney U-test Method... 66.7% [utest] Running Mann-Whitney U-test Method... 68.6% [utest] Running Mann-Whitney U-test Method... 70.6% [utest] Running Mann-Whitney U-test Method... 72.5% [utest] Running Mann-Whitney U-test Method... 74.5% [utest] Running Mann-Whitney U-test Method... 76.5% [utest] Running Mann-Whitney U-test Method... 78.4% [utest] Running Mann-Whitney U-test Method... 80.4% [utest] Running Mann-Whitney U-test Method... 82.4% [utest] Running Mann-Whitney U-test Method... 84.3% [utest] Running Mann-Whitney U-test Method... 86.3% [utest] Running Mann-Whitney U-test Method... 88.2% [utest] Running Mann-Whitney U-test Method... 90.2% [utest] Running Mann-Whitney U-test Method... 92.2% [utest] Running Mann-Whitney U-test Method... 94.1% [utest] Running Mann-Whitney U-test Method... 96.1% [utest] Running Mann-Whitney U-test Method... 98.0% [utest] Running Mann-Whitney U-test Method... 100.0% ok test_zinb (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2' test_zinb_covariates (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2' test_zinb_interactions (tests.test_analysis_methods.TestMethods) ... skipped 'requires R, rpy2' test_TTR (tests.test_norm_methods.TestNormMethods) ... ok test_nonorm (tests.test_norm_methods.TestNormMethods) ... ok test_resampling_NZMean (tests.test_norm_methods.TestNormMethods) ... [utest] [utest] Performing Benjamini-Hochberg Correction [utest] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [utest] Finished Mann-Whitney U-test Method Removing output file... #################### tests.test_norm_methods.TestNormMethods.test_TTR #################### #################### tests.test_norm_methods.TestNormMethods.test_nonorm #################### #################### tests.test_norm_methods.TestNormMethods.test_resampling_NZMean #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: nzmean [resampling] Preprocessing Exp data... [resampling] Normalizing using: nzmean [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_resampling_Quantile (tests.test_norm_methods.TestNormMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_norm_methods.TestNormMethods.test_resampling_Quantile #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: quantile [resampling] Preprocessing Exp data... [resampling] Normalizing using: quantile [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% /build/tnseq-transit-3.2.1/tests/transit_test.py:75: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/testoutput.txt' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback ok test_resampling_TTR (tests.test_norm_methods.TestNormMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_norm_methods.TestNormMethods.test_resampling_TTR #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: TTR [resampling] Preprocessing Exp data... [resampling] Normalizing using: TTR [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_resampling_TotReads (tests.test_norm_methods.TestNormMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_norm_methods.TestNormMethods.test_resampling_TotReads #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: totreads [resampling] Preprocessing Exp data... [resampling] Normalizing using: totreads [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_resampling_ZINFNB (tests.test_norm_methods.TestNormMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_norm_methods.TestNormMethods.test_resampling_ZINFNB #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Normalizing using: zinfnb [resampling] Preprocessing Exp data... [resampling] Normalizing using: zinfnb [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_resampling_nonorm (tests.test_norm_methods.TestNormMethods) ... [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_norm_methods.TestNormMethods.test_resampling_nonorm #################### [resampling] Starting resampling Method [resampling] Getting Data [resampling] Preprocessing Ctrl data... [resampling] Preprocessing Exp data... [resampling] Running Resampling Method... 2.0% [resampling] Running Resampling Method... 3.9% [resampling] Running Resampling Method... 5.9% [resampling] Running Resampling Method... 7.8% [resampling] Running Resampling Method... 9.8% [resampling] Running Resampling Method... 11.8% [resampling] Running Resampling Method... 13.7% [resampling] Running Resampling Method... 15.7% [resampling] Running Resampling Method... 17.6% [resampling] Running Resampling Method... 19.6% [resampling] Running Resampling Method... 21.6% [resampling] Running Resampling Method... 23.5% [resampling] Running Resampling Method... 25.5% [resampling] Running Resampling Method... 27.5% [resampling] Running Resampling Method... 29.4% [resampling] Running Resampling Method... 31.4% [resampling] Running Resampling Method... 33.3% [resampling] Running Resampling Method... 35.3% [resampling] Running Resampling Method... 37.3% [resampling] Running Resampling Method... 39.2% [resampling] Running Resampling Method... 41.2% [resampling] Running Resampling Method... 43.1% [resampling] Running Resampling Method... 45.1% [resampling] Running Resampling Method... 47.1% [resampling] Running Resampling Method... 49.0% [resampling] Running Resampling Method... 51.0% [resampling] Running Resampling Method... 52.9% [resampling] Running Resampling Method... 54.9% [resampling] Running Resampling Method... 56.9% [resampling] Running Resampling Method... 