I: pbuilder: network access will be disabled during build
I: Current time: Sun Feb 23 03:10:53 +14 2025
I: pbuilder-time-stamp: 1740229853
I: Building the build Environment
I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz]
I: copying local configuration
W: --override-config is not set; not updating apt.conf Read the manpage for details.
I: mounting /proc filesystem
I: mounting /sys filesystem
I: creating /{dev,run}/shm
I: mounting /dev/pts filesystem
I: redirecting /dev/ptmx to /dev/pts/ptmx
I: policy-rc.d already exists
I: using eatmydata during job
I: Copying source file
I: copying [ataqv_1.3.1+ds-2.dsc]
I: copying [./ataqv_1.3.1+ds.orig.tar.xz]
I: copying [./ataqv_1.3.1+ds-2.debian.tar.xz]
I: Extracting source
dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2.dsc: unsupported subcommand
dpkg-source: info: extracting ataqv in ataqv-1.3.1+ds
dpkg-source: info: unpacking ataqv_1.3.1+ds.orig.tar.xz
dpkg-source: info: unpacking ataqv_1.3.1+ds-2.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying modernize
dpkg-source: info: applying no_cov
dpkg-source: info: applying python3
dpkg-source: info: applying packaged_js
dpkg-source: info: applying spelling
dpkg-source: info: applying clean_less
dpkg-source: info: applying reproducible_build
I: Not using root during the build.
I: Installing the build-deps
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/D01_modify_environment starting
debug: Running on ionos12-i386.
I: Changing host+domainname to test build reproducibility
I: Adding a custom variable just for the fun of it...
I: Changing /bin/sh to bash
'/bin/sh' -> '/bin/bash'
lrwxrwxrwx 1 root root 9 Feb 22 13:11 /bin/sh -> /bin/bash
I: Setting pbuilder2's login shell to /bin/bash
I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/D01_modify_environment finished
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/D02_print_environment starting
I: set
  BASH=/bin/sh
  BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath
  BASH_ALIASES=()
  BASH_ARGC=()
  BASH_ARGV=()
  BASH_CMDS=()
  BASH_LINENO=([0]="12" [1]="0")
  BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:.
  BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment")
  BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="i686-pc-linux-gnu")
  BASH_VERSION='5.2.37(1)-release'
  BUILDDIR=/build/reproducible-path
  BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other'
  BUILDUSERNAME=pbuilder2
  BUILD_ARCH=i386
  DEBIAN_FRONTEND=noninteractive
  DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=10 '
  DIRSTACK=()
  DISTRIBUTION=trixie
  EUID=0
  FUNCNAME=([0]="Echo" [1]="main")
  GROUPS=()
  HOME=/root
  HOSTNAME=i-capture-the-hostname
  HOSTTYPE=i686
  HOST_ARCH=i386
  IFS=' 	
  '
  INVOCATION_ID=340d0e49ad064cc9b5d6da565611d7b0
  LANG=C
  LANGUAGE=de_CH:de
  LC_ALL=C
  LD_LIBRARY_PATH=/usr/lib/libeatmydata
  LD_PRELOAD=libeatmydata.so
  MACHTYPE=i686-pc-linux-gnu
  MAIL=/var/mail/root
  OPTERR=1
  OPTIND=1
  OSTYPE=linux-gnu
  PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path
  PBCURRENTCOMMANDLINEOPERATION=build
  PBUILDER_OPERATION=build
  PBUILDER_PKGDATADIR=/usr/share/pbuilder
  PBUILDER_PKGLIBDIR=/usr/lib/pbuilder
  PBUILDER_SYSCONFDIR=/etc
  PIPESTATUS=([0]="0")
  POSIXLY_CORRECT=y
  PPID=12918
  PS4='+ '
  PWD=/
  SHELL=/bin/bash
  SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix
  SHLVL=3
  SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.RYnZwfNS/pbuilderrc_Dv0B --distribution trixie --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.RYnZwfNS/b2 --logfile b2/build.log ataqv_1.3.1+ds-2.dsc'
  SUDO_GID=112
  SUDO_UID=107
  SUDO_USER=jenkins
  TERM=unknown
  TZ=/usr/share/zoneinfo/Etc/GMT-14
  UID=0
  USER=root
  _='I: set'
  http_proxy=http://46.16.76.132:3128
I: uname -a
  Linux i-capture-the-hostname 6.1.0-31-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.128-1 (2025-02-07) x86_64 GNU/Linux
I: ls -l /bin
  lrwxrwxrwx 1 root root 7 Nov 22 14:40 /bin -> usr/bin
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/D02_print_environment finished
 -> Attempting to satisfy build-dependencies
 -> Creating pbuilder-satisfydepends-dummy package
Package: pbuilder-satisfydepends-dummy
Version: 0.invalid.0
Architecture: i386
Maintainer: Debian Pbuilder Team <pbuilder-maint@lists.alioth.debian.org>
Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder
 This package was created automatically by pbuilder to satisfy the
 build-dependencies of the package being currently built.
Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper
dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'.
Selecting previously unselected package pbuilder-satisfydepends-dummy.
(Reading database ... 19794 files and directories currently installed.)
Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ...
Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ...
dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested:
 pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however:
  Package debhelper-compat is not installed.
 pbuilder-satisfydepends-dummy depends on libboost-filesystem-dev; however:
  Package libboost-filesystem-dev is not installed.
 pbuilder-satisfydepends-dummy depends on libboost-iostreams-dev; however:
  Package libboost-iostreams-dev is not installed.
 pbuilder-satisfydepends-dummy depends on libboost-system-dev; however:
  Package libboost-system-dev is not installed.
 pbuilder-satisfydepends-dummy depends on libboost-chrono-dev; however:
  Package libboost-chrono-dev is not installed.
 pbuilder-satisfydepends-dummy depends on libhts-dev; however:
  Package libhts-dev is not installed.
 pbuilder-satisfydepends-dummy depends on libncurses-dev; however:
  Package libncurses-dev is not installed.
 pbuilder-satisfydepends-dummy depends on zlib1g-dev; however:
  Package zlib1g-dev is not installed.
 pbuilder-satisfydepends-dummy depends on libjs-jquery; however:
  Package libjs-jquery is not installed.
 pbuilder-satisfydepends-dummy depends on libjs-jquery-datatables; however:
  Package libjs-jquery-datatables is not installed.
 pbuilder-satisfydepends-dummy depends on libjs-jquery-datatables-extensions; however:
  Package libjs-jquery-datatables-extensions is not installed.
 pbuilder-satisfydepends-dummy depends on fonts-font-awesome; however:
  Package fonts-font-awesome is not installed.
 pbuilder-satisfydepends-dummy depends on node-normalize.css; however:
  Package node-normalize.css is not installed.
 pbuilder-satisfydepends-dummy depends on help2man; however:
  Package help2man is not installed.
 pbuilder-satisfydepends-dummy depends on python3; however:
  Package python3 is not installed.
 pbuilder-satisfydepends-dummy depends on node-d3; however:
  Package node-d3 is not installed.
 pbuilder-satisfydepends-dummy depends on debhelper; however:
  Package debhelper is not installed.

Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ...
Reading package lists...
Building dependency tree...
Reading state information...
Initializing package states...
Writing extended state information...
Building tag database...
pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0)
pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0)
The following NEW packages will be installed:
  autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} comerr-dev{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} fonts-font-awesome{a} gettext{a} gettext-base{a} groff-base{a} help2man{a} icu-devtools{a} intltool-debian{a} krb5-multidev{a} libarchive-zip-perl{a} libboost-atomic1.83-dev{a} libboost-atomic1.83.0{a} libboost-chrono-dev{a} libboost-chrono1.83-dev{a} libboost-chrono1.83.0t64{a} libboost-filesystem-dev{a} libboost-filesystem1.83-dev{a} libboost-filesystem1.83.0{a} libboost-iostreams-dev{a} libboost-iostreams1.83-dev{a} libboost-regex1.83-dev{a} libboost-regex1.83.0{a} libboost-system-dev{a} libboost-system1.83-dev{a} libboost-system1.83.0{a} libboost1.83-dev{a} libbrotli-dev{a} libbrotli1{a} libbz2-dev{a} libcom-err2{a} libcurl3t64-gnutls{a} libcurl4-gnutls-dev{a} libdebhelper-perl{a} libdeflate-dev{a} libdeflate0{a} libelf1t64{a} libevent-2.1-7t64{a} libexpat1{a} libffi8{a} libfile-stripnondeterminism-perl{a} libgmp-dev{a} libgmpxx4ldbl{a} libgnutls-dane0t64{a} libgnutls-openssl27t64{a} libgnutls28-dev{a} libgnutls30t64{a} libgssapi-krb5-2{a} libgssrpc4t64{a} libhts-dev{a} libhts3t64{a} libhtscodecs2{a} libicu-dev{a} libicu72{a} libidn2-0{a} libidn2-dev{a} libjs-d3-format{a} libjs-jquery{a} libjs-jquery-datatables{a} libjs-jquery-datatables-extensions{a} libk5crypto3{a} libkadm5clnt-mit12{a} libkadm5srv-mit12{a} libkdb5-10t64{a} libkeyutils1{a} libkrb5-3{a} libkrb5-dev{a} libkrb5support0{a} libldap-dev{a} libldap2{a} liblocale-gettext-perl{a} liblzma-dev{a} libmagic-mgc{a} libmagic1t64{a} libncurses-dev{a} libncurses6{a} libnghttp2-14{a} libnghttp2-dev{a} libnghttp3-9{a} libnghttp3-dev{a} libngtcp2-16{a} libngtcp2-crypto-gnutls-dev{a} libngtcp2-crypto-gnutls8{a} libngtcp2-dev{a} libp11-kit-dev{a} libp11-kit0{a} libpipeline1{a} libpkgconf3{a} libpsl-dev{a} libpsl5t64{a} libpython3-stdlib{a} libpython3.13-minimal{a} libpython3.13-stdlib{a} libreadline8t64{a} librtmp-dev{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libssh2-1-dev{a} libssh2-1t64{a} libssl-dev{a} libtasn1-6{a} libtasn1-6-dev{a} libtool{a} libuchardet0{a} libunbound8{a} libunistring5{a} libxml2{a} libzstd-dev{a} m4{a} man-db{a} media-types{a} netbase{a} nettle-dev{a} node-commander{a} node-d3{a} node-d3-array{a} node-d3-axis{a} node-d3-brush{a} node-d3-chord{a} node-d3-collection{a} node-d3-color{a} node-d3-contour{a} node-d3-dispatch{a} node-d3-drag{a} node-d3-dsv{a} node-d3-ease{a} node-d3-fetch{a} node-d3-force{a} node-d3-format{a} node-d3-geo{a} node-d3-hierarchy{a} node-d3-interpolate{a} node-d3-path{a} node-d3-polygon{a} node-d3-quadtree{a} node-d3-queue{a} node-d3-random{a} node-d3-scale{a} node-d3-scale-chromatic{a} node-d3-selection{a} node-d3-shape{a} node-d3-time{a} node-d3-time-format{a} node-d3-timer{a} node-d3-transition{a} node-d3-voronoi{a} node-d3-zoom{a} node-iconv-lite{a} node-normalize.css{a} node-rw{a} node-safe-buffer{a} pkgconf{a} pkgconf-bin{a} po-debconf{a} python3{a} python3-minimal{a} python3.13{a} python3.13-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} 
The following packages are RECOMMENDED but will NOT be installed:
  bzip2-doc ca-certificates curl javascript-common krb5-locales libarchive-cpio-perl libgpm2 libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules libtasn1-doc lynx publicsuffix wget 
0 packages upgraded, 172 newly installed, 0 to remove and 0 not upgraded.
Need to get 75.4 MB of archives. After unpacking 414 MB will be used.
Writing extended state information...
