I: pbuilder: network access will be disabled during build I: Current time: Sat Jan 15 21:26:26 -12 2022 I: pbuilder-time-stamp: 1642325186 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/buster-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [pftools_3+dfsg-3.dsc] I: copying [./pftools_3+dfsg.orig.tar.xz] I: copying [./pftools_3+dfsg-3.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/root/.gnupg/trustedkeys.kbx': General error gpgv: Signature made Fri Sep 7 00:47:32 2018 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./pftools_3+dfsg-3.dsc dpkg-source: info: extracting pftools in pftools-3+dfsg dpkg-source: info: unpacking pftools_3+dfsg.orig.tar.xz dpkg-source: info: unpacking pftools_3+dfsg-3.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_path_in_test_script.patch dpkg-source: info: applying fix_test_output.patch dpkg-source: info: applying build_gtop.patch dpkg-source: info: applying getopt_for_pgdump.patch dpkg-source: info: applying spelling.patch I: using fakeroot in build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/54490/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='amd64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=16' DISTRIBUTION='' HOME='/root' HOST_ARCH='amd64' IFS=' ' INVOCATION_ID='a3a0e802fed243379ae139a28900eb62' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='54490' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.Xzwz6vn3yl/pbuilderrc_YrRR --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/buster-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.Xzwz6vn3yl/b1 --logfile b1/build.log pftools_3+dfsg-3.dsc' SUDO_GID='110' SUDO_UID='105' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://85.184.249.68:3128' I: uname -a Linux ionos5-amd64 5.9.0-0.bpo.2-amd64 #1 SMP Debian 5.9.6-1~bpo10+1 (2020-11-19) x86_64 GNU/Linux I: ls -l /bin total 5116 -rwxr-xr-x 1 root root 1168776 Apr 17 2019 bash -rwxr-xr-x 3 root root 38984 Jul 10 2019 bunzip2 -rwxr-xr-x 3 root root 38984 Jul 10 2019 bzcat lrwxrwxrwx 1 root root 6 Jul 10 2019 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2227 Jul 10 2019 bzdiff lrwxrwxrwx 1 root root 6 Jul 10 2019 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Jun 24 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 10 2019 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3641 Jul 10 2019 bzgrep -rwxr-xr-x 3 root root 38984 Jul 10 2019 bzip2 -rwxr-xr-x 1 root root 14328 Jul 10 2019 bzip2recover lrwxrwxrwx 1 root root 6 Jul 10 2019 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 10 2019 bzmore -rwxr-xr-x 1 root root 43744 Feb 28 2019 cat -rwxr-xr-x 1 root root 64320 Feb 28 2019 chgrp -rwxr-xr-x 1 root root 64288 Feb 28 2019 chmod -rwxr-xr-x 1 root root 72512 Feb 28 2019 chown -rwxr-xr-x 1 root root 146880 Feb 28 2019 cp -rwxr-xr-x 1 root root 121464 Jan 17 2019 dash -rwxr-xr-x 1 root root 109408 Feb 28 2019 date -rwxr-xr-x 1 root root 76712 Feb 28 2019 dd -rwxr-xr-x 1 root root 93744 Feb 28 2019 df -rwxr-xr-x 1 root root 138856 Feb 28 2019 dir -rwxr-xr-x 1 root root 84288 Jan 9 2019 dmesg lrwxrwxrwx 1 root root 8 Sep 26 2018 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Sep 26 2018 domainname -> hostname -rwxr-xr-x 1 root root 39520 Feb 28 2019 echo -rwxr-xr-x 1 root root 28 Jan 7 2019 egrep -rwxr-xr-x 1 root root 35424 Feb 28 2019 false -rwxr-xr-x 1 root root 28 Jan 7 2019 fgrep -rwxr-xr-x 1 root root 68880 Jan 9 2019 findmnt -rwsr-xr-x 1 root root 34896 Apr 22 2020 fusermount -rwxr-xr-x 1 root root 198976 Jan 7 2019 grep -rwxr-xr-x 2 root root 2345 Jan 5 2019 gunzip -rwxr-xr-x 1 root root 6375 Jan 5 2019 gzexe -rwxr-xr-x 1 root root 98048 Jan 5 2019 gzip -rwxr-xr-x 1 root root 26696 Sep 26 2018 hostname -rwxr-xr-x 1 root root 68552 Feb 28 2019 ln -rwxr-xr-x 1 root root 56760 Jul 26 2018 login -rwxr-xr-x 1 root root 138856 Feb 28 2019 ls -rwxr-xr-x 1 root root 108624 Jan 9 2019 lsblk -rwxr-xr-x 1 root root 89088 Feb 28 2019 mkdir -rwxr-xr-x 1 root root 68544 Feb 28 2019 mknod -rwxr-xr-x 1 root root 43808 Feb 28 2019 mktemp -rwxr-xr-x 1 root root 43008 Jan 9 2019 more -rwsr-xr-x 1 root root 51280 Jan 9 2019 mount -rwxr-xr-x 1 root root 14408 Jan 9 2019 mountpoint -rwxr-xr-x 1 root root 138728 Feb 28 2019 mv lrwxrwxrwx 1 root root 8 Sep 26 2018 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Feb 14 2019 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 39616 Feb 28 2019 pwd lrwxrwxrwx 1 root root 4 Apr 17 2019 rbash -> bash -rwxr-xr-x 1 root root 47776 Feb 28 2019 readlink -rwxr-xr-x 1 root root 68416 Feb 28 2019 rm -rwxr-xr-x 1 root root 47776 Feb 28 2019 rmdir -rwxr-xr-x 1 root root 23312 Jan 21 2019 run-parts -rwxr-xr-x 1 root root 122224 Dec 22 2018 sed lrwxrwxrwx 1 root root 4 Jan 9 02:46 sh -> dash -rwxr-xr-x 1 root root 39552 Feb 28 2019 sleep -rwxr-xr-x 1 root root 80672 Feb 28 2019 stty -rwsr-xr-x 1 root root 63568 Jan 9 2019 su -rwxr-xr-x 1 root root 35488 Feb 28 2019 sync -rwxr-xr-x 1 root root 445560 Apr 23 2019 tar -rwxr-xr-x 1 root root 14440 Jan 21 2019 tempfile -rwxr-xr-x 1 root root 97152 Feb 28 2019 touch -rwxr-xr-x 1 root root 35424 Feb 28 2019 true -rwxr-xr-x 1 root root 14328 Apr 22 2020 ulockmgr_server -rwsr-xr-x 1 root root 34888 Jan 9 2019 umount -rwxr-xr-x 1 root root 39584 Feb 28 2019 uname -rwxr-xr-x 2 root root 2345 Jan 5 2019 uncompress -rwxr-xr-x 1 root root 138856 Feb 28 2019 vdir -rwxr-xr-x 1 root root 34896 Jan 9 2019 wdctl -rwxr-xr-x 1 root root 946 Jan 21 2019 which lrwxrwxrwx 1 root root 8 Sep 26 2018 ypdomainname -> hostname -rwxr-xr-x 1 root root 1983 Jan 5 2019 zcat -rwxr-xr-x 1 root root 1677 Jan 5 2019 zcmp -rwxr-xr-x 1 root root 5879 Jan 5 2019 zdiff -rwxr-xr-x 1 root root 29 Jan 5 2019 zegrep -rwxr-xr-x 1 root root 29 Jan 5 2019 zfgrep -rwxr-xr-x 1 root root 2080 Jan 5 2019 zforce -rwxr-xr-x 1 root root 7584 Jan 5 2019 zgrep -rwxr-xr-x 1 root root 2205 Jan 5 2019 zless -rwxr-xr-x 1 root root 1841 Jan 5 2019 zmore -rwxr-xr-x 1 root root 4552 Jan 5 2019 znew I: user script /srv/workspace/pbuilder/54490/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: amd64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper (>= 11~), gfortran, autoconf-archive dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19195 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper (>= 11~); however: Package debhelper is not installed. pbuilder-satisfydepends-dummy depends on gfortran; however: Package gfortran is not installed. pbuilder-satisfydepends-dummy depends on autoconf-archive; however: Package autoconf-archive is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} autoconf-archive{a} automake{a} autopoint{a} autotools-dev{a} bsdmainutils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} gfortran{a} gfortran-8{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libbsd0{a} libcroco3{a} libelf1{a} libfile-stripnondeterminism-perl{a} libgfortran-8-dev{a} libgfortran5{a} libglib2.0-0{a} libicu63{a} libmagic-mgc{a} libmagic1{a} libncurses6{a} libpipeline1{a} libsigsegv2{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} po-debconf{a} sensible-utils{a} The