58.8% [resampling] Running Resampling Method... 60.8% [resampling] Running Resampling Method... 62.7% [resampling] Running Resampling Method... 64.7% [resampling] Running Resampling Method... 66.7% [resampling] Running Resampling Method... 68.6% [resampling] Running Resampling Method... 70.6% [resampling] Running Resampling Method... 72.5% [resampling] Running Resampling Method... 74.5% [resampling] Running Resampling Method... 76.5% [resampling] Running Resampling Method... 78.4% [resampling] Running Resampling Method... 80.4% [resampling] Running Resampling Method... 82.4% [resampling] Running Resampling Method... 84.3% [resampling] Running Resampling Method... 86.3% [resampling] Running Resampling Method... 88.2% [resampling] Running Resampling Method... 90.2% [resampling] Running Resampling Method... 92.2% [resampling] Running Resampling Method... 94.1% [resampling] Running Resampling Method... 96.1% [resampling] Running Resampling Method... 98.0% [resampling] Running Resampling Method... 100.0% ok test_cleanargs_flag_arguments_w_quotes (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_cleanargs_flag_arguments_with_double_dash (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_cleanargs_flag_without_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_cleanargs_negative_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_cleanargs_positional_arguments (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_cleanargs_positional_arguments_w_quotes (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_file_types (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_genes_creation_fromdata (tests.test_pytransit_tools.TestTnSeqTools) ... /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:1287: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:1214: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'> for line in open(path): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytransit/tnseq_tools.py:518: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/../src/pytransit/genomes/H37Rv.prot_table' mode='r' encoding='UTF-8'> for line in open(self.annotation): ResourceWarning: Enable tracemalloc to get the object allocation traceback ok test_genes_creation_fromwig (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_normalization (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_read_data (tests.test_pytransit_tools.TestTnSeqTools) ... ok test_tpp_flag_primer (tests.test_tpp.TestTPP) ... skipped 'requires local data file' test_tpp_multicontig_auto_replicon_ids (tests.test_tpp.TestTPP) ... [tn_preprocess] running pre-processing on /build/tnseq-transit-3.2.1/tests/data/test-multicontig-1.fastq and [tn_preprocess] protocol: Sassetti [tn_preprocess] transposon type: Himar1 [tn_preprocess] One reference genome specified: /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna, containing 3 records. [tn_preprocess] Autogenerating replicon_ids... [tn_preprocess] extracting reads... [tn_preprocess] fastq2reads: /build/tnseq-transit-3.2.1/tests/data/test-multicontig-1.fastq -> /build/tnseq-transit-3.2.1/tests/test_tpp_temp.reads1 /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:85: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test-multicontig-1.fastq' mode='r' encoding='UTF-8'> for line in open(infile): ResourceWarning: Enable tracemalloc to get the object allocation traceback [tn_preprocess] assuming single-ended reads [tn_preprocess] creating /build/tnseq-transit-3.2.1/tests/test_tpp_temp.trimmed1 [tn_preprocess] prefix sequence: [tn_preprocess] Looking for start of Tn prefix within P,Q = [0,20] /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:276: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'> for line in open(infile): ResourceWarning: Enable tracemalloc to get the object allocation traceback [tn_preprocess] mapping reads using BWA...(this takes a couple of minutes) [tn_preprocess] /usr/bin/bwa index /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna b'[bwa_index] Pack FASTA... 0.17 sec' b'[bwa_index] Construct BWT for the packed sequence...' b'[bwa_index] 8.39 seconds elapse.' b'[bwa_index] Update BWT... 0.12 sec' b'[bwa_index] Pack forward-only FASTA... 0.12 sec' b'[bwa_index] Construct SA from BWT and Occ... 5.76 sec' b'[main] Version: 0.7.17-r1188' b'[main] CMD: /usr/bin/bwa index /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna' b'[main] Real time: 14.797 sec; CPU: 14.567 sec' b'' [tn_preprocess] /usr/bin/bwa mem /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna /build/tnseq-transit-3.2.1/tests/test_tpp_temp.trimmed1 > /build/tnseq-transit-3.2.1/tests/test_tpp_temp.sam b'[M::bwa_idx_load_from_disk] read 0 ALT contigs' b'[M::process] read 2500 sequences (304052 bp)...' b'[M::mem_process_seqs] Processed 2500 reads in 0.619 CPU sec, 0.625 real sec' b'[main] Version: 0.7.17-r1188' b'[main] CMD: /usr/bin/bwa mem /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna /build/tnseq-transit-3.2.1/tests/test_tpp_temp.trimmed1' b'[main] Real time: 0.665 sec; CPU: 0.657 sec' b'' [tn_preprocess] tabulating template counts and statistics for reference genome /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:378: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna' mode='r' encoding='UTF-8'> for line in