Get: 1 http://deb.debian.org/debian trixie/main i386 liblocale-gettext-perl i386 1.07-7+b1 [15.4 kB]
Get: 2 http://deb.debian.org/debian trixie/main i386 libpython3.13-minimal i386 3.13.2-1 [859 kB]
Get: 3 http://deb.debian.org/debian trixie/main i386 libexpat1 i386 2.6.4-1 [107 kB]
Get: 4 http://deb.debian.org/debian trixie/main i386 python3.13-minimal i386 3.13.2-1 [2266 kB]
Get: 5 http://deb.debian.org/debian trixie/main i386 python3-minimal i386 3.13.1-2 [27.0 kB]
Get: 6 http://deb.debian.org/debian trixie/main i386 media-types all 10.1.0 [26.9 kB]
Get: 7 http://deb.debian.org/debian trixie/main i386 netbase all 6.4 [12.8 kB]
Get: 8 http://deb.debian.org/debian trixie/main i386 tzdata all 2025a-2 [259 kB]
Get: 9 http://deb.debian.org/debian trixie/main i386 libffi8 i386 3.4.7-1 [21.4 kB]
Get: 10 http://deb.debian.org/debian trixie/main i386 readline-common all 8.2-6 [69.4 kB]
Get: 11 http://deb.debian.org/debian trixie/main i386 libreadline8t64 i386 8.2-6 [173 kB]
Get: 12 http://deb.debian.org/debian trixie/main i386 libpython3.13-stdlib i386 3.13.2-1 [1985 kB]
Get: 13 http://deb.debian.org/debian trixie/main i386 python3.13 i386 3.13.2-1 [745 kB]
Get: 14 http://deb.debian.org/debian trixie/main i386 libpython3-stdlib i386 3.13.1-2 [9952 B]
Get: 15 http://deb.debian.org/debian trixie/main i386 python3 i386 3.13.1-2 [28.0 kB]
Get: 16 http://deb.debian.org/debian trixie/main i386 sensible-utils all 0.0.24 [24.8 kB]
Get: 17 http://deb.debian.org/debian trixie/main i386 libmagic-mgc i386 1:5.45-3+b1 [314 kB]
Get: 18 http://deb.debian.org/debian trixie/main i386 libmagic1t64 i386 1:5.45-3+b1 [115 kB]
Get: 19 http://deb.debian.org/debian trixie/main i386 file i386 1:5.45-3+b1 [43.2 kB]
Get: 20 http://deb.debian.org/debian trixie/main i386 gettext-base i386 0.23.1-1 [245 kB]
Get: 21 http://deb.debian.org/debian trixie/main i386 libuchardet0 i386 0.0.8-1+b2 [69.2 kB]
Get: 22 http://deb.debian.org/debian trixie/main i386 groff-base i386 1.23.0-7 [1199 kB]
Get: 23 http://deb.debian.org/debian trixie/main i386 bsdextrautils i386 2.40.4-3 [96.2 kB]
Get: 24 http://deb.debian.org/debian trixie/main i386 libpipeline1 i386 1.5.8-1 [41.2 kB]
Get: 25 http://deb.debian.org/debian trixie/main i386 man-db i386 2.13.0-1 [1428 kB]
Get: 26 http://deb.debian.org/debian trixie/main i386 m4 i386 1.4.19-5 [301 kB]
Get: 27 http://deb.debian.org/debian trixie/main i386 autoconf all 2.72-3 [493 kB]
Get: 28 http://deb.debian.org/debian trixie/main i386 autotools-dev all 20220109.1 [51.6 kB]
Get: 29 http://deb.debian.org/debian trixie/main i386 automake all 1:1.17-3 [862 kB]
Get: 30 http://deb.debian.org/debian trixie/main i386 autopoint all 0.23.1-1 [770 kB]
Get: 31 http://deb.debian.org/debian trixie/main i386 libcom-err2 i386 1.47.2-1 [24.3 kB]
Get: 32 http://deb.debian.org/debian trixie/main i386 comerr-dev i386 2.1-1.47.2-1 [56.2 kB]
Get: 33 http://deb.debian.org/debian trixie/main i386 libdebhelper-perl all 13.24.1 [90.9 kB]
Get: 34 http://deb.debian.org/debian trixie/main i386 libtool all 2.5.4-3 [539 kB]
Get: 35 http://deb.debian.org/debian trixie/main i386 dh-autoreconf all 20 [17.1 kB]
Get: 36 http://deb.debian.org/debian trixie/main i386 libarchive-zip-perl all 1.68-1 [104 kB]