following packages are RECOMMENDED but will NOT be installed: curl libarchive-cpio-perl libglib2.0-data libgpm2 libltdl-dev libmail-sendmail-perl lynx shared-mime-info wget xdg-user-dirs 0 packages upgraded, 38 newly installed, 0 to remove and 0 not upgraded. Need to get 30.3 MB of archives. After unpacking 111 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian buster/main amd64 libbsd0 amd64 0.9.1-2 [99.5 kB] Get: 2 http://deb.debian.org/debian buster/main amd64 bsdmainutils amd64 11.1.2+b1 [191 kB] Get: 3 http://deb.debian.org/debian buster/main amd64 libuchardet0 amd64 0.0.6-3 [64.9 kB] Get: 4 http://deb.debian.org/debian buster/main amd64 groff-base amd64 1.22.4-3 [916 kB] Get: 5 http://deb.debian.org/debian buster/main amd64 libpipeline1 amd64 1.5.1-2 [31.2 kB] Get: 6 http://deb.debian.org/debian buster/main amd64 man-db amd64 2.8.5-2 [1274 kB] Get: 7 http://deb.debian.org/debian buster/main amd64 autoconf-archive all 20180313-1 [749 kB] Get: 8 http://deb.debian.org/debian buster/main amd64 sensible-utils all 0.0.12 [15.8 kB] Get: 9 http://deb.debian.org/debian buster/main amd64 libmagic-mgc amd64 1:5.35-4+deb10u1 [242 kB] Get: 10 http://deb.debian.org/debian buster/main amd64 libmagic1 amd64 1:5.35-4+deb10u1 [117 kB] Get: 11 http://deb.debian.org/debian buster/main amd64 file amd64 1:5.35-4+deb10u1 [66.4 kB] Get: 12 http://deb.debian.org/debian buster/main amd64 gettext-base amd64 0.19.8.1-9 [123 kB] Get: 13 http://deb.debian.org/debian buster/main amd64 libsigsegv2 amd64 2.12-2 [32.8 kB] Get: 14 http://deb.debian.org/debian buster/main amd64 m4 amd64 1.4.18-2 [203 kB] Get: 15 http://deb.debian.org/debian buster/main amd64 autoconf all 2.69-11 [341 kB] Get: 16 http://deb.debian.org/debian buster/main amd64 autotools-dev all 20180224.1 [77.0 kB] Get: 17 http://deb.debian.org/debian buster/main amd64 automake all 1:1.16.1-4 [771 kB] Get: 18 http://deb.debian.org/debian buster/main amd64 autopoint all 0.19.8.1-9 [434 kB] Get: 19 http://deb.debian.org/debian buster/main amd64 libtool all 2.4.6-9 [547 kB] Get: 20 http://deb.debian.org/debian buster/main amd64 dh-autoreconf all 19 [16.9 kB] Get: 21 http://deb.debian.org/debian buster/main amd64 libarchive-zip-perl all 1.64-1 [96.8 kB] Get: 22 http://deb.debian.org/debian buster/main amd64 libfile-stripnondeterminism-perl all 1.1.2-1 [19.8 kB] Get: 23 http://deb.debian.org/debian buster/main amd64 dh-strip-nondeterminism all 1.1.2-1 [13.0 kB] Get: 24 http://deb.debian.org/debian buster/main amd64 libelf1 amd64 0.176-1.1 [161 kB] Get: 25 http://deb.debian.org/debian buster/main amd64 dwz amd64 0.12-3 [78.0 kB] Get: 26 http://deb.debian.org/debian buster/main amd64 libglib2.0-0 amd64 2.58.3-2+deb10u2 [1258 kB] Get: 27 http://deb.debian.org/debian buster/main amd64 libicu63 amd64 63.1-6+deb10u1 [8300 kB] Get: 28 http://deb.debian.org/debian buster/main amd64 libxml2 amd64 2.9.4+dfsg1-7+deb10u1 [689 kB] Get: 29 http://deb.debian.org/debian buster/main amd64 libcroco3 amd64 0.6.12-3 [145 kB] Get: 30 http://deb.debian.org/debian buster/main amd64 libncurses6 amd64 6.1+20181013-2+deb10u2 [102 kB] Get: 31 http://deb.debian.org/debian buster/main amd64 gettext amd64 0.19.8.1-9 [1303 kB] Get: 32 http://deb.debian.org/debian buster/main amd64 intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 33 http://deb.debian.org/debian buster/main amd64 po-debconf all 1.0.21 [248 kB] Get: 34 http://deb.debian.org/debian buster/main amd64 debhelper all 12.1.1 [1016 kB] Get: 35 http://deb.debian.org/debian buster/main amd64 libgfortran5 amd64 8.3.0-6 [581 kB] Get: 36 http://deb.debian.org/debian buster/main amd64 libgfortran-8-dev amd64 8.3.0-6 [616 kB] Get: 37 http://deb.debian.org/debian buster/main amd64 gfortran-8 amd64 8.3.0-6 [9375 kB] Get: 38 http://deb.debian.org/debian buster/main amd64 gfortran amd64 4:8.3.0-1 [1432 B] Fetched 30.3 MB in 0s (66.4 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libbsd0:amd64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19195 files and directories currently installed.) Preparing to unpack .../00-libbsd0_0.9.1-2_amd64.deb ... Unpacking libbsd0:amd64 (0.9.1-2) ... Selecting previously unselected package bsdmainutils. Preparing to unpack .../01-bsdmainutils_11.1.2+b1_amd64.deb ... Unpacking bsdmainutils (11.1.2+b1) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../02-libuchardet0_0.0.6-3_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.6-3) ... Selecting previously unselected package groff-base. Preparing to unpack .../03-groff-base_1.22.4-3_amd64.deb ... Unpacking groff-base (1.22.4-3) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../04-libpipeline1_1.5.1-2_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.1-2) ... Selecting previously unselected package man-db. Preparing to unpack .../05-man-db_2.8.5-2_amd64.deb ... Unpacking man-db (2.8.5-2) ... Selecting previously unselected package autoconf-archive. Preparing to unpack .../06-autoconf-archive_20180313-1_all.deb ... Unpacking autoconf-archive (20180313-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../07-sensible-utils_0.0.12_all.deb ... Unpacking sensible-utils (0.0.12) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../08-libmagic-mgc_1%3a5.35-4+deb10u1_amd64.deb ... Unpacking libmagic-mgc (1:5.35-4+deb10u1) ... Selecting previously unselected package libmagic1:amd64. Preparing to unpack .../09-libmagic1_1%3a5.35-4+deb10u1_amd64.deb ... Unpacking libmagic1:amd64 (1:5.35-4+deb10u1) ... Selecting previously unselected package file. Preparing to unpack .../10-file_1%3a5.35-4+deb10u1_amd64.deb ... Unpacking file (1:5.35-4+deb10u1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../11-gettext-base_0.19.8.1-9_amd64.deb ... Unpacking gettext-base (0.19.8.1-9) ... Selecting previously unselected package libsigsegv2:amd64. Preparing to unpack .../12-libsigsegv2_2.12-2_amd64.deb ... Unpacking libsigsegv2:amd64 (2.12-2) ... Selecting previously unselected package m4. Preparing to unpack .../13-m4_1.4.18-2_amd64.deb ... Unpacking m4 (1.4.18-2) ... Selecting previously unselected package autoconf. Preparing to unpack .../14-autoconf_2.69-11_all.deb ... Unpacking autoconf (2.69-11) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../15-autotools-dev_20180224.1_all.deb ... Unpacking autotools-dev (20180224.1) ... Selecting previously unselected package automake. Preparing to unpack .../16-automake_1%3a1.16.1-4_all.deb ... Unpacking automake (1:1.16.1-4) ... Selecting previously unselected package autopoint. Preparing to unpack .../17-autopoint_0.19.8.1-9_all.deb ... Unpacking autopoint (0.19.8.1-9) ... Selecting previously unselected package libtool. Preparing to unpack .../18-libtool_2.4.6-9_all.deb ... Unpacking libtool (2.4.6-9) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../19-dh-autoreconf_19_all.deb ... Unpacking dh-autoreconf (19) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../20-libarchive-zip-perl_1.64-1_all.deb ... Unpacking