I: pbuilder: network access will be disabled during build I: Current time: Thu Jun 11 05:05:19 +14 2020 I: pbuilder-time-stamp: 1591801519 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/buster-reproducible-base.tgz] I: copying local configuration I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [dawg_1.2-2.dsc] I: copying [./dawg_1.2.orig.tar.gz] I: copying [./dawg_1.2-2.debian.tar.xz] I: Extracting source gpgv: unknown type of key resource 'trustedkeys.kbx' gpgv: keyblock resource '/root/.gnupg/trustedkeys.kbx': General error gpgv: Signature made Mon Jul 16 21:15:57 2018 +14 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: failed to verify signature on ./dawg_1.2-2.dsc dpkg-source: info: extracting dawg in dawg-1.2 dpkg-source: info: unpacking dawg_1.2.orig.tar.gz dpkg-source: info: unpacking dawg_1.2-2.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying 0001-Add-missing-include-of-cstring.patch dpkg-source: info: applying 0003-Don-t-override-install-directories.patch dpkg-source: info: applying 0004-Fix-typo-in-help-text.patch dpkg-source: info: applying 0005-Remove-Encoding-add-Keywords-to-dawg.desktop.patch dpkg-source: info: applying 0006-relative-path-in-test-script.patch I: using fakeroot in build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/22782/tmp/hooks/D01_modify_environment starting debug: Running on jtx1c. I: Changing host+domainname to test build reproducibility I: Adding a custom variable just for the fun of it... I: Changing /bin/sh to bash Removing 'diversion of /bin/sh to /bin/sh.distrib by dash' Adding 'diversion of /bin/sh to /bin/sh.distrib by bash' Removing 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by dash' Adding 'diversion of /usr/share/man/man1/sh.1.gz to /usr/share/man/man1/sh.distrib.1.gz by bash' I: Setting pbuilder2's login shell to /bin/bash I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other I: user script /srv/workspace/pbuilder/22782/tmp/hooks/D01_modify_environment finished I: user script /srv/workspace/pbuilder/22782/tmp/hooks/D02_print_environment starting I: set BASH=/bin/sh BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:hostcomplete:interactive_comments:progcomp:promptvars:sourcepath BASH_ALIASES=() BASH_ARGC=() BASH_ARGV=() BASH_CMDS=() BASH_LINENO=([0]="12" [1]="0") BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") BASH_VERSINFO=([0]="5" [1]="0" [2]="3" [3]="1" [4]="release" [5]="arm-unknown-linux-gnueabihf") BASH_VERSION='5.0.3(1)-release' BUILDDIR=/build BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' BUILDUSERNAME=pbuilder2 BUILD_ARCH=armhf DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=4' DIRSTACK=() DISTRIBUTION= EUID=0 FUNCNAME=([0]="Echo" [1]="main") GROUPS=() HOME=/root HOSTNAME=i-capture-the-hostname HOSTTYPE=arm HOST_ARCH=armhf IFS=' ' INVOCATION_ID=58fb9c56e5cd47a6820b4c66679e8fb3 LANG=C LANGUAGE=it_CH:it LC_ALL=C MACHTYPE=arm-unknown-linux-gnueabihf MAIL=/var/mail/root OPTERR=1 OPTIND=1 OSTYPE=linux-gnueabihf PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path PBCURRENTCOMMANDLINEOPERATION=build PBUILDER_OPERATION=build PBUILDER_PKGDATADIR=/usr/share/pbuilder PBUILDER_PKGLIBDIR=/usr/lib/pbuilder PBUILDER_SYSCONFDIR=/etc PIPESTATUS=([0]="0") POSIXLY_CORRECT=y PPID=22782 PS4='+ ' PWD=/ SHELL=/bin/bash SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix SHLVL=3 SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/tmp.bPfGwIMsno/pbuilderrc_q8w4 --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/buster-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/tmp.bPfGwIMsno/b2 --logfile b2/build.log dawg_1.2-2.dsc' SUDO_GID=111 SUDO_UID=107 SUDO_USER=jenkins TERM=unknown TZ=/usr/share/zoneinfo/Etc/GMT-14 UID=0 USER=root _='I: set' http_proxy=http://10.0.0.15:8000/ I: uname -a Linux i-capture-the-hostname 4.19.0-9-arm64 #1 SMP Debian 4.19.118-2 (2020-04-29) aarch64 GNU/Linux I: ls -l /bin total 3328 -rwxr-xr-x 1 root root 767656 Apr 18 2019 bash -rwxr-xr-x 3 root root 26052 Jul 11 2019 bunzip2 -rwxr-xr-x 3 root root 26052 Jul 11 2019 bzcat lrwxrwxrwx 1 root root 6 Jul 11 2019 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2227 Jul 11 2019 bzdiff lrwxrwxrwx 1 root root 6 Jul 11 2019 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4877 Jun 25 2019 bzexe lrwxrwxrwx 1 root root 6 Jul 11 2019 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3641 Jul 11 2019 bzgrep -rwxr-xr-x 3 root root 26052 Jul 11 2019 bzip2 -rwxr-xr-x 1 root root 9636 Jul 11 2019 bzip2recover lrwxrwxrwx 1 root root 6 Jul 11 2019 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Jul 11 2019 bzmore -rwxr-xr-x 1 root root 22432 Mar 1 2019 cat -rwxr-xr-x 1 root root 38868 Mar 1 2019 chgrp -rwxr-xr-x 1 root root 38836 Mar 1 2019 chmod -rwxr-xr-x 1 root root 42972 Mar 1 2019 chown -rwxr-xr-x 1 root root 88376 Mar 1 2019 cp -rwxr-xr-x 1 root root 75516 Jan 18 2019 dash -rwxr-xr-x 1 root root 71648 Mar 1 2019 date -rwxr-xr-x 1 root root 51212 Mar 1 2019 dd -rwxr-xr-x 1 root root 55672 Mar 1 2019 df -rwxr-xr-x 1 root root 88444 Mar 1 2019 dir -rwxr-xr-x 1 root root 54872 Jan 10 2019 dmesg lrwxrwxrwx 1 root root 8 Sep 27 2018 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Sep 27 2018 domainname -> hostname -rwxr-xr-x 1 root root 22364 Mar 1 2019 echo -rwxr-xr-x 1 root root 28 Jan 8 2019 egrep -rwxr-xr-x 1 root root 18260 Mar 1 2019 false -rwxr-xr-x 1 root root 28 Jan 8 2019 fgrep -rwxr-xr-x 1 root root 47356 Jan 10 2019 findmnt -rwsr-xr-x 1 root root 21980 Apr 23 09:38 fusermount -rwxr-xr-x 1 root root 124508 Jan 8 2019 grep -rwxr-xr-x 2 root root 2345 Jan 6 2019 gunzip -rwxr-xr-x 1 root root 6375 Jan 6 2019 gzexe -rwxr-xr-x 1 root root 64232 Jan 6 2019 gzip -rwxr-xr-x 1 root root 13784 Sep 27 2018 hostname -rwxr-xr-x 1 root root 43044 Mar 1 2019 ln -rwxr-xr-x 1 root root 34932 Jul 27 2018 login -rwxr-xr-x 1 root root 88444 Mar 1 2019 ls -rwxr-xr-x 1 root root 67036 Jan 10 2019 lsblk -rwxr-xr-x 1 root root 47168 Mar 1 2019 mkdir -rwxr-xr-x 1 root root 43040 Mar 1 2019 mknod -rwxr-xr-x 1 root root 26552 Mar 1 2019 mktemp -rwxr-xr-x 1 root root 26024 Jan 10 2019 more -rwsr-xr-x 1 root root 34268 Jan 10 2019 mount -rwxr-xr-x 1 root root 9688 Jan 10 2019 mountpoint -rwxr-xr-x 1 root root 84284 Mar 1 2019 mv lrwxrwxrwx 1 root root 8 Sep 27 2018 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Feb 15 2019 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 22416 Mar 1 2019 pwd lrwxrwxrwx 1 root root 4 Apr 18 2019 rbash -> bash -rwxr-xr-x 1 root root 26504 Mar 1 2019 readlink -rwxr-xr-x 1 root root 42968 Mar 1 2019 rm -rwxr-xr-x 1 root root 26496 Mar 1 2019 rmdir -rwxr-xr-x 1 root root 14136 Jan 22 2019 run-parts -rwxr-xr-x 1 root root 76012 Dec 23 2018 sed lrwxrwxrwx 1 root root 4 Jun 11 05:05 sh -> bash lrwxrwxrwx 1 root root 4 Jun 10 22:25 sh.distrib -> dash -rwxr-xr-x 1 root root 22384 Mar 1 2019 sleep -rwxr-xr-x 1 root root 51124 Mar 1 2019 stty -rwsr-xr-x 1 root root 42472 Jan 10 2019 su -rwxr-xr-x 1 root root 22392 Mar 1 2019 sync -rwxr-xr-x 1 root root 283324 Apr 24 2019 tar -rwxr-xr-x 1 root root 9808 Jan 22 2019 tempfile -rwxr-xr-x 1 root root 63464 Mar 1 2019 touch -rwxr-xr-x 1 root root 18260 Mar 1 2019 true -rwxr-xr-x 1 root root 9636 Apr 23 09:38 ulockmgr_server -rwsr-xr-x 1 root root 21976 Jan 10 2019 umount -rwxr-xr-x 1 root root 22380 Mar 1 2019 uname -rwxr-xr-x 2 root root 2345 Jan 6 2019 uncompress -rwxr-xr-x 1 root root 88444 Mar 1 2019 vdir -rwxr-xr-x 1 root root 21980 Jan 10 2019 wdctl -rwxr-xr-x 1 root root 946 Jan 22 2019 which lrwxrwxrwx 1 root root 8 Sep 27 2018 ypdomainname -> hostname -rwxr-xr-x 1 root root 1983 Jan 6 2019 zcat -rwxr-xr-x 1 root root 1677 Jan 6 2019 zcmp -rwxr-xr-x 1 root root 5879 Jan 6 2019 zdiff -rwxr-xr-x 1 root root 29 Jan 6 2019 zegrep -rwxr-xr-x 1 root root 29 Jan 6 2019 zfgrep -rwxr-xr-x 1 root root 2080 Jan 6 2019 zforce -rwxr-xr-x 1 root root 7584 Jan 6 2019 zgrep -rwxr-xr-x 1 root root 2205 Jan 6 2019 zless -rwxr-xr-x 1 root root 1841 Jan 6 2019 zmore -rwxr-xr-x 1 root root 4552 Jan 6 2019 znew I: user script /srv/workspace/pbuilder/22782/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: armhf Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper (>= 11~), cmake, bison, flex dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 18932 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper (>= 11~); however: Package debhelper is not installed. pbuilder-satisfydepends-dummy depends on cmake; however: Package cmake is not installed. pbuilder-satisfydepends-dummy depends on bison; however: Package bison is not installed. pbuilder-satisfydepends-dummy depends on flex; however: Package flex is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bison{a} bsdmainutils{a} cmake{a} cmake-data{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} flex{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libarchive13{a} libbison-dev{a} libbsd0{a} libcroco3{a} libcurl4{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libglib2.0-0{a} libgssapi-krb5-2{a} libicu63{a} libjsoncpp1{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libldap-2.4-2{a} libldap-common{a} libmagic-mgc{a} libmagic1{a} libncurses6{a} libnghttp2-14{a} libpipeline1{a} libprocps7{a} libpsl5{a} librhash0{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libsigsegv2{a} libssh2-1{a} libssl1.1{a} libtool{a} libuchardet0{a} libuv1{a} libxml2{a} lsb-base{a} m4{a} man-db{a} po-debconf{a} procps{a} sensible-utils{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl krb5-locales libarchive-cpio-perl libfl-dev libglib2.0-data libgpm2 libltdl-dev libmail-sendmail-perl libsasl2-modules lynx psmisc publicsuffix shared-mime-info wget xdg-user-dirs 0 packages upgraded, 61 newly installed, 0 to remove and 0 not upgraded. Need to get 28.3 MB of archives. After unpacking 93.9 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian buster/main armhf libbsd0 armhf 0.9.1-2 [103 kB] Get: 2 http://deb.debian.org/debian buster/main armhf bsdmainutils armhf 11.1.2+b1 [186 kB] Get: 3 http://deb.debian.org/debian buster/main armhf libuchardet0 armhf 0.0.6-3 [62.2 kB] Get: 4 http://deb.debian.org/debian buster/main armhf groff-base armhf 1.22.4-3 [828 kB] Get: 5 http://deb.debian.org/debian buster/main armhf libpipeline1 armhf 1.5.1-2 [26.8 kB] Get: 6 http://deb.debian.org/debian buster/main armhf man-db armhf 2.8.5-2 [1240 kB] Get: 7 http://deb.debian.org/debian buster/main armhf libsigsegv2 armhf 2.12-2 [32.1 kB] Get: 8 http://deb.debian.org/debian buster/main armhf m4 armhf 1.4.18-2 [190 kB] Get: 9 http://deb.debian.org/debian buster/main armhf flex armhf 2.6.4-6.2 [438 kB] Get: 10 http://deb.debian.org/debian buster/main armhf libncurses6 armhf 6.1+20181013-2+deb10u2 [79.8 kB] Get: 11 http://deb.debian.org/debian buster/main armhf libprocps7 armhf 2:3.3.15-2 [58.7 kB] Get: 12 http://deb.debian.org/debian buster/main armhf lsb-base all 10.2019051400 [28.4 kB] Get: 13 http://deb.debian.org/debian buster/main armhf procps armhf 2:3.3.15-2 [248 kB] Get: 14 http://deb.debian.org/debian buster/main armhf sensible-utils all 0.0.12 [15.8 kB] Get: 15 http://deb.debian.org/debian