open(filename): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:560: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/test_tpp_temp.sam' mode='r' encoding='UTF-8'> for line in open(sam): ResourceWarning: Enable tracemalloc to get the object allocation traceback [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp_1.wig [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp_2.wig [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp_3.wig /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:1108: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'> for line in open(vars.reads1): ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:1117: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/test_tpp_temp.reads1' mode='r' encoding='UTF-8'> read_length = get_read_length(vars.base + ".reads1") ResourceWarning: Enable tracemalloc to get the object allocation traceback /build/tnseq-transit-3.2.1/tests/../src/pytpp/tpp_tools.py:1118: ResourceWarning: unclosed file <_io.TextIOWrapper name='/build/tnseq-transit-3.2.1/tests/test_tpp_temp.trimmed1' mode='r' encoding='UTF-8'> mean_r1_genomic = get_genomic_portion(vars.base + ".trimmed1") ResourceWarning: Enable tracemalloc to get the object allocation traceback [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp.tn_stats [tn_preprocess] Done. ok test_tpp_multicontig_empty_prefix (tests.test_tpp.TestTPP) ... [tn_preprocess] running pre-processing on /build/tnseq-transit-3.2.1/tests/data/test-multicontig-1.fastq and [tn_preprocess] protocol: Sassetti [tn_preprocess] transposon type: Himar1 [tn_preprocess] One reference genome specified: /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna, containing 3 records. [tn_preprocess] extracting reads... [tn_preprocess] fastq2reads: /build/tnseq-transit-3.2.1/tests/data/test-multicontig-1.fastq -> /build/tnseq-transit-3.2.1/tests/test_tpp_temp.reads1 [tn_preprocess] assuming single-ended reads [tn_preprocess] creating /build/tnseq-transit-3.2.1/tests/test_tpp_temp.trimmed1 [tn_preprocess] prefix sequence: [tn_preprocess] Looking for start of Tn prefix within P,Q = [0,20] [tn_preprocess] mapping reads using BWA...(this takes a couple of minutes) [tn_preprocess] /usr/bin/bwa mem /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna /build/tnseq-transit-3.2.1/tests/test_tpp_temp.trimmed1 > /build/tnseq-transit-3.2.1/tests/test_tpp_temp.sam b'[M::bwa_idx_load_from_disk] read 0 ALT contigs' b'[M::process] read 2500 sequences (304052 bp)...' b'[M::mem_process_seqs] Processed 2500 reads in 0.683 CPU sec, 0.687 real sec' b'[main] Version: 0.7.17-r1188' b'[main] CMD: /usr/bin/bwa mem /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna /build/tnseq-transit-3.2.1/tests/test_tpp_temp.trimmed1' b'[main] Real time: 0.728 sec; CPU: 0.727 sec' b'' [tn_preprocess] tabulating template counts and statistics for reference genome /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp_a.wig [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp_b.wig [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp_c.wig [tn_preprocess] writing /build/tnseq-transit-3.2.1/tests/test_tpp_temp.tn_stats [tn_preprocess] Done. ok test_tpp_noflag_primer (tests.test_tpp.TestTPP) ... skipped 'requires local data file' test_tpp_protocol_mme1 (tests.test_tpp.TestTPP) ... skipped 'requires local data file' ---------------------------------------------------------------------- Ran 39 tests in 712.268s OK (skipped=6) [resampling] [resampling] Performing Benjamini-Hochberg Correction [resampling] Adding File: /build/tnseq-transit-3.2.1/tests/testoutput.txt [resampling] Finished resampling Method Removing output file... #################### tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_arguments_w_quotes #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_arguments_with_double_dash #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_flag_without_arguments #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_negative_arguments #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_positional_arguments #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_cleanargs_positional_arguments_w_quotes #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_file_types #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_genes_creation_fromdata #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_genes_creation_fromwig #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_normalization #################### #################### tests.test_pytransit_tools.TestTnSeqTools.test_read_data #################### #################### tests.test_tpp.TestTPP.test_tpp_multicontig_auto_replicon_ids #################### # title: Tn-Seq Pre-Processor # date: 07/14/2021 16:47:13 # command: python python3.9 -m unittest -v tests/test_analysis_methods.py tests/test_norm_methods.py tests/test_pytransit_tools.py tests/test_tpp.py tests/transit_test.py # transposon type: Himar1 # protocol type: Sassetti # bwa flags: # read1: /build/tnseq-transit-3.2.1/tests/data/test-multicontig-1.fastq # read2: # ref_genome: /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna # replicon_ids: 1,2,3 # total_reads (or read pairs): 2500 # trimmed_reads (reads with valid Tn prefix, and insert size>20bp): 2512 # reads1_mapped: 2116 # reads2_mapped: 0 # mapped_reads (both R1 and R2 map into genome, and R2 has a proper barcode): 2116 # read_count (TA sites only, for Himar1): # 1: 63 # 2: 0 # 