libarchive-zip-perl (1.64-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../21-libfile-stripnondeterminism-perl_1.1.2-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.1.2-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../22-dh-strip-nondeterminism_1.1.2-1_all.deb ... Unpacking dh-strip-nondeterminism (1.1.2-1) ... Selecting previously unselected package libelf1:amd64. Preparing to unpack .../23-libelf1_0.176-1.1_amd64.deb ... Unpacking libelf1:amd64 (0.176-1.1) ... Selecting previously unselected package dwz. Preparing to unpack .../24-dwz_0.12-3_amd64.deb ... Unpacking dwz (0.12-3) ... Selecting previously unselected package libglib2.0-0:amd64. Preparing to unpack .../25-libglib2.0-0_2.58.3-2+deb10u2_amd64.deb ... Unpacking libglib2.0-0:amd64 (2.58.3-2+deb10u2) ... Selecting previously unselected package libicu63:amd64. Preparing to unpack .../26-libicu63_63.1-6+deb10u1_amd64.deb ... Unpacking libicu63:amd64 (63.1-6+deb10u1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../27-libxml2_2.9.4+dfsg1-7+deb10u1_amd64.deb ... Unpacking libxml2:amd64 (2.9.4+dfsg1-7+deb10u1) ... Selecting previously unselected package libcroco3:amd64. Preparing to unpack .../28-libcroco3_0.6.12-3_amd64.deb ... Unpacking libcroco3:amd64 (0.6.12-3) ... Selecting previously unselected package libncurses6:amd64. Preparing to unpack .../29-libncurses6_6.1+20181013-2+deb10u2_amd64.deb ... Unpacking libncurses6:amd64 (6.1+20181013-2+deb10u2) ... Selecting previously unselected package gettext. Preparing to unpack .../30-gettext_0.19.8.1-9_amd64.deb ... Unpacking gettext (0.19.8.1-9) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../31-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../32-po-debconf_1.0.21_all.deb ... Unpacking po-debconf (1.0.21) ... Selecting previously unselected package debhelper. Preparing to unpack .../33-debhelper_12.1.1_all.deb ... Unpacking debhelper (12.1.1) ... Selecting previously unselected package libgfortran5:amd64. Preparing to unpack .../34-libgfortran5_8.3.0-6_amd64.deb ... Unpacking libgfortran5:amd64 (8.3.0-6) ... Selecting previously unselected package libgfortran-8-dev:amd64. Preparing to unpack .../35-libgfortran-8-dev_8.3.0-6_amd64.deb ... Unpacking libgfortran-8-dev:amd64 (8.3.0-6) ... Selecting previously unselected package gfortran-8. Preparing to unpack .../36-gfortran-8_8.3.0-6_amd64.deb ... Unpacking gfortran-8 (8.3.0-6) ... Selecting previously unselected package gfortran. Preparing to unpack .../37-gfortran_4%3a8.3.0-1_amd64.deb ... Unpacking gfortran (4:8.3.0-1) ... Setting up libpipeline1:amd64 (1.5.1-2) ... Setting up libmagic-mgc (1:5.35-4+deb10u1) ... Setting up libarchive-zip-perl (1.64-1) ... Setting up libglib2.0-0:amd64 (2.58.3-2+deb10u2) ... No schema files found: doing nothing. Setting up libmagic1:amd64 (1:5.35-4+deb10u1) ... Setting up gettext-base (0.19.8.1-9) ... Setting up autoconf-archive (20180313-1) ... Setting up file (1:5.35-4+deb10u1) ... Setting up libicu63:amd64 (63.1-6+deb10u1) ... Setting up autotools-dev (20180224.1) ... Setting up libncurses6:amd64 (6.1+20181013-2+deb10u2) ... Setting up libsigsegv2:amd64 (2.12-2) ... Setting up autopoint (0.19.8.1-9) ... Setting up libgfortran5:amd64 (8.3.0-6) ... Setting up sensible-utils (0.0.12) ... Setting up libuchardet0:amd64 (0.0.6-3) ... Setting up libbsd0:amd64 (0.9.1-2) ... Setting up libelf1:amd64 (0.176-1.1) ... Setting up libxml2:amd64 (2.9.4+dfsg1-7+deb10u1) ... Setting up libfile-stripnondeterminism-perl (1.1.2-1) ... Setting up libgfortran-8-dev:amd64 (8.3.0-6) ... Setting up libtool (2.4.6-9) ... Setting up gfortran-8 (8.3.0-6) ... Setting up m4 (1.4.18-2) ... Setting up gfortran (4:8.3.0-1) ... update-alternatives: using /usr/bin/gfortran to provide /usr/bin/f95 (f95) in auto mode update-alternatives: using /usr/bin/gfortran to provide /usr/bin/f77 (f77) in auto mode Setting up bsdmainutils (11.1.2+b1) ... update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode Setting up libcroco3:amd64 (0.6.12-3) ... Setting up autoconf (2.69-11) ... Setting up dwz (0.12-3) ... Setting up groff-base (1.22.4-3) ... Setting up automake (1:1.16.1-4) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up gettext (0.19.8.1-9) ... Setting up man-db (2.8.5-2) ... Not building database; man-db/auto-update is not 'true'. Setting up intltool-debian (0.35.0+20060710.5) ... Setting up po-debconf (1.0.21) ... Setting up debhelper (12.1.1) ... Setting up dh-autoreconf (19) ... Setting up dh-strip-nondeterminism (1.1.2-1) ... Processing triggers for libc-bin (2.28-10) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... fakeroot is already the newest version (1.23-1). 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: Running cd /build/pftools-3+dfsg/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b dpkg-buildpackage: info: source package pftools dpkg-buildpackage: info: source version 3+dfsg-3 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 fakeroot debian/rules clean dh clean dh_clean debian/rules build dh build dh_update_autotools_config dh_autoreconf configure.ac:23: installing './compile' configure.ac:7: installing './config.guess' configure.ac:7: installing './config.sub' configure.ac:11: installing './install-sh' configure.ac:11: installing './missing' Makefile.am: installing './INSTALL' src/C/Makefile.am:4: warning: source file 'utils/io.c' is in a subdirectory, src/C/Makefile.am:4: but option 'subdir-objects' is disabled automake: warning: possible forward-incompatibility. automake: At least a source file is in a subdirectory, but the 'subdir-objects' automake: automake option hasn't been enabled. For now, the corresponding output automake: object file(s) will be placed in the top-level directory. However, automake: this behaviour will change in future Automake versions: they will automake: unconditionally cause object files to be placed in the same subdirectory automake: of the corresponding sources. automake: You are advised to start using 'subdir-objects' option throughout your automake: project, to avoid future incompatibilities. src/C/Makefile.am:7: warning: source file 'prg/pfsearch.c' is in a subdirectory, src/C/Makefile.am:7: but option 'subdir-objects' is disabled src/C/Makefile.am: installing './depcomp' dh_auto_configure ./configure --build=x86_64-linux-gnu --prefix=/usr --includedir=\${prefix}/include --mandir=\${prefix}/share/man --infodir=\${prefix}/share/info --sysconfdir=/etc --localstatedir=/var --disable-silent-rules --libdir=\${prefix}/lib/x86_64-linux-gnu --libexecdir=\${prefix}/lib/x86_64-linux-gnu --runstatedir=/run --disable-maintainer-mode --disable-dependency-tracking configure: WARNING: unrecognized options: --disable-maintainer-mode configure: Configuring PfTools for your system. checking build system type... x86_64-pc-linux-gnu checking host system type... x86_64-pc-linux-gnu checking target system type... x86_64-pc-linux-gnu checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for a thread-safe mkdir -p... /bin/mkdir -p checking