buster/main armhf libmagic-mgc armhf 1:5.35-4+deb10u1 [242 kB] Get: 16 http://deb.debian.org/debian buster/main armhf libmagic1 armhf 1:5.35-4+deb10u1 [110 kB] Get: 17 http://deb.debian.org/debian buster/main armhf file armhf 1:5.35-4+deb10u1 [65.5 kB] Get: 18 http://deb.debian.org/debian buster/main armhf gettext-base armhf 0.19.8.1-9 [118 kB] Get: 19 http://deb.debian.org/debian buster/main armhf autoconf all 2.69-11 [341 kB] Get: 20 http://deb.debian.org/debian buster/main armhf autotools-dev all 20180224.1 [77.0 kB] Get: 21 http://deb.debian.org/debian buster/main armhf automake all 1:1.16.1-4 [771 kB] Get: 22 http://deb.debian.org/debian buster/main armhf autopoint all 0.19.8.1-9 [434 kB] Get: 23 http://deb.debian.org/debian buster/main armhf libbison-dev armhf 2:3.3.2.dfsg-1 [500 kB] Get: 24 http://deb.debian.org/debian buster/main armhf bison armhf 2:3.3.2.dfsg-1 [848 kB] Get: 25 http://deb.debian.org/debian buster/main armhf cmake-data all 3.13.4-1 [1476 kB] Get: 26 http://deb.debian.org/debian buster/main armhf libicu63 armhf 63.1-6+deb10u1 [8005 kB] Get: 27 http://deb.debian.org/debian buster/main armhf libxml2 armhf 2.9.4+dfsg1-7+b3 [595 kB] Get: 28 http://deb.debian.org/debian buster/main armhf libarchive13 armhf 3.3.3-4+deb10u1 [277 kB] Get: 29 http://deb.debian.org/debian buster/main armhf libkeyutils1 armhf 1.6-6 [13.9 kB] Get: 30 http://deb.debian.org/debian buster/main armhf libkrb5support0 armhf 1.17-3 [62.3 kB] Get: 31 http://deb.debian.org/debian buster/main armhf libk5crypto3 armhf 1.17-3 [119 kB] Get: 32 http://deb.debian.org/debian buster/main armhf libssl1.1 armhf 1.1.1d-0+deb10u3 [1299 kB] Get: 33 http://deb.debian.org/debian buster/main armhf libkrb5-3 armhf 1.17-3 [323 kB] Get: 34 http://deb.debian.org/debian buster/main armhf libgssapi-krb5-2 armhf 1.17-3 [137 kB] Get: 35 http://deb.debian.org/debian buster/main armhf libsasl2-modules-db armhf 2.1.27+dfsg-1+deb10u1 [67.4 kB] Get: 36 http://deb.debian.org/debian buster/main armhf libsasl2-2 armhf 2.1.27+dfsg-1+deb10u1 [98.9 kB] Get: 37 http://deb.debian.org/debian buster/main armhf libldap-common all 2.4.47+dfsg-3+deb10u2 [89.7 kB] Get: 38 http://deb.debian.org/debian buster/main armhf libldap-2.4-2 armhf 2.4.47+dfsg-3+deb10u2 [202 kB] Get: 39 http://deb.debian.org/debian buster/main armhf libnghttp2-14 armhf 1.36.0-2+deb10u1 [74.4 kB] Get: 40 http://deb.debian.org/debian buster/main armhf libpsl5 armhf 0.20.2-2 [52.4 kB] Get: 41 http://deb.debian.org/debian buster/main armhf librtmp1 armhf 2.4+20151223.gitfa8646d.1-2 [54.9 kB] Get: 42 http://deb.debian.org/debian buster/main armhf libssh2-1 armhf 1.8.0-2.1 [129 kB] Get: 43 http://deb.debian.org/debian buster/main armhf libcurl4 armhf 7.64.0-4+deb10u1 [297 kB] Get: 44 http://deb.debian.org/debian buster/main armhf libexpat1 armhf 2.2.6-2+deb10u1 [78.0 kB] Get: 45 http://deb.debian.org/debian buster/main armhf libjsoncpp1 armhf 1.7.4-3 [67.8 kB] Get: 46 http://deb.debian.org/debian buster/main armhf librhash0 armhf 1.3.8-1 [134 kB] Get: 47 http://deb.debian.org/debian buster/main armhf libuv1 armhf 1.24.1-1 [98.0 kB] Get: 48 http://deb.debian.org/debian buster/main armhf cmake armhf 3.13.4-1 [2848 kB] Get: 49 http://deb.debian.org/debian buster/main armhf libtool all 2.4.6-9 [547 kB] Get: 50 http://deb.debian.org/debian buster/main armhf dh-autoreconf all 19 [16.9 kB] Get: 51 http://deb.debian.org/debian buster/main armhf libarchive-zip-perl all 1.64-1 [96.8 kB] Get: 52 http://deb.debian.org/debian buster/main armhf libfile-stripnondeterminism-perl all 1.1.2-1 [19.8 kB] Get: 53 http://deb.debian.org/debian buster/main armhf dh-strip-nondeterminism all 1.1.2-1 [13.0 kB] Get: 54 http://deb.debian.org/debian buster/main armhf libelf1 armhf 0.176-1.1 [158 kB] Get: 55 http://deb.debian.org/debian buster/main armhf dwz armhf 0.12-3 [72.0 kB] Get: 56 http://deb.debian.org/debian buster/main armhf libglib2.0-0 armhf 2.58.3-2+deb10u2 [1101 kB] Get: 57 http://deb.debian.org/debian buster/main armhf libcroco3 armhf 0.6.12-3 [133 kB] Get: 58 http://deb.debian.org/debian buster/main armhf gettext armhf 0.19.8.1-9 [1242 kB] Get: 59 http://deb.debian.org/debian buster/main armhf intltool-debian all 0.35.0+20060710.5 [26.8 kB] Get: 60 http://deb.debian.org/debian buster/main armhf po-debconf all 1.0.21 [248 kB] Get: 61 http://deb.debian.org/debian buster/main armhf debhelper all 12.1.1 [1016 kB] Fetched 28.3 MB in 3s (9274 kB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package libbsd0:armhf. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 18932 files and directories currently installed.) Preparing to unpack .../00-libbsd0_0.9.1-2_armhf.deb ... Unpacking libbsd0:armhf (0.9.1-2) ... Selecting previously unselected package bsdmainutils. Preparing to unpack .../01-bsdmainutils_11.1.2+b1_armhf.deb ... Unpacking bsdmainutils (11.1.2+b1) ... Selecting previously unselected package libuchardet0:armhf. Preparing to unpack .../02-libuchardet0_0.0.6-3_armhf.deb ... Unpacking libuchardet0:armhf (0.0.6-3) ... Selecting previously unselected package groff-base. Preparing to unpack .../03-groff-base_1.22.4-3_armhf.deb ... Unpacking groff-base (1.22.4-3) ... Selecting previously unselected package libpipeline1:armhf. Preparing to unpack .../04-libpipeline1_1.5.1-2_armhf.deb ... Unpacking libpipeline1:armhf (1.5.1-2) ... Selecting previously unselected package man-db. Preparing to unpack .../05-man-db_2.8.5-2_armhf.deb ... Unpacking man-db (2.8.5-2) ... Selecting previously unselected package libsigsegv2:armhf. Preparing to