3: 0 # template_count: # 1: 63 # 2: 0 # 3: 0 # template_ratio (reads per template): # 1: 1.00 # 2: 0.00 # 3: 0.00 # TA_sites: # 1: 89994 # 2: 646 # 3: 664 # TAs_hit: # 1: 63 # 2: 0 # 3: 0 # density: # 1: 0.001 # 2: 0.000 # 3: 0.000 # max_count (among templates): # 1: 1 # 2: 0 # 3: 0 # max_site (coordinate): # 1: 4977050 # 2: 57441 # 3: 38111 # NZ_mean (among templates): # 1: 1.0 # 2: 0.0 # 3: 0.0 # FR_corr (Fwd templates vs. Rev templates): # 1: -0.000 # 2: nan # 3: nan # BC_corr (reads vs. templates, summed over both strands): # 1: nan # 2: nan # 3: nan # primer_matches: 36 reads (1.4%) contain CTAGAGGGCCCAATTCGCCCTATAGTGAGT (Himar1) # vector_matches: 36 reads (1.4%) contain CTAGACCGTCCAGTCTGGCAGGCCGGAAAC (phiMycoMarT7) # adapter_matches: 57 reads (2.3%) contain GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina/TruSeq index) # misprimed_reads: 17 reads (0.7%) contain Himar1 prefix but don't end in TGTTA # read_length: 125 bp # mean_R1_genomic_length: 121.6 bp Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file #################### tests.test_tpp.TestTPP.test_tpp_multicontig_empty_prefix #################### # title: Tn-Seq Pre-Processor # date: 07/14/2021 16:47:20 # command: python python3.9 -m unittest -v tests/test_analysis_methods.py tests/test_norm_methods.py tests/test_pytransit_tools.py tests/test_tpp.py tests/transit_test.py # transposon type: Himar1 # protocol type: Sassetti # bwa flags: # read1: /build/tnseq-transit-3.2.1/tests/data/test-multicontig-1.fastq # read2: # ref_genome: /build/tnseq-transit-3.2.1/tests/data/test-multicontig.fna # replicon_ids: a,b,c # total_reads (or read pairs): 2500 # trimmed_reads (reads with valid Tn prefix, and insert size>20bp): 2512 # reads1_mapped: 2116 # reads2_mapped: 0 # mapped_reads (both R1 and R2 map into genome, and R2 has a proper barcode): 2116 # read_count (TA sites only, for Himar1): # a: 63 # b: 0 # c: 0 # template_count: # a: 63 # b: 0 # c: 0 # template_ratio (reads per template): # a: 1.00 # b: 0.00 # c: 0.00 # TA_sites: # a: 89994 # b: 646 # c: 664 # TAs_hit: # a: 63 # b: 0 # c: 0 # density: # a: 0.001 # b: 0.000 # c: 0.000 # max_count (among templates): # a: 1 # b: 0 # c: 0 # max_site (coordinate): # a: 4977050 # b: 57441 # c: 38111 # NZ_mean (among templates): # a: 1.0 # b: 0.0 # c: 0.0 # FR_corr (Fwd templates vs. Rev templates): # a: -0.000 # b: nan # c: nan # BC_corr (reads vs. templates, summed over both strands): # a: nan # b: nan # c: nan # primer_matches: 36 reads (1.4%) contain CTAGAGGGCCCAATTCGCCCTATAGTGAGT (Himar1) # vector_matches: 36 reads (1.4%) contain CTAGACCGTCCAGTCTGGCAGGCCGGAAAC (phiMycoMarT7) # adapter_matches: 57 reads (2.3%) contain GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (Illumina/TruSeq index) # misprimed_reads: 17 reads (0.7%) contain Himar1 prefix but don't end in TGTTA # read_length: 125 bp # mean_R1_genomic_length: 121.6 bp Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file Removing tpp test file make[1]: uscita dalla directory «/build/tnseq-transit-3.2.1» create-stamp debian/debhelper-build-stamp dh_testroot -O--buildsystem=pybuild dh_prep -O--buildsystem=pybuild dh_auto_install -O--buildsystem=pybuild I: pybuild base:232: /usr/bin/python3 setup.py install --root /build/tnseq-transit-3.2.1/debian/tnseq-transit running install running build running build_py running egg_info writing tnseq_transit.egg-info/PKG-INFO writing dependency_links to tnseq_transit.egg-info/dependency_links.txt writing entry points to tnseq_transit.egg-info/entry_points.txt writing requirements to tnseq_transit.egg-info/requires.txt writing top-level names to tnseq_transit.egg-info/top_level.txt reading manifest file 'tnseq_transit.egg-info/SOURCES.txt' reading manifest template 'MANIFEST.in' warning: no files found matching 'VERSION' warning: no files found matching '*.html' under directory 'src/pytransit/doc/build/html' warning: no files found matching '*.png' under directory 'src/pytransit/doc/build/html/_images' warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_modules' warning: no files found matching '*' under directory 'src/pytransit/doc/build/html/_static' writing manifest file 'tnseq_transit.egg-info/SOURCES.txt' running install_lib creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9 creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp/tpp_gui.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp/tpp_tools.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp/__main__.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytpp/__init__.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/trash.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/stat_tools.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/norm_tools.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/fileDisplay.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/view_trash.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/draw_trash.