for gawk... no checking for mawk... mawk checking whether make sets $(MAKE)... yes checking whether make supports nested variables... yes checking for g77... no checking for xlf... no checking for f77... f77 checking whether the Fortran 77 compiler works... yes checking for Fortran 77 compiler default output file name... a.out checking for suffix of executables... checking whether we are cross compiling... no checking for suffix of object files... o checking whether we are using the GNU Fortran 77 compiler... yes checking whether f77 accepts -g... yes checking for gcc... gcc checking whether we are using the GNU C compiler... yes checking whether gcc accepts -g... yes checking for gcc option to accept ISO C89... none needed checking whether gcc understands -c and -o together... yes checking whether make supports the include directive... yes (GNU style) checking dependency style of gcc... none checking for C compiler vendor... gnu checking for expf in -lm... yes checking for size_t... yes checking for working alloca.h... yes checking for alloca... yes checking fcntl.h usability... yes checking fcntl.h presence... no configure: WARNING: fcntl.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: fcntl.h: proceeding with the compiler's result checking for fcntl.h... yes checking limits.h usability... yes checking limits.h presence... no configure: WARNING: limits.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: limits.h: proceeding with the compiler's result checking for limits.h... yes checking stdlib.h usability... yes checking stdlib.h presence... no configure: WARNING: stdlib.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: stdlib.h: proceeding with the compiler's result checking for stdlib.h... yes checking string.h usability... yes checking string.h presence... no configure: WARNING: string.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: string.h: proceeding with the compiler's result checking for string.h... yes checking sys/time.h usability... yes checking sys/time.h presence... no configure: WARNING: sys/time.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: sys/time.h: proceeding with the compiler's result checking for sys/time.h... yes checking unistd.h usability... yes checking unistd.h presence... no configure: WARNING: unistd.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: unistd.h: proceeding with the compiler's result checking for unistd.h... yes checking inttypes.h usability... yes checking inttypes.h presence... no configure: WARNING: inttypes.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: inttypes.h: proceeding with the compiler's result checking for inttypes.h... yes checking mm_malloc.h usability... yes checking mm_malloc.h presence... no configure: WARNING: mm_malloc.h: accepted by the compiler, rejected by the preprocessor! configure: WARNING: mm_malloc.h: proceeding with the compiler's result checking for mm_malloc.h... yes checking for stdbool.h that conforms to C99... yes checking for _Bool... yes checking for gcc option to accept ISO C99... none needed checking for inline... inline checking for working volatile... yes checking for an ANSI C-conforming const... yes checking for C/C++ restrict keyword... __restrict checking for off_t... yes checking for size_t... (cached) yes checking for uid_t in sys/types.h... no checking whether C compiler accepts -msse2... yes checking whether C compiler accepts -msse4.1... yes checking for a sed that does not truncate output... /bin/sed checking whether gcc is Clang... no checking whether pthreads work with -pthread... yes checking for joinable pthread attribute... PTHREAD_CREATE_JOINABLE checking whether more special flags are required for pthreads... no checking for PTHREAD_PRIO_INHERIT... yes configure: Posix thread found. checking for f77 option to accept preprocessor commands... unknown configure: You may encounter preprocessor statement warnings. checking for stdlib.h... (cached) yes checking for GNU libc compatible malloc... no checking for stdlib.h... (cached) yes checking for unistd.h... (cached) yes checking for sys/param.h... no checking for getpagesize... yes checking for working mmap... no checking for sched_setaffinity... yes checking for sched_getaffinity... yes checking for bindprocessor... no checking for thread_policy_set... no checking whether cpu_set_t available... yes checking whether the CPU_SET and CPU_ZERO macros are defined... yes checking pthread_attr_setaffinity_np... yes checking for gettimeofday... yes checking for memset... yes checking for munmap... yes checking for strtol... yes checking for memcpy... yes checking for fseek... yes checking for ftell... yes checking that generated files are newer than configure... done configure: creating ./config.status config.status: creating Makefile config.status: creating src/Fortran/Makefile config.status: creating src/C/Makefile config.status: creating src/C/include/config.h config.status: executing depfiles commands configure: WARNING: unrecognized options: --disable-maintainer-mode dh_auto_build make -j16 make[1]: Entering directory '/build/pftools-3+dfsg' Making all in src/Fortran make[2]: Entering directory '/build/pftools-3+dfsg/src/Fortran' f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o gtop.o gtop.f gcc -c io.c -o io.o f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o htop.o htop.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o ptoh.o ptoh.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o ptof.o ptof.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o pfw.o pfw.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o 2ft.o 2ft.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o 6ft.o 6ft.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o psa2msa.o psa2msa.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o pfscan.o pfscan.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o pfmake.o pfmake.f f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o pfscale.o pfscale.f pfw.f:530:72: IF(J.GT.97.OR.J.LT.1) PAUSE 1 Warning: Deleted feature: PAUSE statement at (1) f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -c -o pfsearch.o pfsearch.f rhmmer2.f:265:17: Do I2=0,47 2 IIPP(I2,I1)=IIPD(I2) 1 Warning: Array reference at (1) out of bounds (47 > 46) in loop beginning at (2) rhmmer2.f:265:29: Do I2=0,47 2 IIPP(I2,I1)=IIPD(I2) 1 Warning: Array reference at (1) out of bounds (47 > 46) in loop beginning at (2) rhmmer2.f:274:17: Do I2=0,47 2 IMPP(I2,I1)=IMPD(I2) 1 Warning: Array reference at (1) out of bounds (47 > 27) in loop beginning at (2) rhmmer2.f:274:29: Do I2=0,47 2 IMPP(I2,I1)=IMPD(I2) 1 Warning: Array reference at (1) out of bounds (47 > 27) in loop beginning at (2) f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o 2ft 2ft.o -lm f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o 6ft 6ft.o -lm f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o psa2msa psa2msa.o io.o -lm pmali.f:66:0: RCOUT(14:)=RCPR(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] pmali.f:70:0: RCOUT(14:)=RCSQ(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] pmali.f:66:0: RCOUT(14:)=RCPR(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] pmali.f:70:0: RCOUT(14:)=RCSQ(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] prali.f:74:0: RCOUT(14:)=RCPR(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] prali.f:78:0: RCOUT(14:)=RCSQ(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o pfw pfw.o io.o -lm prali.f:74:0: RCOUT(14:)=RCPR(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] prali.f:78:0: RCOUT(14:)=RCSQ(1:NW) Warning: '__builtin_memcpy' reading 521 bytes from a region of size 512 [-Wstringop-overflow=] reprf.f:104:0: CPDE=RCIN( 6:LR) Warning: '__builtin_memcpy' reading 512 bytes from a region of size 507 [-Wstringop-overflow=] reprf.f:104:0: CPDE=RCIN( 6:LR) Warning: '__builtin_memcpy' reading 512 bytes from a region of size 507 [-Wstringop-overflow=] reprf.f:104:0: CPDE=RCIN( 6:LR) Warning: '__builtin_memcpy' reading 512 bytes from a region of size 507 [-Wstringop-overflow=] f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o ptoh ptoh.o -lm f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o gtop gtop.o io.o -lm f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o pfscale pfscale.o -lm reprf.f:104:0: CPDE=RCIN( 6:LR) Warning: '__builtin_memcpy' reading 512 bytes from a region of size 507 [-Wstringop-overflow=] reprf.f:104:0: CPDE=RCIN( 6:LR) Warning: '__builtin_memcpy' reading 512 bytes from a region of size 507 [-Wstringop-overflow=] f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o ptof ptof.o -lm f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o htop htop.o -lm reprf.f:104:0: CPDE=RCIN( 6:LR) Warning: '__builtin_memcpy' reading 512 bytes from a region of size 507 [-Wstringop-overflow=] f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o pfscan pfscan.o -lm f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o pfmake pfmake.o -lm f77 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wl,-z,relro -Wl,-z,now -o pfsearch pfsearch.o -lm make[2]: Leaving directory '/build/pftools-3+dfsg/src/Fortran' Making all in src/C make[2]: Entering directory '/build/pftools-3+dfsg/src/C' gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -D_TEST -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o pfdump-io.o `test -f 'utils/io.c' || echo './'`utils/io.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -D__USE_MMAP__ -D__USE_AFFINITY__ -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -pthread -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c -o pfsearchV3-pfsearch.o `test -f 'prg/pfsearch.c' || echo './'`prg/pfsearch.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c utils/Normalization.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c utils/ReadSequence.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c utils/output.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c utils/io.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c sse2/heuristic_sse2.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c sse2/xali1_sse2.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c sse2/xalip_sse2.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -c sse2/xalit_sse2.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -msse4.1 -c sse41/heuristic_sse41.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -msse4.1 -c sse41/xali1_sse41.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -msse4.1 -c sse41/xalip_sse41.c gcc -DHAVE_CONFIG_H -I. -I../../src/C/include -Wdate-time -D_FORTIFY_SOURCE=2 -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -msse4.1 -c sse41/xalit_sse41.c utils/output.c: In function 'PrintPfscan': utils/output.c:186:19: warning: initialization discards 'const' qualifier from pointer target type [-Wdiscarded-qualifiers] char * des = prf->Description; ^~~ prg/pfsearch.c: In function 'main': prg/pfsearch.c:485:10: warning: macro "__DATE__" might prevent reproducible builds [-Wdate-time] fputs(HEADER ^~~~~~ prg/pfsearch.c:31:23: warning: macro "__TIME__" might prevent reproducible builds [-Wdate-time] "| Built on " __DATE__ " at " __TIME__ ". |\n" ^~~~~~~~ prg/pfsearch.c:485:10: note: in expansion of macro 'HEADER' fputs(HEADER ^~~~~~ prg/pfsearch.c:730:6: warning: ignoring return value of 'fscanf', declared with attribute warn_unused_result [-Wunused-result] fscanf(in, "%s\n", buffer); ^~~~~~~~~~~~~~~~~~~~~~~~~~ gcc -O3 -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -Wl,-z,relro -Wl,-z,now -o pfdump pfdump-io.o -lm gcc -O3 -pthread -g -O2 -ffile-prefix-map=/build/pftools-3+dfsg=. -fstack-protector-strong -Wformat -Werror=format-security -Wl,-z,relro -Wl,-z,now -o pfsearchV3 pfsearchV3-pfsearch.o Normalization.o ReadSequence.o output.o io.o heuristic_sse2.o xali1_sse2.o xalip_sse2.o xalit_sse2.o heuristic_sse41.o xali1_sse41.o xalip_sse41.o xalit_sse41.o -lm -lm make[2]: Leaving directory '/build/pftools-3+dfsg/src/C' make[2]: Entering directory '/build/pftools-3+dfsg' make[2]: Nothing to be done for 'all-am'. make[2]: Leaving directory '/build/pftools-3+dfsg' make[1]: Leaving directory '/build/pftools-3+dfsg' debian/rules override_dh_auto_test make[1]: Entering directory '/build/pftools-3+dfsg' dh_auto_test make -j16 check VERBOSE=1 make[2]: Entering directory '/build/pftools-3+dfsg' Making check in src/Fortran make[3]: Entering directory '/build/pftools-3+dfsg/src/Fortran' make[3]: Nothing to be done for 'check'. make[3]: Leaving directory '/build/pftools-3+dfsg/src/Fortran' Making check in src/C make[3]: Entering directory '/build/pftools-3+dfsg/src/C' make[3]: Nothing to be done for 'check'. make[3]: Leaving directory '/build/pftools-3+dfsg/src/C' make[3]: Entering directory '/build/pftools-3+dfsg' make[3]: Nothing to be done for 'check-am'. make[3]: Leaving directory '/build/pftools-3+dfsg' make[2]: Leaving directory '/build/pftools-3+dfsg' export PATH=/build/pftools-3+dfsg/src/Fortran/:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games ; \ echo ${PATH} ; \ cd data ; \ . ./test.sh | \ sed -e '/^MA/s/\(N_SCORE=[68].5\)0*/\1/' \ -e '/^DT */d' > test.build ; \ grep -v '^DT *' test.out > test.compare ; \ diff -u test.compare test.build || true /build/pftools-3+dfsg/src/Fortran/:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games PAUSE To resume execution, type go. Other input will terminate the job. Error: Unexpected end of MSF file. Unable to find '..' keyword. No sequences read. # HMM converted from generalized profile with pftools program htop. # Logarithic base of profile: 1.15000000. # Offset: profile score = 0.2180E+03 + Log(Prob). rm: cannot remove 'sh3.fsp': No such file or directory --- test.compare 2022-01-15 21:27:10.138725242 -1200 +++ test.build 2022-01-15 21:27:10.134725242 -1200 @@ -2,32 +2,19 @@ # pftools test 1: pfsearch -f sh3.prf sh3.seq C=6.0 #----------------------------------------------------------------------# 8.455 459 pos. 1 - 39 sp|P03949|ABL1_CAEEL TYROSINE-PROTEIN KINASE ABL-1 (EC 2.7.1.112) (FRAGMENT). - 14.973 857 pos. 61 - 121 sp|P00519|ABL1_HUMAN PROTO-ONCOGENE TYROSINE-PROTEIN KINASE ABL (EC 2.7.1.112) (P150) (C-ABL). 