unpack .../06-libsigsegv2_2.12-2_armhf.deb ... Unpacking libsigsegv2:armhf (2.12-2) ... Selecting previously unselected package m4. Preparing to unpack .../07-m4_1.4.18-2_armhf.deb ... Unpacking m4 (1.4.18-2) ... Selecting previously unselected package flex. Preparing to unpack .../08-flex_2.6.4-6.2_armhf.deb ... Unpacking flex (2.6.4-6.2) ... Selecting previously unselected package libncurses6:armhf. Preparing to unpack .../09-libncurses6_6.1+20181013-2+deb10u2_armhf.deb ... Unpacking libncurses6:armhf (6.1+20181013-2+deb10u2) ... Selecting previously unselected package libprocps7:armhf. Preparing to unpack .../10-libprocps7_2%3a3.3.15-2_armhf.deb ... Unpacking libprocps7:armhf (2:3.3.15-2) ... Selecting previously unselected package lsb-base. Preparing to unpack .../11-lsb-base_10.2019051400_all.deb ... Unpacking lsb-base (10.2019051400) ... Selecting previously unselected package procps. Preparing to unpack .../12-procps_2%3a3.3.15-2_armhf.deb ... Unpacking procps (2:3.3.15-2) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../13-sensible-utils_0.0.12_all.deb ... Unpacking sensible-utils (0.0.12) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../14-libmagic-mgc_1%3a5.35-4+deb10u1_armhf.deb ... Unpacking libmagic-mgc (1:5.35-4+deb10u1) ... Selecting previously unselected package libmagic1:armhf. Preparing to unpack .../15-libmagic1_1%3a5.35-4+deb10u1_armhf.deb ... Unpacking libmagic1:armhf (1:5.35-4+deb10u1) ... Selecting previously unselected package file. Preparing to unpack .../16-file_1%3a5.35-4+deb10u1_armhf.deb ... Unpacking file (1:5.35-4+deb10u1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../17-gettext-base_0.19.8.1-9_armhf.deb ... Unpacking gettext-base (0.19.8.1-9) ... Selecting previously unselected package autoconf. Preparing to unpack .../18-autoconf_2.69-11_all.deb ... Unpacking autoconf (2.69-11) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../19-autotools-dev_20180224.1_all.deb ... Unpacking autotools-dev (20180224.1) ... Selecting previously unselected package automake. Preparing to unpack .../20-automake_1%3a1.16.1-4_all.deb ... Unpacking automake (1:1.16.1-4) ... Selecting previously unselected package autopoint. Preparing to unpack .../21-autopoint_0.19.8.1-9_all.deb ... Unpacking autopoint (0.19.8.1-9) ... Selecting previously unselected package libbison-dev:armhf. Preparing to unpack .../22-libbison-dev_2%3a3.3.2.dfsg-1_armhf.deb ... Unpacking libbison-dev:armhf (2:3.3.2.dfsg-1) ... Selecting previously unselected package bison. Preparing to unpack .../23-bison_2%3a3.3.2.dfsg-1_armhf.deb ... Unpacking bison (2:3.3.2.dfsg-1) ... Selecting previously unselected package cmake-data. Preparing to unpack .../24-cmake-data_3.13.4-1_all.deb ... Unpacking cmake-data (3.13.4-1) ... Selecting previously unselected package libicu63:armhf. Preparing to unpack .../25-libicu63_63.1-6+deb10u1_armhf.deb ... Unpacking libicu63:armhf (63.1-6+deb10u1) ... Selecting previously unselected package libxml2:armhf. Preparing to unpack .../26-libxml2_2.9.4+dfsg1-7+b3_armhf.deb ... Unpacking libxml2:armhf (2.9.4+dfsg1-7+b3) ... Selecting previously unselected package libarchive13:armhf. Preparing to unpack .../27-libarchive13_3.3.3-4+deb10u1_armhf.deb ... Unpacking libarchive13:armhf (3.3.3-4+deb10u1) ... Selecting previously unselected package libkeyutils1:armhf. Preparing to unpack .../28-libkeyutils1_1.6-6_armhf.deb ... Unpacking libkeyutils1:armhf (1.6-6) ... Selecting previously unselected package libkrb5support0:armhf. Preparing to unpack .../29-libkrb5support0_1.17-3_armhf.deb ... Unpacking libkrb5support0:armhf (1.17-3) ... Selecting previously unselected package libk5crypto3:armhf. Preparing to unpack .../30-libk5crypto3_1.17-3_armhf.deb ... Unpacking libk5crypto3:armhf (1.17-3) ... Selecting previously unselected package libssl1.1:armhf. Preparing to unpack .../31-libssl1.1_1.1.1d-0+deb10u3_armhf.deb ... Unpacking libssl1.1:armhf (1.1.1d-0+deb10u3) ... Selecting previously unselected package libkrb5-3:armhf. Preparing to unpack .../32-libkrb5-3_1.17-3_armhf.deb ... Unpacking libkrb5-3:armhf (1.17-3) ... Selecting previously unselected package libgssapi-krb5-2:armhf. Preparing to unpack .../33-libgssapi-krb5-2_1.17-3_armhf.deb ... Unpacking libgssapi-krb5-2:armhf (1.17-3) ... Selecting previously unselected package libsasl2-modules-db:armhf. Preparing to unpack .../34-libsasl2-modules-db_2.1.27+dfsg-1+deb10u1_armhf.deb ... Unpacking libsasl2-modules-db:armhf (2.1.27+dfsg-1+deb10u1) ... Selecting previously unselected package libsasl2-2:armhf. Preparing to unpack .../35-libsasl2-2_2.1.27+dfsg-1+deb10u1_armhf.deb ... Unpacking libsasl2-2:armhf (2.1.27+dfsg-1+deb10u1) ... Selecting previously unselected package libldap-common. Preparing to unpack .../36-libldap-common_2.4.47+dfsg-3+deb10u2_all.deb ... Unpacking libldap-common (2.4.47+dfsg-3+deb10u2) ... Selecting previously unselected package libldap-2.4-2:armhf. Preparing to unpack .../37-libldap-2.4-2_2.4.47+dfsg-3+deb10u2_armhf.deb ... Unpacking libldap-2.4-2:armhf (2.4.47+dfsg-3+deb10u2) ... Selecting previously unselected package libnghttp2-14:armhf. Preparing to unpack .../38-libnghttp2-14_1.36.0-2+deb10u1_armhf.deb ... Unpacking libnghttp2-14:armhf (1.36.0-2+deb10u1) ... Selecting previously unselected package libpsl5:armhf. Preparing to unpack .../39-libpsl5_0.20.2-2_armhf.deb ... Unpacking libpsl5:armhf (0.20.2-2) ... Selecting previously unselected package librtmp1:armhf. Preparing to unpack .../40-librtmp1_2.4+20151223.gitfa8646d.1-2_armhf.deb ... Unpacking