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv_GO_terms.txt -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv.sanger_associated_RVS.csv -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/samples_metadata_cg_covar.txt -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/README.md -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/gene_ontology.1_2.3-11-18.obo -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv_sanger_roles.dat -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/samples_metadata_cg.txt -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/GO_associated_Rvs-3-11-18.txt -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/H37Rv_COG_roles.dat -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/COG_roles.dat -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/glycerol_H37Rv_rep1.wig -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_rep3.wig -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_glycerol_combined.dat -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/smeg_GO_terms.txt -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/sanger_roles.dat -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/GO_terms_for_each_Rv.obo-3-11-18.txt -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/glycerol_H37Rv_merged.wig -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_rep1.wig -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/GO_term_names.dat -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_merged.wig -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/cholesterol_H37Rv_rep2.wig -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/glycerol_H37Rv_rep2.wig -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/GO_associated_Rvs.csv -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/data/samples_metadata_cg_interactions.txt -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/data copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/qcDisplay.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/convert/base.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/convert/__init__.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/convert/gff_to_prot_table.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/images.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/transit_gui.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvMA2.fna -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/BCG.fna -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/BCG.prot_table -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/H37Rv.fna -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvBD_mod3.prot_table -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvMA2.prot_table -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/genomes.html -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/mc2_155_tamu.prot_table -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvBD.prot_table -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/H37RvBD.fna -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/H37Rv.prot_table -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/genomes/mc2_155_tamu.fna -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/genomes copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/transit_tools.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/__main__.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/rankproduct.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/anova.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/base.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/gi.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/example.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/corrplot.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/tn5gaps.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/normalize.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/tnseq_stats.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/binomial.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/heatmap.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/utest.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/griffin.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/pathway_enrichment.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/gumbel.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/__init__.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/hmm.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/zinb.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/resampling.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/analysis/norm.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis creating /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export/base.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export/igv.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export/prot_table.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export/mean_counts.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export/__init__.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/export/combined_wig.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/__init__.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit copying /build/tnseq-transit-3.2.1/.pybuild/cpython3_3.9/build/pytransit/tnseq_tools.py -> /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/tpp_gui.py to tpp_gui.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/tpp_tools.py to tpp_tools.cpython-39.pyc /usr/lib/python3.9/dist-packages/pytpp/tpp_tools.py:648: SyntaxWarning: "is" with a literal. Did you mean "=="? /usr/lib/python3.9/dist-packages/pytpp/tpp_tools.py:651: SyntaxWarning: "is" with a literal. Did you mean "=="? byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/__main__.py to __main__.