Get: 37 http://deb.debian.org/debian trixie/main i386 libfile-stripnondeterminism-perl all 1.14.1-2 [19.7 kB]
Get: 38 http://deb.debian.org/debian trixie/main i386 dh-strip-nondeterminism all 1.14.1-2 [8620 B]
Get: 39 http://deb.debian.org/debian trixie/main i386 libelf1t64 i386 0.192-4 [195 kB]
Get: 40 http://deb.debian.org/debian trixie/main i386 dwz i386 0.15-1+b1 [116 kB]
Get: 41 http://deb.debian.org/debian trixie/main i386 libunistring5 i386 1.3-1 [458 kB]
Get: 42 http://deb.debian.org/debian trixie/main i386 libicu72 i386 72.1-6 [9582 kB]
Get: 43 http://deb.debian.org/debian trixie/main i386 libxml2 i386 2.12.7+dfsg+really2.9.14-0.2+b1 [734 kB]
Get: 44 http://deb.debian.org/debian trixie/main i386 gettext i386 0.23.1-1 [1714 kB]
Get: 45 http://deb.debian.org/debian trixie/main i386 intltool-debian all 0.35.0+20060710.6 [22.9 kB]
Get: 46 http://deb.debian.org/debian trixie/main i386 po-debconf all 1.0.21+nmu1 [248 kB]
Get: 47 http://deb.debian.org/debian trixie/main i386 debhelper all 13.24.1 [920 kB]
Get: 48 http://deb.debian.org/debian trixie/main i386 fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [517 kB]
Get: 49 http://deb.debian.org/debian trixie/main i386 help2man i386 1.49.3 [198 kB]
Get: 50 http://deb.debian.org/debian trixie/main i386 icu-devtools i386 72.1-6 [218 kB]
Get: 51 http://deb.debian.org/debian trixie/main i386 libkrb5support0 i386 1.21.3-4 [35.0 kB]
Get: 52 http://deb.debian.org/debian trixie/main i386 libk5crypto3 i386 1.21.3-4 [83.7 kB]
Get: 53 http://deb.debian.org/debian trixie/main i386 libkeyutils1 i386 1.6.3-4 [9600 B]
Get: 54 http://deb.debian.org/debian trixie/main i386 libkrb5-3 i386 1.21.3-4 [354 kB]
Get: 55 http://deb.debian.org/debian trixie/main i386 libgssapi-krb5-2 i386 1.21.3-4 [149 kB]
Get: 56 http://deb.debian.org/debian trixie/main i386 libgssrpc4t64 i386 1.21.3-4 [63.4 kB]
Get: 57 http://deb.debian.org/debian trixie/main i386 libkadm5clnt-mit12 i386 1.21.3-4 [44.1 kB]
Get: 58 http://deb.debian.org/debian trixie/main i386 libkdb5-10t64 i386 1.21.3-4 [45.3 kB]
Get: 59 http://deb.debian.org/debian trixie/main i386 libkadm5srv-mit12 i386 1.21.3-4 [57.7 kB]
Get: 60 http://deb.debian.org/debian trixie/main i386 krb5-multidev i386 1.21.3-4 [126 kB]
Get: 61 http://deb.debian.org/debian trixie/main i386 libboost1.83-dev i386 1.83.0-4.1 [10.6 MB]
Get: 62 http://deb.debian.org/debian trixie/main i386 libboost-atomic1.83.0 i386 1.83.0-4.1 [234 kB]
Get: 63 http://deb.debian.org/debian trixie/main i386 libboost-atomic1.83-dev i386 1.83.0-4.1 [235 kB]
Get: 64 http://deb.debian.org/debian trixie/main i386 libboost-chrono1.83.0t64 i386 1.83.0-4.1 [241 kB]
Get: 65 http://deb.debian.org/debian trixie/main i386 libboost-chrono1.83-dev i386 1.83.0-4.1 [247 kB]
Get: 66 http://deb.debian.org/debian trixie/main i386 libboost-chrono-dev i386 1.83.0.2+b2 [4228 B]
Get: 67 http://deb.debian.org/debian trixie/main i386 libboost-filesystem1.83.0 i386 1.83.0-4.1 [287 kB]
Get: 68 http://deb.debian.org/debian trixie/main i386 libboost-system1.83.0 i386 1.83.0-4.1 [230 kB]
Get: 69 http://deb.debian.org/debian trixie/main i386 libboost-system1.83-dev i386 1.83.0-4.1 [231 kB]