librtmp1:armhf (2.4+20151223.gitfa8646d.1-2) ... Selecting previously unselected package libssh2-1:armhf. Preparing to unpack .../41-libssh2-1_1.8.0-2.1_armhf.deb ... Unpacking libssh2-1:armhf (1.8.0-2.1) ... Selecting previously unselected package libcurl4:armhf. Preparing to unpack .../42-libcurl4_7.64.0-4+deb10u1_armhf.deb ... Unpacking libcurl4:armhf (7.64.0-4+deb10u1) ... Selecting previously unselected package libexpat1:armhf. Preparing to unpack .../43-libexpat1_2.2.6-2+deb10u1_armhf.deb ... Unpacking libexpat1:armhf (2.2.6-2+deb10u1) ... Selecting previously unselected package libjsoncpp1:armhf. Preparing to unpack .../44-libjsoncpp1_1.7.4-3_armhf.deb ... Unpacking libjsoncpp1:armhf (1.7.4-3) ... Selecting previously unselected package librhash0:armhf. Preparing to unpack .../45-librhash0_1.3.8-1_armhf.deb ... Unpacking librhash0:armhf (1.3.8-1) ... Selecting previously unselected package libuv1:armhf. Preparing to unpack .../46-libuv1_1.24.1-1_armhf.deb ... Unpacking libuv1:armhf (1.24.1-1) ... Selecting previously unselected package cmake. Preparing to unpack .../47-cmake_3.13.4-1_armhf.deb ... Unpacking cmake (3.13.4-1) ... Selecting previously unselected package libtool. Preparing to unpack .../48-libtool_2.4.6-9_all.deb ... Unpacking libtool (2.4.6-9) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../49-dh-autoreconf_19_all.deb ... Unpacking dh-autoreconf (19) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../50-libarchive-zip-perl_1.64-1_all.deb ... Unpacking libarchive-zip-perl (1.64-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../51-libfile-stripnondeterminism-perl_1.1.2-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.1.2-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../52-dh-strip-nondeterminism_1.1.2-1_all.deb ... Unpacking dh-strip-nondeterminism (1.1.2-1) ... Selecting previously unselected package libelf1:armhf. Preparing to unpack .../53-libelf1_0.176-1.1_armhf.deb ... Unpacking libelf1:armhf (0.176-1.1) ... Selecting previously unselected package dwz. Preparing to unpack .../54-dwz_0.12-3_armhf.deb ... Unpacking dwz (0.12-3) ... Selecting previously unselected package libglib2.0-0:armhf. Preparing to unpack .../55-libglib2.0-0_2.58.3-2+deb10u2_armhf.deb ... Unpacking libglib2.0-0:armhf (2.58.3-2+deb10u2) ... Selecting previously unselected package libcroco3:armhf. Preparing to unpack .../56-libcroco3_0.6.12-3_armhf.deb ... Unpacking libcroco3:armhf (0.6.12-3) ... Selecting previously unselected package gettext. Preparing to unpack .../57-gettext_0.19.8.1-9_armhf.deb ... Unpacking gettext (0.19.8.1-9) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../58-intltool-debian_0.35.0+20060710.5_all.deb ... Unpacking intltool-debian (0.35.0+20060710.5) ... Selecting previously unselected package po-debconf. Preparing to unpack .../59-po-debconf_1.0.21_all.deb ... Unpacking po-debconf (1.0.21) ... Selecting previously unselected package debhelper. Preparing to unpack .../60-debhelper_12.1.1_all.deb ... Unpacking debhelper (12.1.1) ... Setting up libexpat1:armhf (2.2.6-2+deb10u1) ... Setting up libpipeline1:armhf (1.5.1-2) ... Setting up lsb-base (10.2019051400) ... Setting up libkeyutils1:armhf (1.6-6) ... Setting up libpsl5:armhf (0.20.2-2) ... Setting up libbison-dev:armhf (2:3.3.2.dfsg-1) ... Setting up libmagic-mgc (1:5.35-4+deb10u1) ... Setting up libarchive-zip-perl (1.64-1) ... Setting up libglib2.0-0:armhf (2.58.3-2+deb10u2) ... No schema files found: doing nothing. Setting up libssl1.1:armhf (1.1.1d-0+deb10u3) ... Setting up libprocps7:armhf (2:3.3.15-2) ... Setting up libnghttp2-14:armhf (1.36.0-2+deb10u1) ... Setting up libmagic1:armhf (1:5.35-4+deb10u1) ... Setting up gettext-base (0.19.8.1-9) ... Setting up file (1:5.35-4+deb10u1) ... Setting up libldap-common (2.4.47+dfsg-3+deb10u2) ... Setting up libicu63:armhf (63.1-6+deb10u1) ... Setting up libkrb5support0:armhf (1.17-3) ... Setting up libsasl2-modules-db:armhf (2.1.27+dfsg-1+deb10u1) ... Setting up autotools-dev (20180224.1) ... Setting up libuv1:armhf (1.24.1-1) ... Setting up librtmp1:armhf (2.4+20151223.gitfa8646d.1-2) ... Setting up libncurses6:armhf (6.1+20181013-2+deb10u2) ... Setting up libsigsegv2:armhf (2.12-2) ... Setting up autopoint (0.19.8.1-9) ... Setting up libk5crypto3:armhf (1.17-3) ... Setting up libsasl2-2:armhf (2.1.27+dfsg-1+deb10u1) ... Setting up sensible-utils (0.0.12) ... Setting up librhash0:armhf (1.3.8-1) ... Setting up libuchardet0:armhf (0.0.6-3) ... Setting up procps (2:3.3.15-2) ... update-alternatives: using /usr/bin/w.procps to provide /usr/bin/w (w) in auto mode Setting up libssh2-1:armhf (1.8.0-2.1) ... Setting up cmake-data (3.13.4-1) ... Setting up libkrb5-3:armhf (1.17-3) ... Setting up libbsd0:armhf (0.9.1-2) ... Setting up libelf1:armhf (0.176-1.1) ... Setting up libxml2:armhf (2.9.4+dfsg1-7+b3) ... Setting up libjsoncpp1:armhf (1.7.4-3) ... Setting up libfile-stripnondeterminism-perl (1.1.2-1) ... Setting up libtool (2.4.6-9) ... Setting up libarchive13:armhf (3.3.3-4+deb10u1) ... Setting up libldap-2.4-2:armhf (2.4.47+dfsg-3+deb10u2) ... Setting up m4 (1.4.18-2) ... Setting up bsdmainutils (11.1.2+b1) ... update-alternatives: using /usr/bin/bsd-write to provide /usr/bin/write (write) in auto mode update-alternatives: using /usr/bin/bsd-from to provide /usr/bin/from (from) in auto mode Setting up libgssapi-krb5-2:armhf (1.17-3) ... Setting up libcroco3:armhf (0.6.12-3) ... Setting up autoconf (2.69-11) ... Setting up dwz (0.12-3) ... Setting up groff-base (1.22.4-3) ... Setting up bison (2:3.3.2.dfsg-1) ... update-alternatives: using /usr/bin/bison.yacc to provide /usr/bin/yacc (yacc) in auto mode Setting up libcurl4:armhf (7.64.0-4+deb10u1) ... Setting up automake (1:1.16.1-4) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up flex (2.6.4-6.2) ... Setting up gettext (0.19.8.1-9) ... Setting up man-db (2.8.5-2) ... Not building database; man-db/auto-update is not 'true'. Setting up intltool-debian (0.35.0+20060710.5) ... Setting up cmake (3.13.4-1) ... Setting up po-debconf (1.0.21) ... Setting up debhelper (12.1.1) ... Setting up dh-autoreconf (19) ... Setting up dh-strip-nondeterminism (1.1.2-1) ... Processing triggers for libc-bin (2.28-10) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... fakeroot is already the newest version (1.23-1). 