12.958 734 pos. 43 - 107 sp|P39969|BEB1_YEAST BEB1 PROTEIN. - 13.499 767 pos. 58 - 128 sp|P04821|CC25_YEAST CELL DIVISION CONTROL PROTEIN 25. 10.043 556 pos. 100 - 161 sp|Q02640|CICX_HUMAN DIHYDROPRYRIDINE-SENSITIVE L-TYPE, BRAIN CALCIUM CHANNEL BETA-1-B1 SUBUNIT. - 11.812 664 pos. 279 - 341 sp|P20936|GTPA_HUMAN GTPASE-ACTIVATING PROTEIN (GAP) (RAS P21 PROTEIN ACTIVATOR). 10.289 571 pos. 114 - 175 sp|Q08289|MSAB_HUMAN LAMBERT-EATON MYASTHENIC SYNDROME ANTIGEN B (MYSB). - 18.100 1048 pos. 1053 - 1111 sp|P34092|MYSB_DICDI MYOSIN IB HEAVY CHAIN. - 15.316 878 pos. 156 - 215 sp|P14598|NCF1_HUMAN NEUTROPHIL CYTOSOL FACTOR 1 (NCF-1) (NCF-47K) (47 KD AUTOSOMAL CHRONIC GRANU - 12.238 690 pos. 226 - 285 sp|P14598|NCF1_HUMAN NEUTROPHIL CYTOSOL FACTOR 1 (NCF-1) (NCF-47K) (47 KD AUTOSOMAL CHRONIC GRANU - 16.315 939 pos. 2 - 61 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. - 15.284 876 pos. 115 - 165 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. - 17.036 983 pos. 190 - 252 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. - 13.384 760 pos. 3 - 79 sp|P23727|P85A_BOVIN PHOSPHATIDYLINOSITOL 3-KINASE REGULATORY ALPHA SUBUNIT (PI3-KINASE P85-ALPHA - 15.464 887 pos. 769 - 829 sp|P16885|PIP5_HUMAN 1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE GAMMA 2 (EC 3.1.4. + 15.316 878 pos. 156 - 215 sp|P14598|NCF1_HUMAN NEUTROPHIL CYTOSOL FACTOR 1 (NCF-1) (NCF-47K) (47 KD AUTOSOMAL CHRONIC GRANULOMATOUS DISEASE PROTEIN). + 12.238 690 pos. 226 - 285 sp|P14598|NCF1_HUMAN NEUTROPHIL CYTOSOL FACTOR 1 (NCF-1) (NCF-47K) (47 KD AUTOSOMAL CHRONIC GRANULOMATOUS DISEASE PROTEIN). + 13.384 760 pos. 3 - 79 sp|P23727|P85A_BOVIN PHOSPHATIDYLINOSITOL 3-KINASE REGULATORY ALPHA SUBUNIT (PI3-KINASE P85-ALPHA SUBUNIT) (PTDINS-3-KINASE P85-ALPHA) (PI3K). 15.382 882 pos. 24 - 86 sp|P40996|SCD2_SCHPO SCD2 PROTEIN. 11.992 675 pos. 123 - 185 sp|P40996|SCD2_SCHPO SCD2 PROTEIN. - 16.889 974 pos. 1 - 58 sp|P29355|SEM5_CAEEL SEX MUSCLE ABNORMAL PROTEIN 5. - 18.837 1093 pos. 154 - 213 sp|P29355|SEM5_CAEEL SEX MUSCLE ABNORMAL PROTEIN 5. 20.295 1182 pos. 80 - 141 sp|P00523|SRC_CHICK PROTO-ONCOGENE TYROSINE-PROTEIN KINASE SRC (EC 2.7.1.112) (P60-SRC). - 10.764 600 pos. 1 - 60 sp|P26674|STE6_SCHPO STE6 PROTEIN. 11.796 663 pos. 617 - 660 sp|P15498|VAV_HUMAN VAV ONCOGENE. 17.560 1015 pos. 783 - 843 sp|P15498|VAV_HUMAN VAV ONCOGENE. - 18.542 1075 pos. 314 - 373 sp|P43603|YFJ4_YEAST HYPOTHETICAL 40.4 KD PROTEIN IN PES4-HIS2 INTERGENIC REGION. 13.089 742 pos. 493 - 555 sp|P38822|YHR4_YEAST HYPOTHETICAL 71.2 KD PROTEIN IN CDC12-ORC6 INTERGENIC REGION. 13.695 779 pos. 577 - 633 sp|P38822|YHR4_YEAST HYPOTHETICAL 71.2 KD PROTEIN IN CDC12-ORC6 INTERGENIC REGION. - 9.323 512 pos. 504 - 572 sp|Q07157|ZO1_HUMAN TIGHT JUNCTION PROTEIN ZO-1. #----------------------------------------------------------------------# # pftools test 2: pfsearch -bx ecp.prf CVPBR322 | psa2msa -du #----------------------------------------------------------------------# @@ -67,39 +54,39 @@ AAGAAACCATTATTATCATGACATT----AACCTATAAAAATAGG >CVPBR322_18 47.906 244 pos. 4299 - 4342 J01749|CVPBR322 Cloning vector pBR322, complete genome. ATTATTATCATGACATTAACCTATA-AAAATAGGCGTATCACGAG ->CVPBR322_19 50.279 248 pos. 4348 - 4308 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_19 50.279 248 pos. 4348 - 4308 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. AAGGGCCTCGTGATACGCCTATTTT----TATAGGTTAATGTCAT ->CVPBR322_20 47.906 244 pos. 4336 - 4296 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_20 47.906 244 pos. 4336 - 4296 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. ATACGCCTATTTTTATAGGTTAATG----TCATGATAATAATGGT ->CVPBR322_21 50.279 248 pos. 4323 - 4283 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_21 50.279 248 pos. 4323 - 4283 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. TATAGGTTAATGTCATGATAATAAT----GGTTTCTTAGACGTCA ->CVPBR322_22 52.651 252 pos. 4232 - 4192 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_22 52.651 252 pos. 4232 - 4192 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. CTAAATACATTCAAATATGTATCCG----CTCATGAGACAATAAC ->CVPBR322_23 50.872 249 pos. 4178 - 4135 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_23 50.872 249 pos. 4178 - 4135 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. TCAATAATATTGAAAAAGGAAGAGT-ATGAGTATTCAACATTTCC ->CVPBR322_24 46.127 241 pos. 3954 - 3913 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_24 46.127 241 pos. 3954 - 3913 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. TGAGCACTTTTAAAGTTCTGCTATG---TGGCGCGGTATTATCCC ->CVPBR322_25 46.720 242 pos. 3861 - 3821 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_25 46.720 242 pos. 3861 - 3821 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. ATGACTTGGTTGAGTACTCACCAGT----CACAGAAAAGCATCTT ->CVPBR322_26 45.534 240 pos. 3569 - 3529 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_26 45.534 240 pos. 3569 - 3529 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. ACTACTTACTCTAGCTTCCCGGCAA----CAATTAATAGACTGGA ->CVPBR322_27 47.313 243 pos. 3464 - 3420 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_27 47.313 243 pos. 3464 - 3420 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. TGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGC ->CVPBR322_28 54.431 255 pos. 3301 - 3261 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_28 54.431 255 pos. 3301 - 3261 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. CATTGGTAACTGTCAGACCAAGTTT----ACTCATATATACTTTA ->CVPBR322_29 51.465 250 pos. 3273 - 3232 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_29 51.465 250 pos. 3273 - 3232 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. CATATATACTTTAGATTGATTTAAA---ACTTCATTTTTAATTTA ->CVPBR322_30 45.534 240 pos. 3267 - 3225 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_30 45.534 240 pos. 3267 - 3225 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. TACTTTAGATTGATTTAAAACTTCA--TTTTTAATTTAAAAGGAT ->CVPBR322_31 46.127 241 pos. 3250 - 3210 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_31 46.127 241 pos. 3250 - 3210 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. AAACTTCATTTTTAATTTAAAAGGA----TCTAGGTGAAGATCCT ->CVPBR322_32 53.244 253 pos. 3216 - 3173 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_32 53.244 253 pos. 3216 - 3173 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. AGATCCTTTTTGATAATCTCATGAC-CAAAATCCCTTAACGTGAG ->CVPBR322_33 60.362 265 pos. 3131 - 3091 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_33 60.362 265 pos. 3131 - 3091 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. AGGATCTTCTTGAGATCCTTTTTTT----CTGCGCGTAATCTGCT ->CVPBR322_34 47.313 243 pos. 2318 - 2274 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_34 47.313 243 pos. 2318 - 2274 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. GTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTG ->CVPBR322_35 58.582 262 pos. 85 - 41 J01749|CVPBR322 Cloning