Get: 70 http://deb.debian.org/debian trixie/main i386 libboost-filesystem1.83-dev i386 1.83.0-4.1 [305 kB]
Get: 71 http://deb.debian.org/debian trixie/main i386 libboost-filesystem-dev i386 1.83.0.2+b2 [3640 B]
Get: 72 http://deb.debian.org/debian trixie/main i386 libboost-regex1.83.0 i386 1.83.0-4.1 [329 kB]
Get: 73 http://deb.debian.org/debian trixie/main i386 libicu-dev i386 72.1-6 [10.6 MB]
Get: 74 http://deb.debian.org/debian trixie/main i386 libboost-regex1.83-dev i386 1.83.0-4.1 [347 kB]
Get: 75 http://deb.debian.org/debian trixie/main i386 libboost-iostreams1.83-dev i386 1.83.0-4.1 [264 kB]
Get: 76 http://deb.debian.org/debian trixie/main i386 libboost-iostreams-dev i386 1.83.0.2+b2 [3588 B]
Get: 77 http://deb.debian.org/debian trixie/main i386 libboost-system-dev i386 1.83.0.2+b2 [3740 B]
Get: 78 http://deb.debian.org/debian trixie/main i386 libbrotli1 i386 1.1.0-2+b6 [308 kB]
Get: 79 http://deb.debian.org/debian trixie/main i386 libbrotli-dev i386 1.1.0-2+b6 [313 kB]
Get: 80 http://deb.debian.org/debian trixie/main i386 libbz2-dev i386 1.0.8-6 [32.1 kB]
Get: 81 http://deb.debian.org/debian trixie/main i386 libidn2-0 i386 2.3.7-2+b1 [130 kB]
Get: 82 http://deb.debian.org/debian trixie/main i386 libp11-kit0 i386 0.25.5-3 [423 kB]
Get: 83 http://deb.debian.org/debian trixie/main i386 libtasn1-6 i386 4.20.0-2 [51.6 kB]
Get: 84 http://deb.debian.org/debian trixie/main i386 libgnutls30t64 i386 3.8.9-2 [1462 kB]
Get: 85 http://deb.debian.org/debian trixie/main i386 libsasl2-modules-db i386 2.1.28+dfsg1-8+b1 [20.9 kB]
Get: 86 http://deb.debian.org/debian trixie/main i386 libsasl2-2 i386 2.1.28+dfsg1-8+b1 [61.3 kB]
Get: 87 http://deb.debian.org/debian trixie/main i386 libldap2 i386 2.6.9+dfsg-1 [205 kB]
Get: 88 http://deb.debian.org/debian trixie/main i386 libnghttp2-14 i386 1.64.0-1 [82.4 kB]
Get: 89 http://deb.debian.org/debian trixie/main i386 libnghttp3-9 i386 1.6.0-2 [75.9 kB]
Get: 90 http://deb.debian.org/debian trixie/main i386 libngtcp2-16 i386 1.9.1-1 [151 kB]
Get: 91 http://deb.debian.org/debian trixie/main i386 libngtcp2-crypto-gnutls8 i386 1.9.1-1 [19.1 kB]
Get: 92 http://deb.debian.org/debian trixie/main i386 libpsl5t64 i386 0.21.2-1.1+b1 [57.7 kB]
Get: 93 http://deb.debian.org/debian trixie/main i386 librtmp1 i386 2.4+20151223.gitfa8646d.1-2+b5 [62.4 kB]
Get: 94 http://deb.debian.org/debian trixie/main i386 libssh2-1t64 i386 1.11.1-1 [256 kB]
Get: 95 http://deb.debian.org/debian trixie/main i386 libcurl3t64-gnutls i386 8.12.1-2 [411 kB]
Get: 96 http://deb.debian.org/debian trixie/main i386 libevent-2.1-7t64 i386 2.1.12-stable-10+b1 [195 kB]
Get: 97 http://deb.debian.org/debian trixie/main i386 libunbound8 i386 1.22.0-1+b1 [633 kB]
Get: 98 http://deb.debian.org/debian trixie/main i386 libgnutls-dane0t64 i386 3.8.9-2 [453 kB]
Get: 99 http://deb.debian.org/debian trixie/main i386 libgnutls-openssl27t64 i386 3.8.9-2 [453 kB]
Get: 100 http://deb.debian.org/debian trixie/main i386 libidn2-dev i386 2.3.7-2+b1 [126 kB]
Get: 101 http://deb.debian.org/debian trixie/main i386 libp11-kit-dev i386 0.25.5-3 [208 kB]
Get: 102 http://deb.debian.org/debian trixie/main i386 libtasn1-6-dev i386 4.20.0-2 [103 kB]
Get: 103 http://deb.debian.org/debian trixie/main i386 libgmpxx4ldbl i386 2:6.3.0+dfsg-3 [329 kB]