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: Running cd /build/dawg-1.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b dpkg-buildpackage: info: source package dawg dpkg-buildpackage: info: source version 1.2-2 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture armhf fakeroot debian/rules clean dh clean dh_clean debian/rules build dh build dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/dawg-1.2' dh_auto_configure -- \ -DCMAKE_LIBRARY_PATH=arm-linux-gnueabihf \ -DCMAKE_DATA_DIR=/usr/share/doc/dawg cd obj-arm-linux-gnueabihf && cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/arm-linux-gnueabihf -DCMAKE_LIBRARY_PATH=arm-linux-gnueabihf -DCMAKE_DATA_DIR=/usr/share/doc/dawg .. -- The C compiler identification is GNU 8.3.0 -- The CXX compiler identification is GNU 8.3.0 -- Check for working C compiler: /usr/bin/cc -- Check for working C compiler: /usr/bin/cc -- works -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Detecting C compile features -- Detecting C compile features - done -- Check for working CXX compiler: /usr/bin/c++ -- Check for working CXX compiler: /usr/bin/c++ -- works -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Detecting CXX compile features -- Detecting CXX compile features - done -- Looking for bison -- Looking for bison -- /usr/bin/bison -- Looking for flex -- Looking for flex -- /usr/bin/flex -- Looking for unistd.h -- Looking for unistd.h - found -- Looking for process.h -- Looking for process.h - not found -- Looking for io.h -- Looking for io.h - not found -- Looking for getopt.h -- Looking for getopt.h - found -- Looking for stdint.h -- Looking for stdint.h - found -- Looking for sys/types.h -- Looking for sys/types.h - found -- Looking for getpid -- Looking for getpid - found -- Looking for _getpid -- Looking for _getpid - not found -- Looking for copysign -- Looking for copysign - found -- Looking for _copysign -- Looking for _copysign - not found -- Looking for snprintf -- Looking for snprintf - found -- Looking for _snprintf -- Looking for _snprintf - not found -- Configuring done -- Generating done CMake Warning: Manually-specified variables were not used by the project: CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR CMAKE_LIBRARY_PATH -- Build files have been written to: /build/dawg-1.2/obj-arm-linux-gnueabihf make[1]: Leaving directory '/build/dawg-1.2' dh_auto_build cd obj-arm-linux-gnueabihf && make -j4 "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-arm-linux-gnueabihf --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/depend make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [ 15%] Generating parser.tab.cpp, parser.tab.hpp [ 15%] Generating lex.parser.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/bison --name-prefix=parser --defines --output-file=/build/dawg-1.2/obj-arm-linux-gnueabihf/src/parser.tab.cpp /build/dawg-1.2/src/parser.ypp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/flex -Pparser -o/build/dawg-1.2/obj-arm-linux-gnueabihf/src/lex.parser.cpp /build/dawg-1.2/src/parser.lpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/dawg-1.2 /build/dawg-1.2/src /build/dawg-1.2/obj-arm-linux-gnueabihf /build/dawg-1.2/obj-arm-linux-gnueabihf/src /build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/dawg.dir/DependInfo.cmake --color= Scanning dependencies of target dawg make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/build make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [ 38%] Building CXX object src/CMakeFiles/dawg.dir/eigen.cpp.o [ 38%] Building CXX object src/CMakeFiles/dawg.dir/dawg.cpp.o [ 38%] Building CXX object src/CMakeFiles/dawg.dir/indel.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/dawg.cpp.o -c /build/dawg-1.2/src/dawg.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/eigen.cpp.o -c /build/dawg-1.2/src/eigen.cpp cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/indel.cpp.o -c /build/dawg-1.2/src/indel.cpp [ 46%] Building CXX object src/CMakeFiles/dawg.dir/matrix.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/matrix.cpp.o -c /build/dawg-1.2/src/matrix.cpp In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSib; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSub; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pInsertionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/dawg.cpp:20: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pDeletionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /usr/include/c++/8/vector:69, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/indel.cpp:3: /usr/include/c++/8/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_realloc_insert(std::vector<_Tp, _Alloc>::iterator, _Args&& ...) [with _Args = {const double&}; _Tp = double; _Alloc = std::allocator]': /usr/include/c++/8/bits/vector.tcc:413:7: note: parameter passing for argument of type 'std::vector::iterator' {aka '__gnu_cxx::__normal_iterator >'} changed in GCC 7.1 vector<_Tp, _Alloc>:: ^~~~~~~~~~~~~~~~~~~ [ 53%] Building CXX object src/CMakeFiles/dawg.dir/output.