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytpp/__init__.py to __init__.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/trash.py to trash.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/stat_tools.py to stat_tools.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/norm_tools.py to norm_tools.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/fileDisplay.py to fileDisplay.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/view_trash.py to view_trash.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/draw_trash.py to draw_trash.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/qcDisplay.py to qcDisplay.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert/base.py to base.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert/__init__.py to __init__.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/convert/gff_to_prot_table.py to gff_to_prot_table.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/images.py to images.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/transit_gui.py to transit_gui.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/transit_tools.py to transit_tools.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/__main__.py to __main__.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/rankproduct.py to rankproduct.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/anova.py to anova.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/base.py to base.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/gi.py to gi.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/example.py to example.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/corrplot.py to corrplot.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/tn5gaps.py to tn5gaps.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/normalize.py to normalize.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/tnseq_stats.py to tnseq_stats.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/binomial.py to binomial.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/heatmap.py to heatmap.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/utest.py to utest.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/griffin.py to griffin.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/pathway_enrichment.py to pathway_enrichment.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/gumbel.py to gumbel.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/__init__.py to __init__.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/hmm.py to hmm.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/zinb.py to zinb.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/resampling.py to resampling.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/analysis/norm.py to norm.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/base.py to base.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/igv.py to igv.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/prot_table.py to prot_table.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/mean_counts.py to mean_counts.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/__init__.py to __init__.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/export/combined_wig.py to combined_wig.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/__init__.py to __init__.cpython-39.pyc byte-compiling /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/pytransit/tnseq_tools.py to tnseq_tools.cpython-39.pyc running install_egg_info Copying tnseq_transit.egg-info to /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/lib/python3.9/dist-packages/tnseq_transit-3.2.1.egg-info Skipping SOURCES.txt running install_scripts Installing tpp script to /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/bin Installing transit script to /build/tnseq-transit-3.2.1/debian/tnseq-transit/usr/bin debian/rules override_dh_install make[1]: ingresso nella directory «/build/tnseq-transit-3.2.1» dh_install mv debian/tnseq-transit/usr/bin/tpp debian/tnseq-transit/usr/bin/transit-tpp make[1]: uscita dalla directory «/build/tnseq-transit-3.2.1» dh_installdocs -O--buildsystem=pybuild dh_installchangelogs -O--buildsystem=pybuild dh_installman -O--buildsystem=pybuild dh_python3 -O--buildsystem=pybuild dh_installsystemduser -O--buildsystem=pybuild dh_perl -O--buildsystem=pybuild dh_link -O--buildsystem=pybuild dh_strip_nondeterminism -O--buildsystem=pybuild dh_compress -O--buildsystem=pybuild dh_fixperms -O--buildsystem=pybuild dh_missing -O--buildsystem=pybuild dh_dwz -a -O--buildsystem=pybuild dh_strip -a -O--buildsystem=pybuild dh_makeshlibs -a -O--buildsystem=pybuild dh_shlibdeps -a -O--buildsystem=pybuild dh_installdeb -O--buildsystem=pybuild dh_gencontrol -O--buildsystem=pybuild dh_md5sums -O--buildsystem=pybuild dh_builddeb -O--buildsystem=pybuild dpkg-deb: generazione del pacchetto "tnseq-transit" in "../tnseq-transit_3.2.1-1_armhf.deb". dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../tnseq-transit_3.2.1-1_armhf.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: including full source code in upload I: copying local configuration I: user script /srv/workspace/pbuilder/21411/tmp/hooks/B01_cleanup starting I: user script /srv/workspace/pbuilder/21411/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/21411 and its subdirectories I: Current time: Wed Jul 14 16:49:17 +14 2021 I: pbuilder-time-stamp: 1626230957