Get: 104 http://deb.debian.org/debian trixie/main i386 libgmp-dev i386 2:6.3.0+dfsg-3 [661 kB]
Get: 105 http://deb.debian.org/debian trixie/main i386 nettle-dev i386 3.10-1+b1 [1334 kB]
Get: 106 http://deb.debian.org/debian trixie/main i386 libgnutls28-dev i386 3.8.9-2 [1464 kB]
Get: 107 http://deb.debian.org/debian trixie/main i386 libkrb5-dev i386 1.21.3-4 [15.9 kB]
Get: 108 http://deb.debian.org/debian trixie/main i386 libldap-dev i386 2.6.9+dfsg-1 [328 kB]
Get: 109 http://deb.debian.org/debian trixie/main i386 libpkgconf3 i386 1.8.1-4 [38.4 kB]
Get: 110 http://deb.debian.org/debian trixie/main i386 pkgconf-bin i386 1.8.1-4 [30.6 kB]
Get: 111 http://deb.debian.org/debian trixie/main i386 pkgconf i386 1.8.1-4 [26.2 kB]
Get: 112 http://deb.debian.org/debian trixie/main i386 libnghttp2-dev i386 1.64.0-1 [123 kB]
Get: 113 http://deb.debian.org/debian trixie/main i386 libnghttp3-dev i386 1.6.0-2 [101 kB]
Get: 114 http://deb.debian.org/debian trixie/main i386 libngtcp2-crypto-gnutls-dev i386 1.9.1-1 [24.0 kB]
Get: 115 http://deb.debian.org/debian trixie/main i386 libngtcp2-dev i386 1.9.1-1 [202 kB]
Get: 116 http://deb.debian.org/debian trixie/main i386 libpsl-dev i386 0.21.2-1.1+b1 [78.4 kB]
Get: 117 http://deb.debian.org/debian trixie/main i386 zlib1g-dev i386 1:1.3.dfsg+really1.3.1-1+b1 [916 kB]
Get: 118 http://deb.debian.org/debian trixie/main i386 librtmp-dev i386 2.4+20151223.gitfa8646d.1-2+b5 [72.3 kB]
Get: 119 http://deb.debian.org/debian trixie/main i386 libssl-dev i386 3.4.1-1 [2837 kB]
Get: 120 http://deb.debian.org/debian trixie/main i386 libssh2-1-dev i386 1.11.1-1 [407 kB]
Get: 121 http://deb.debian.org/debian trixie/main i386 libzstd-dev i386 1.5.6+dfsg-2 [354 kB]
Get: 122 http://deb.debian.org/debian trixie/main i386 libcurl4-gnutls-dev i386 8.12.1-2 [542 kB]
Get: 123 http://deb.debian.org/debian trixie/main i386 libdeflate0 i386 1.23-1+b1 [48.4 kB]
Get: 124 http://deb.debian.org/debian trixie/main i386 libdeflate-dev i386 1.23-1+b1 [57.5 kB]
Get: 125 http://deb.debian.org/debian trixie/main i386 libhtscodecs2 i386 1.6.1-2 [70.9 kB]
Get: 126 http://deb.debian.org/debian trixie/main i386 libhts3t64 i386 1.21+ds-1 [506 kB]
Get: 127 http://deb.debian.org/debian trixie/main i386 liblzma-dev i386 5.6.3-1+b1 [328 kB]
Get: 128 http://deb.debian.org/debian trixie/main i386 libhts-dev i386 1.21+ds-1 [1725 kB]
Get: 129 http://deb.debian.org/debian trixie/main i386 libjs-d3-format all 1:1.4.5+~1.4.2-2 [17.7 kB]
Get: 130 http://deb.debian.org/debian trixie/main i386 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [326 kB]
Get: 131 http://deb.debian.org/debian trixie/main i386 libjs-jquery-datatables all 1.11.5+dfsg-2 [144 kB]
Get: 132 http://deb.debian.org/debian trixie/main i386 libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB]
Get: 133 http://deb.debian.org/debian trixie/main i386 libncurses6 i386 6.5+20250125-2 [112 kB]
Get: 134 http://deb.debian.org/debian trixie/main i386 libncurses-dev i386 6.5+20250125-2 [384 kB]
Get: 135 http://deb.debian.org/debian trixie/main i386 node-commander all 9.4.1-1 [65.3 kB]
Get: 136 http://deb.debian.org/debian trixie/main i386 node-d3-array all 3.2.0+~cs5.0.6-2 [44.1 kB]