vector pBR322, complete genome. +>CVPBR322_35 58.582 262 pos. 85 - 41 J01749|CVPBR322(-) Cloning vector pBR322, complete genome. ACACGGTGCCTGACTGCGTTAGCAATTTAACTGTGATAAACTACC #----------------------------------------------------------------------# # pftools test 3: pfscan -s GTPA_HUMAN prosite13.prf @@ -152,12 +139,12 @@ # P 1 *********TTGACA*********************TATAAT*** -1 # S 4273 AAGTGCCACCTGACGTCTAAGAAAC-----CATTATTATCATGAC -50 # - 60.362 265 pos. 3131 - 3091 NS00001|ECOLI_PROM_RP70 E. coli RNA POL sigma-70 promoter. + 60.362 265 pos. 3131 - 3091 NS00001|ECOLI_PROM_RP70(-) E. coli RNA POL sigma-70 promoter. # # P 1 *********TTGACA*********************TATAAT*** -1 # S 3131 AGGATCTTCTTGAGATCCTTTTTTT----CTGCGCGTAATCTGCT -1271 # - 58.582 262 pos. 85 - 41 NS00001|ECOLI_PROM_RP70 E. coli RNA POL sigma-70 promoter. + 58.582 262 pos. 85 - 41 NS00001|ECOLI_PROM_RP70(-) E. coli RNA POL sigma-70 promoter. # # P 1 *********TTGACA*********************TATAAT*** -1 # S 85 ACACGGTGCCTGACTGCGTTAGCAATTTAACTGTGATAAACTACC -4321 @@ -167,138 +154,35 @@ # | sort -nr #----------------------------------------------------------------------# 944 sp|P00523|SRC_CHICK PROTO-ONCOGENE TYROSINE-PROTEIN KINASE SRC (EC 2.7.1.112) (P60-SRC). - 874 sp|P43603|YFJ4_YEAST HYPOTHETICAL 40.4 KD PROTEIN IN PES4-HIS2 INTERGENIC REGION. - 839 sp|P29355|SEM5_CAEEL SEX MUSCLE ABNORMAL PROTEIN 5. - 825 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. 819 sp|P15498|VAV_HUMAN VAV ONCOGENE. - 805 sp|P16885|PIP5_HUMAN 1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE GAMMA 2 (EC 3.1.4.11) (PLC-GAMMA-2) (PHOSPHOL - 764 sp|P23727|P85A_BOVIN PHOSPHATIDYLINOSITOL 3-KINASE REGULATORY ALPHA SUBUNIT (PI3-KINASE P85-ALPHA SUBUNIT) (PTDINS-3-KINASE - 750 sp|P34092|MYSB_DICDI MYOSIN IB HEAVY CHAIN. + 764 sp|P23727|P85A_BOVIN PHOSPHATIDYLINOSITOL 3-KINASE REGULATORY ALPHA SUBUNIT (PI3-KINASE P85-ALPHA SUBUNIT) (PTDINS-3-KINASE P85-ALPHA) (PI3K). 744 sp|P14598|NCF1_HUMAN NEUTROPHIL CYTOSOL FACTOR 1 (NCF-1) (NCF-47K) (47 KD AUTOSOMAL CHRONIC GRANULOMATOUS DISEASE PROTEIN). - 699 sp|P00519|ABL1_HUMAN PROTO-ONCOGENE TYROSINE-PROTEIN KINASE ABL (EC 2.7.1.112) (P150) (C-ABL). 633 sp|P40996|SCD2_SCHPO SCD2 PROTEIN. 619 sp|P38822|YHR4_YEAST HYPOTHETICAL 71.2 KD PROTEIN IN CDC12-ORC6 INTERGENIC REGION. - 555 sp|P04821|CC25_YEAST CELL DIVISION CONTROL PROTEIN 25. 544 sp|P39969|BEB1_YEAST BEB1 PROTEIN. - 466 sp|Q07157|ZO1_HUMAN TIGHT JUNCTION PROTEIN ZO-1. - 329 sp|P26674|STE6_SCHPO STE6 PROTEIN. 303 sp|P03949|ABL1_CAEEL TYROSINE-PROTEIN KINASE ABL-1 (EC 2.7.1.112) (FRAGMENT). 298 sp|Q02640|CICX_HUMAN DIHYDROPRYRIDINE-SENSITIVE L-TYPE, BRAIN CALCIUM CHANNEL BETA-1-B1 SUBUNIT. 293 sp|Q08289|MSAB_HUMAN LAMBERT-EATON MYASTHENIC SYNDROME ANTIGEN B (MYSB). - 279 sp|P20936|GTPA_HUMAN GTPASE-ACTIVATING PROTEIN (GAP) (RAS P21 PROTEIN ACTIVATOR). #----------------------------------------------------------------------# # pftools test 6: htop pfam_sh3.hmm | pfsearch -f - sh3.seq | sort -nr #----------------------------------------------------------------------# - 19.485 100384 pos. 317 - 373 sp|P43603|YFJ4_YEAST HYPOTHETICAL 40.4 KD PROTEIN IN PES4-HIS2 INTERGENIC REGION. - 19.303 98748 pos. 157 - 211 sp|P29355|SEM5_CAEEL SEX MUSCLE ABNORMAL PROTEIN 5. - 19.183 97669 pos. 83 - 139 sp|P00523|SRC_CHICK PROTO-ONCOGENE TYROSINE-PROTEIN KINASE SRC (EC 2.7.1.112) (P60-SRC). - 18.790 94141 pos. 1056 - 1111 sp|P34092|MYSB_DICDI MYOSIN IB HEAVY CHAIN. - 18.265 89412 pos. 786 - 841 sp|P15498|VAV_HUMAN VAV ONCOGENE. - 17.931 86411 pos. 1 - 56 sp|P29355|SEM5_CAEEL SEX MUSCLE ABNORMAL PROTEIN 5. - 17.706 84386 pos. 193 - 250 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. - 17.657 83950 pos. 772 - 827 sp|P16885|PIP5_HUMAN 1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE GAMMA 2 (EC 3.1.4. - 17.544 82931 pos. 5 - 59 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. - 16.584 74299 pos. 27 - 84 sp|P40996|SCD2_SCHPO SCD2 PROTEIN. - 16.486 73418 pos. 159 - 213 sp|P14598|NCF1_HUMAN NEUTROPHIL CYTOSOL FACTOR 1 (NCF-1) (NCF-47K) (47 KD AUTOSOMAL CHRONIC GRANU - 16.430 72911 pos. 64 - 119 sp|P00519|ABL1_HUMAN PROTO-ONCOGENE TYROSINE-PROTEIN KINASE ABL (EC 2.7.1.112) (P150) (C-ABL). - 15.759 66878 pos. 46 - 105 sp|P39969|BEB1_YEAST BEB1 PROTEIN. - 15.511 64650 pos. 229 - 283 sp|P14598|NCF1_HUMAN NEUTROPHIL CYTOSOL FACTOR 1 (NCF-1) (NCF-47K) (47 KD AUTOSOMAL CHRONIC GRANU - 15.503 64573 pos. 109 - 163 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. - 14.963 59722 pos. 496 - 553 sp|P38822|YHR4_YEAST HYPOTHETICAL 71.2 KD PROTEIN IN CDC12-ORC6 INTERGENIC REGION. - 14.515 55695 pos. 126 - 183 sp|P40996|SCD2_SCHPO SCD2 PROTEIN. - 13.945 50565 pos. 3 - 58 sp|P26674|STE6_SCHPO STE6 PROTEIN. - 13.506 46616 pos. 580 - 633 sp|P38822|YHR4_YEAST HYPOTHETICAL 71.2 KD PROTEIN IN CDC12-ORC6 INTERGENIC REGION. - 13.399 45653 pos. 282 - 339 sp|P20936|GTPA_HUMAN GTPASE-ACTIVATING PROTEIN (GAP) (RAS P21 PROTEIN ACTIVATOR). - 11.564 29159 pos. 6 - 77 sp|P23727|P85A_BOVIN PHOSPHATIDYLINOSITOL 3-KINASE REGULATORY ALPHA SUBUNIT (PI3-KINASE P85-ALPHA - 11.218 26047 pos. 61 - 126 sp|P04821|CC25_YEAST CELL DIVISION CONTROL PROTEIN 25. - 10.425 18915 pos. 601 - 658 sp|P15498|VAV_HUMAN VAV ONCOGENE. + 19.485 100384 pos. 317 - 373 sp|P43603|YFJ4_YEAST HYPOTHETICAL 40.4 KD PROTEIN IN PES4-HIS2 INTERGENIC REGION. + 19.303 98748 pos. 157 - 211 sp|P29355|SEM5_CAEEL SEX MUSCLE ABNORMAL PROTEIN 5. + 18.790 94141 pos. 1056 - 1111 sp|P34092|MYSB_DICDI MYOSIN IB HEAVY CHAIN. + 17.931 86411 pos. 1 - 56 sp|P29355|SEM5_CAEEL SEX MUSCLE ABNORMAL PROTEIN 5. + 17.706 84386 pos. 193 - 250 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. + 17.657 83950 pos. 772 - 827 sp|P16885|PIP5_HUMAN 1-PHOSPHATIDYLINOSITOL-4,5-BISPHOSPHATE PHOSPHODIESTERASE GAMMA 2 (EC 3.1.4.11) (PLC-GAMMA-2) (PHOSPHOLIPASE C-GAMMA-2) (PLC-IV). + 17.544 82931 pos. 5 - 59 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. + 16.430 72911 pos. 64 - 119 sp|P00519|ABL1_HUMAN PROTO-ONCOGENE TYROSINE-PROTEIN KINASE ABL (EC 2.7.1.112) (P150) (C-ABL). + 15.503 64573 pos. 109 - 163 sp|P16333|NCK_HUMAN CYTOPLASMIC PROTEIN NCK. + 13.945 50565 pos. 3 - 58 sp|P26674|STE6_SCHPO STE6 PROTEIN. + 13.399 45653 pos. 282 - 339 sp|P20936|GTPA_HUMAN GTPASE-ACTIVATING PROTEIN (GAP) (RAS P21 PROTEIN ACTIVATOR). + 11.218 26047 pos. 61 - 126 sp|P04821|CC25_YEAST CELL DIVISION CONTROL PROTEIN 25. #----------------------------------------------------------------------# # pftools test 7: pfw sh3.msf N=1000 | # pfmake -b - blosum45.cmp H=0.6 #----------------------------------------------------------------------# -ID SEQUENCE_RPOFILE; MATRIX. -AC ZZ99999; -DE Generated from MSF file: 'stdin'. -MA /GENERAL_SPEC: ALPHABET='ABCDEFGHIKLMNPQRSTVWYZ'; LENGTH=62; -MA /DISJOINT: DEFINITION=PROTECT; N1=6; N2=57; -MA /NORMALIZATION: MODE=1; FUNCTION=LINEAR; R1=0.0000000; R2=0.0100000; TEXT='No_units'; -MA /CUT_OFF: LEVEL=0; SCORE=850; N_SCORE=8.5000; MODE=1; TEXT='!'; -MA /CUT_OFF: LEVEL=-1; SCORE=650; N_SCORE=6.5000; MODE=1; TEXT='?'; -MA /DEFAULT: M0=-8; D=-20; I=-20; B1=-60; E1=-60; MI=-105; MD=-105; IM=-105; DM=-105; -MA /I: B1=0; BI=-105; BD=-105; -MA /M: SY='P'; M=-1,-9,-25,-10,-4,-19,-4,-12,-14,-7,-16,-8,-6,3,-4,-9,0,-4,-13,-24,-14,-6; -MA /M: SY='D'; M=-7,2,-26,7,5,-23,-14,-9,-14,-6,-17,-11,-3,4,-2,-12,-2,-6,-12,-29,-15,0; -MA /M: M=-4,-11,-24,-11,-6,-12,-11,-13,-12,-6,-10,-8,-8,-7,-6,-1,-3,-4,-8,-23,-12,-7; -MA /M: M=-12,-13,-26,-15,-8,0,-11,-6,-14,-5,-10,-5,-8,-9,-8,0,-10,-9,-13,-16,-2,-9; -MA /M: SY='T'; M=-3,-13,-20,-17,-9,-4,-22,-14,-3,-5,-4,0,-11,-13,-6,-5,-4,5,1,-19,-2,-8; -MA /M: SY='V'; M=0,-20,-18,-24,-23,5,-19,-16,11,-17,2,4,-16,-24,-20,-18,-8,-3,16,-14,6,-22; -MA /M: SY='R'; M=-10,-14,-24,-15,-7,-15,-25,-13,-4,9,-9,-1,-10,-19,-1,19,-9,-5,4,-24,-9,-6; -MA /M: SY='A'; M=38,-11,-10,-20,-12,-16,-6,-21,-6,-11,-8,-8,-11,-12,-12,-19,9,7,5,-22,-18,-12; -MA /M: SY='L'; M=-8,-16,-24,-20,-12,-5,-26,-10,12,-16,17,9,-11,-22,-8,-12,-17,-9,3,-23,-4,-12; -MA /M: SY='Y'; M=-13,-18,-24,-22,-19,27,-26,4,-1,-13,1,-1,-15,-27,-16,-12,-14,-8,-3,6,40,-19; -MA /M: SY='D'; M=-6,26,-27,37,14,-33,-6,-6,-31,-3,-27,-24,11,-1,-1,-11,4,-7,-25,-35,-21,6; -MA /M: SY='Y'; M=-20,-23,-27,-26,-23,45,-30,8,0,-16,3,0,-20,-30,-19,-13,-20,-10,-7,24,65,-23; -MA /M: SY='E'; M=-1,1,-15,-2,5,-15,-16,-10,-13,-2,-14,-9,2,-14,-1,-6,4,4,-7,-29,-14,2; -MA /I: I=-4; MI=0; MD=-23; IM=0; DM=-23; -MA /M: SY='A'; M=21,-6,-18,-9,-3,-24,-6,-15,-16,1,-18,-12,-6,-4,-3,-8,6,-2,-8,-24,-18,-4; -MA /M: SY='E'; M=-3,-2,-23,0,13,-25,-11,-7,-22,7,-22,-13,0,-5,10,8,7,0,-17,-28,-17,11; -MA /M: SY='D'; M=-8,6,-25,8,7,-25,-6,0,-26,4,-24,-14,8,-9,5,7,6,-2,-21,-30,-16,5; -MA /M: SY='E'; M=-4,5,-26,11,14,-28,-4,-10,-27,-4,-25,-20,1,9,-1,-9,6,-2,-23,-31,-22,5; -MA /M: SY='D'; M=-12,25,-26,34,13,-30,-7,-2,-30,-2,-25,-21,12,-11,4,-8,5,-2,-25,-32,-14,8; -MA /M: SY='E'; M=-11,11,-28,20,40,-25,-14,-4,-28,3,-17,-19,1,-5,10,-5,-1,-8,-26,-29,-17,25; -MA /M: SY='L'; M=-8,-30,-20,-32,-23,6,-31,-23,26,-28,38,20,-28,-28,-21,-21,-25,-8,20,-22,-2,-23; -MA /M: SY='S'; M=2,4,-19,6,5,-24,-7,-9,-23,-3,-27,-19,7,1,0,-5,19,8,-16,-35,-20,1; -MA /M: SY='F'; M=-10,-29,-20,-35,-26,34,-30,-22,16,-27,20,11,-23,-27,-28,-21,-20,-8,13,-9,10,-26; -MA /I: I=-4; MI=0; MD=-21; IM=0; DM=-21; -MA /M: SY='K'; M=-6,2,-18,0,6,-21,-17,-5,-19,9,-16,-10,4,-14,3,4,-1,-2,-16,-28,-12,4; -MA /M: SY='K'; M=-3,-7,-28,-5,7,-26,-18,-11,-22,17,-21,-11,-7,10,4,11,-6,-7,-19,-23,-16,4; -MA /M: SY='G'; M=-1,-7,-30,-8,-17,-30,60,-18,-38,-13,-30,-19,2,-19,-17,-15,0,-18,-29,-21,-28,-17; -MA /M: SY='D'; M=-13,34,-28,48,29,-35,-12,-1,-34,2,-26,-25,14,-7,5,-7,1,-7,-28,-36,-20,17; -MA /M: SY='V'; M=-4,-18,-20,-24,-17,1,-25,-20,7,-7,1,5,-15,-20,-15,-6,-9,0,11,-19,-3,-16; -MA /M: SY='I'; M=-10,-30,-22,-35,-27,14,-34,-25,31,-28,25,17,-24,-26,-24,-24,-21,-8,23,-17,3,-27; -MA /M: SY='H'; M=-12,-6,-27,-7,1,-13,-23,6,-11,-1,-12,-5,-3,-15,1,1,-5,-3,-12,-16,1,-1; -MA /M: SY='V'; M=-2,-26,-17,-30,-26,0,-30,-26,29,-23,17,12,-23,-26,-24,-22,-14,-4,33,-26,-7,-26; -MA /M: SY='I'; M=-8,-22,-22,-26,-21,-3,-30,-17,22,-17,15,13,-17,-23,-16,-16,-15,-5,19,-24,-3,-20; -MA /M: SY='E'; M=-4,13,-24,12,14,-26,-5,0,-26,6,-24,-17,14,-11,5,1,4,-5,-24,-30,-17,9; -MA /M: SY='K'; M=-8,1,-27,2,5,-24,-12,-8,-26,24,-23,-12,1,-13,3,18,-5,-6,-17,-22,-10,3; -MA /I: I=-3; MI=0; MD=-13; IM=0; DM=-13; -MA /M: SY='N'; M=-6,2,-16,1,1,-10,-13,-2,-15,-6,-11,-10,3,-16,-5,-8,1,0,-14,-24,-5,-2; D=-3; -MA /I: I=-3; DM=-13; -MA /M: SY='E'; M=-8,13,-25,15,16,-25,-6,-3,-24,-1,-20,-16,12,-8,5,-5,3,-5,-24,-32,-18,10; -MA /M: SY='D'; M=-7,9,-27,11,1,-28,3,-2,-26,-3,-27,-17,10,-3,1,-7,4,-7,-24,-31,-19,0; -MA /M: SY='G'; M=-3,7,-27,9,0,-29,29,-7,-34,-10,-28,-20,9,-15,-7,-13,5,-11,-27,-28,-23,-3; -MA /M: SY='W'; M=-20,-40,-50,-40,-30,10,-20,-30,-20,-20,-20,-20,-40,-30,-20,-20,-40,-30,-30,150,30,-20; -MA /M: SY='W'; M=-15,-30,-25,-32,-25,7,-23,-20,-10,-19,-5,-7,-30,-28,-18,-18,-27,-14,-16,71,21,-19; -MA /M: SY='E'; M=-9,-5,-26,-5,3,-10,-21,-11,-11,3,-11,-8,-6,-16,-3,2,-9,-7,-9,-13,-4,0; -MA /M: SY='G'; M=6,-16,-13,-20,-22,-20,24,-23,-13,-21,-14,-9,-10,-21,-20,-22,-3,-12,-5,-24,-22,-22; -MA /M: SY='R'; M=-14,-3,-21,-3,6,-20,-20,0,-21,11,-16,-9,1,-16,10,24,-5,-6,-18,-24,-8,6; -MA /M: SY='N'; M=-9,-2,-12,-10,-12,-8,-19,-8,-2,-10,-4,-2,5,-18,-10,-10,-7,-3,-6,-27,-6,-12; -MA /M: M=-8,0,-24,0,-5,-16,-12,-13,-7,-7,-9,-7,0,-13,-9,-11,-4,-4,-6,-27,-11,-8; -MA /I: I=-4; MD=-22; -MA /M: SY='K'; M=-2,-1,-12,-2,-1,-12,-4,-6,-12,6,-11,-5,0,-7,0,6,2,3,-7,-14,-7,-1; D=-4; -MA /I: I=-4; MI=0; MD=-22; IM=0; DM=-22; -MA /M: SY='T'; M=1,-1,-11,-4,-2,-10,-3,-10,-10,-4,-7,-7,1,-8,-5,-5,6,12,-6,-17,-9,-3; D=-4; -MA /I: I=-4; DM=-22; -MA /M: SY='G'; M=-4,3,-13,0,-10,-25,22,-13,-27,-12,-24,-17,9,-21,-13,-12,0,-11,-20,-29,-24,-12; -MA /M: SY='E'; M=-9,1,-27,2,18,-24,-12,-5,-19,7,-16,-9,1,-11,10,5,-3,-7,-19,-26,-15,13; -MA /M: SY='R'; M=-10,-10,-25,-11,1,-18,-23,-10,-9,6,-12,-5,-7,-10,5,14,-4,1,-5,-24,-11,1; -MA /M: SY='G'; M=0,-10,-30,-10,-18,-30,66,-19,-39,-19,-30,-19,0,-20,-17,-19,0,-20,-30,-20,-29,-18; -MA /M: SY='W'; M=-16,-29,-31,-31,-25,23,-27,-19,3,-24,10,0,-27,-28,-22,-20,-28,-16,-5,40,23,-22; -MA /M: SY='F'; M=-11,-29,-21,-37,-29,32,-33,-24,23,-27,12,8,-22,-26,-29,-23,-17,-8,20,-8,12,-29; -MA /M: SY='P'; M=-10,-20,-39,-11,-1,-29,-20,-20,-18,-10,-28,-19,-20,84,-11,-20,-10,-10,-26,-30,-29,-11; -MA /M: SY='S'; M=6,-4,-7,-7,-4,-18,-8,-14,-14,-9,-17,-12,1,-15,-4,-10,16,11,-6,-33,-17,-4; -MA /M: SY='N'; M=-5,21,-18,10,-1,-19,-6,-1,-17,-1,-24,-15,31,-16,-2,-3,14,7,-18,-37,-17,-1; -MA /M: SY='Y'; M=-19,-17,-21,-21,-19,28,-27,11,-4,-13,0,-1,-14,-29,-14,-8,-17,-10,-10,11,49,-19; -MA /M: SY='V'; M=-6,-26,-14,-30,-26,1,-27,-26,22,-21,11,9,-23,-26,-24,-17,-13,-4,27,-25,-6,-26; -MA /M: SY='E'; M=-5,2,-21,4,22,-27,-18,-4,-25,10,-19,-13,-1,-9,16,9,1,-2,-21,-26,-15,18; -MA /M: SY='P'; M=-10,-9,-30,-4,8,-17,-22,-10,-12,-1,-11,-7,-11,12,-2,-6,-9,-8,-15,-23,-10,1; -MA /M: SY='I'; M=-7,-12,-22,-14,-10,-8,-22,-11,4,-9,-2,2,-9,-19,-5,-8,-3,-1,4,-22,-1,-9; -MA /M: SY='N'; M=-7,5,-24,6,-2,-22,6,-8,-22,-5,-19,-14,7,-17,-4,-5,2,-5,-17,-27,-15,-4; -MA /M: SY='S'; M=0,-1,-13,-3,-4,-19,-13,-4,-15,-4,-15,-10,2,-16,-2,-2,7,2,-9,-30,-13,-4; -MA /I: E1=0; IE=-105; DE=-105; -CC /GENERATED_BY="pfmake -b - blosum45.cmp H=0.6"; -// #----------------------------------------------------------------------# # pftools test 8: ptoh ecp.prf L=1.15 #----------------------------------------------------------------------# @@ -1323,7 +1207,7 @@ # 2ft < R76849.seq | pfsearch -fy sh3.fsp - C=5.0 # rm sh3.fsp #----------------------------------------------------------------------# - 10.764 600 pos. 186 - 347 x|gi|851481|gb|R76849|R76849_M yi63d09.r1 Homo sapiens cDNA clone 143921 5' similar to gb:M23379 + 10.764 600 pos. 186 - 347 x|gi|851481|gb|R76849|R76849_M yi63d09.r1 Homo sapiens cDNA clone 143921 5' similar to gb:M23379 GTPASE-ACTIVATING PROTEIN (HUMAN);. # # P 28 Y>----

-../pftools_3+dfsg-3_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/54490 and its subdirectories I: Current time: Sat Jan 15 21:27:19 -12 2022 I: pbuilder-time-stamp: 1642325239