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/output.cpp.o -c /build/dawg-1.2/src/output.cpp In file included from /usr/include/c++/8/vector:64, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/indel.cpp:3: /usr/include/c++/8/bits/stl_vector.h: In constructor 'UserModel::UserModel(const std::vector&)': /usr/include/c++/8/bits/stl_vector.h:1085:4: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 _M_realloc_insert(end(), __x); ^~~~~~~~~~~~~~~~~ [ 61%] Building CXX object src/CMakeFiles/dawg.dir/rand.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/rand.cpp.o -c /build/dawg-1.2/src/rand.cpp [ 69%] Building CXX object src/CMakeFiles/dawg.dir/tree.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/tree.cpp.o -c /build/dawg-1.2/src/tree.cpp [ 76%] Building CXX object src/CMakeFiles/dawg.dir/var.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -o CMakeFiles/dawg.dir/var.cpp.o -c /build/dawg-1.2/src/var.cpp In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSib; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSub; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pInsertionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/output.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pDeletionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/output.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSib; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSub; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /usr/include/c++/8/vector:69, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/8/bits/vector.tcc: In member function 'void std::vector<_Tp, _Alloc>::_M_fill_insert(std::vector<_Tp, _Alloc>::iterator, std::vector<_Tp, _Alloc>::size_type, const value_type&) [with _Tp = double; _Alloc = std::allocator]': /usr/include/c++/8/bits/vector.tcc:478:5: note: parameter passing for argument of type 'std::vector::iterator' {aka '__gnu_cxx::__normal_iterator >'} changed in GCC 7.1 vector<_Tp, _Alloc>:: ^~~~~~~~~~~~~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pInsertionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/tree.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pDeletionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/tree.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSib; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSub; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pInsertionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/var.cpp:4: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pDeletionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/var.cpp:3: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /usr/include/c++/8/vector:64, from /build/dawg-1.2/src/dawg.h:42, from /build/dawg-1.2/src/dawg.cpp:19: /usr/include/c++/8/bits/stl_vector.h: In function 'bool Execute()': /usr/include/c++/8/bits/stl_vector.h:847:4: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 _M_fill_insert(end(), __new_size - size(), __x); ^~~~~~~~~~~~~~ /usr/include/c++/8/bits/stl_vector.h:847:4: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 _M_fill_insert(end(), __new_size - size(), __x); ^~~~~~~~~~~~~~ /usr/include/c++/8/bits/stl_vector.h:847:4: note: parameter passing for argument of type '__gnu_cxx::__normal_iterator >' changed in GCC 7.1 _M_fill_insert(end(), __new_size - size(), __x); ^~~~~~~~~~~~~~ [ 84%] Building CXX object src/CMakeFiles/dawg.dir/lex.parser.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/lex.parser.cpp.o -c /build/dawg-1.2/obj-arm-linux-gnueabihf/src/lex.parser.cpp [ 92%] Building CXX object src/CMakeFiles/dawg.dir/parser.tab.cpp.o cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/c++ -DHAVE_CONFIG_H -I/build/dawg-1.2/obj-arm-linux-gnueabihf/src -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 "-DPACKAGE_STRING=\"dawg 1.2-release\"" "-DPACKAGE_BUGREPORT=\"reed@scit.us\"" -I "/build/dawg-1.2/src" -o CMakeFiles/dawg.dir/parser.tab.cpp.o -c /build/dawg-1.2/obj-arm-linux-gnueabihf/src/parser.tab.cpp In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSib; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSub; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pInsertionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.lpp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pDeletionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.lpp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:17:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSib; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:18:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pSub; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:199:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pInsertionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ In file included from /build/dawg-1.2/src/var.h:7, from /build/dawg-1.2/src/parser.ypp:5: /build/dawg-1.2/src/tree.h:200:7: warning: 'template class std::auto_ptr' is deprecated [-Wdeprecated-declarations] std::auto_ptr m_pDeletionModel; ^~~~~~~~ In file included from /usr/include/c++/8/bits/locale_conv.h:41, from /usr/include/c++/8/locale:43, from /usr/include/c++/8/iomanip:43, from /build/dawg-1.2/src/dawg.h:47, from /build/dawg-1.2/src/parser.ypp:4: /usr/include/c++/8/bits/unique_ptr.h:53:28: note: declared here template class auto_ptr; ^~~~~~~~ [100%] Linking CXX executable dawg cd /build/dawg-1.2/obj-arm-linux-gnueabihf/src && /usr/bin/cmake -E cmake_link_script CMakeFiles/dawg.dir/link.txt --verbose=1 /usr/bin/c++ -g -O2 -ffile-prefix-map=/build/dawg-1.2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2 -Wl,-z,relro -Wl,-z,now -rdynamic CMakeFiles/dawg.dir/dawg.cpp.o CMakeFiles/dawg.dir/eigen.cpp.o CMakeFiles/dawg.dir/indel.cpp.o CMakeFiles/dawg.dir/matrix.cpp.o CMakeFiles/dawg.dir/output.cpp.o CMakeFiles/dawg.dir/rand.cpp.o CMakeFiles/dawg.dir/tree.cpp.o CMakeFiles/dawg.dir/var.cpp.o CMakeFiles/dawg.dir/lex.parser.cpp.o CMakeFiles/dawg.dir/parser.tab.cpp.o -o dawg make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [100%] Built target dawg make[2]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles 0 make[1]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' debian/rules override_dh_auto_test make[1]: Entering directory '/build/dawg-1.2' # FIXME: This test fails - but let the build pass anyway for the moment cd tests && PATH=$PATH:/build/dawg-1.2/obj-arm-linux-gnueabihf/src sh test0.sh || true 2,3c2,3 < TCCTTGACCAGTTAGCAAGACGATATGCATCAAGTGCACTGGC---GTAAGTCTTTTTAC < GCTGATCATA--TAGTCCGTATAGTCACTGAACGCCGTCCTCTCG --- > AGGAACTGGTCACGTTCTGCTATACGTAGTTCACGTGACCGCATTCAGAAAAATGCGACT > AGTATTGTGATCAGGCATATCAGTGACTTGCGGCAGGAGAGC 6,7c6,7 < TCGTTGGACAGT--GCAAGACGCTATGCATCAAGTGCACTGGCTAGGTAAGTGCGTTTAT < GATGAGCACAACAGGTCCGGATAGTCCCTGAACGCTATACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAACACTACT > TGTGCT--GACCATGCATATCAGGGACTTGCGACATGTGGGC 10,11c10,11 < TCGA-CCCCAAA--TTAATACGTTAGTCATCAAGTGCACTGAC---GTAATAGCGTTTAT < GATGATGAGTACTAGCCCGTGGAAACCCTAAAAGCGTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGTTCAGTAGTTAACCAGACGGCATTAACGCTAATACATC- > -GTGTT--GACCTACCAACGTACGGACTTGCGTAATGTGGTC 14,15c14,15 < TCGTTGAACAGT--GCAAGACGCTATGCATCAAGTGCACTGGC---GTAAGTGCGTTTAT < GATGAACACAACTGGTCCGTATAGTCCCTGAACGCTGTACTCCCG --- > AGCAACTTGTCACGTTCTGCGATACGTAGTTCACGTGACCGCATTCACGCAAATACTACT > TGTGTT--GACCAGGCATATCAGGGACTTGCGACATGAGGGC 18,19c18,19 < TCGTACCACAGT--TCAAGACGCTAGGCATCAAGTGCACTGGC---GTAATTGCGTTTAT < GATGGACACAACTAGTCCGTTGAATCCCTGAACGCTTTACCCCCG --- > AGCATGGTGTCAAGTTCTGCGATCCGTAGTTCACGTGACCGCATTAACGCAAATACTACC > TGTGTT--GATCAGGCAACTTAGGGACTTGCGAAATGGGGGC make[1]: Leaving directory '/build/dawg-1.2' create-stamp debian/debhelper-build-stamp fakeroot debian/rules binary dh binary dh_testroot dh_prep dh_auto_install cd obj-arm-linux-gnueabihf && make -j4 install DESTDIR=/build/dawg-1.2/debian/dawg AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" make[1]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -S/build/dawg-1.2 -B/build/dawg-1.2/obj-arm-linux-gnueabihf --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/depend make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' cd /build/dawg-1.2/obj-arm-linux-gnueabihf && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/dawg-1.2 /build/dawg-1.2/src /build/dawg-1.2/obj-arm-linux-gnueabihf /build/dawg-1.2/obj-arm-linux-gnueabihf/src /build/dawg-1.2/obj-arm-linux-gnueabihf/src/CMakeFiles/dawg.dir/DependInfo.cmake --color= make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make -f src/CMakeFiles/dawg.dir/build.make src/CMakeFiles/dawg.dir/build make[3]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make[3]: Nothing to be done for 'src/CMakeFiles/dawg.dir/build'. make[3]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' [100%] Built target dawg make[2]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' /usr/bin/cmake -E cmake_progress_start /build/dawg-1.2/obj-arm-linux-gnueabihf/CMakeFiles 0 make -f CMakeFiles/Makefile2 preinstall make[2]: Entering directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' make[2]: Nothing to be done for 'preinstall'. make[2]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' Install the project... /usr/bin/cmake -P cmake_install.cmake -- Install configuration: "None" -- Installing: /build/dawg-1.2/debian/dawg/usr/bin/dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/applications/dawg.desktop -- Installing: /build/dawg-1.2/debian/dawg/usr/share/pixmaps/dawg.png -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example0.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example1.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example2.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example3.dawg -- Installing: /build/dawg-1.2/debian/dawg/usr/share/doc/dawg/examples/example4.dawg make[1]: Leaving directory '/build/dawg-1.2/obj-arm-linux-gnueabihf' dh_install dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress debian/rules override_dh_fixperms make[1]: Entering directory '/build/dawg-1.2' dh_fixperms chmod -x debian/dawg/usr/share/doc/dawg/examples/* make[1]: Leaving directory '/build/dawg-1.2' dh_missing dh_strip dh_makeshlibs dh_shlibdeps dpkg-shlibdeps: warning: debian/dawg/usr/bin/dawg contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'dawg-dbgsym' in '../dawg-dbgsym_1.2-2_armhf.deb'. dpkg-deb: building package 'dawg' in '../dawg_1.2-2_armhf.deb'. dpkg-genbuildinfo --build=binary dpkg-genchanges --build=binary >../dawg_1.2-2_armhf.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) I: copying local configuration I: user script /srv/workspace/pbuilder/22782/tmp/hooks/B01_cleanup starting I: user script /srv/workspace/pbuilder/22782/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/22782 and its subdirectories I: Current time: Thu Jun 11 05:07:09 +14 2020 I: pbuilder-time-stamp: 1591801629