Get: 137 http://deb.debian.org/debian trixie/main i386 node-d3-axis all 1.0.12+~1.0.16-1 [13.7 kB]
Get: 138 http://deb.debian.org/debian trixie/main i386 node-d3-dispatch all 1.0.6+~1.0.9-1 [9560 B]
Get: 139 http://deb.debian.org/debian trixie/main i386 node-d3-selection all 1.4.1+~1.4.3-1 [42.1 kB]
Get: 140 http://deb.debian.org/debian trixie/main i386 node-d3-drag all 1.2.5+~1.2.5-1 [18.7 kB]
Get: 141 http://deb.debian.org/debian trixie/main i386 node-d3-color all 1.4.1+~1.4.2-1 [19.1 kB]
Get: 142 http://deb.debian.org/debian trixie/main i386 node-d3-interpolate all 1.4.0+~1.4.2-1 [23.3 kB]
Get: 143 http://deb.debian.org/debian trixie/main i386 node-d3-ease all 1.0.7+~1.0.11-1 [12.2 kB]
Get: 144 http://deb.debian.org/debian trixie/main i386 node-d3-timer all 1.0.10+~1.0.10-1 [10.3 kB]
Get: 145 http://deb.debian.org/debian trixie/main i386 node-d3-transition all 1.3.2+~1.3.2-1 [28.2 kB]
Get: 146 http://deb.debian.org/debian trixie/main i386 node-d3-brush all 1.1.6+~1.1.5-1 [185 kB]
Get: 147 http://deb.debian.org/debian trixie/main i386 node-d3-path all 1.0.9+~1.0.9-1 [10.2 kB]
Get: 148 http://deb.debian.org/debian trixie/main i386 node-d3-chord all 1.0.6+~1.0.11-1 [13.9 kB]
Get: 149 http://deb.debian.org/debian trixie/main i386 node-d3-collection all 1.0.7+~1.0.10-1 [16.9 kB]
Get: 150 http://deb.debian.org/debian trixie/main i386 node-d3-contour all 1.3.2+~1.3.3-1 [17.2 kB]
Get: 151 http://deb.debian.org/debian trixie/main i386 node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.5 kB]
Get: 152 http://deb.debian.org/debian trixie/main i386 node-iconv-lite all 0.6.3-3 [115 kB]
Get: 153 http://deb.debian.org/debian trixie/main i386 node-d3-queue all 3.0.7-13 [10.2 kB]
Get: 154 http://deb.debian.org/debian trixie/main i386 node-rw all 1.3.3-5 [7428 B]
Get: 155 http://deb.debian.org/debian trixie/main i386 node-d3-dsv all 1.2.0+~1.2.3-1 [17.4 kB]
Get: 156 http://deb.debian.org/debian trixie/main i386 node-d3-fetch all 1.2.0+~1.2.2-1 [9844 B]
Get: 157 http://deb.debian.org/debian trixie/main i386 node-d3-quadtree all 1.0.7+~1.0.9-1 [16.0 kB]
Get: 158 http://deb.debian.org/debian trixie/main i386 node-d3-force all 2.1.1+~2.1.4-1 [30.2 kB]
Get: 159 http://deb.debian.org/debian trixie/main i386 node-d3-format all 1:1.4.5+~1.4.2-2 [12.6 kB]
Get: 160 http://deb.debian.org/debian trixie/main i386 node-d3-geo all 1.12.1+~1.12.4-1 [65.5 kB]
Get: 161 http://deb.debian.org/debian trixie/main i386 node-d3-hierarchy all 1.1.9+~1.1.8-1 [34.1 kB]
Get: 162 http://deb.debian.org/debian trixie/main i386 node-d3-polygon all 1.0.6+~1.0.8-1 [8580 B]
Get: 163 http://deb.debian.org/debian trixie/main i386 node-d3-random all 1.1.2+~1.1.3-1 [8908 B]
Get: 164 http://deb.debian.org/debian trixie/main i386 node-d3-time all 1.1.0+~1.1.1-1 [18.7 kB]
Get: 165 http://deb.debian.org/debian trixie/main i386 node-d3-time-format all 2.3.0+~2.3.1-1 [22.9 kB]
Get: 166 http://deb.debian.org/debian trixie/main i386 node-d3-scale all 2.2.2+~2.2.6-1 [42.7 kB]
Get: 167 http://deb.debian.org/debian trixie/main i386 node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [21.4 kB]
Get: 168 http://deb.debian.org/debian trixie/main i386 node-d3-shape all 1.3.7+~1.3.8-1 [54.8 kB]
Get: 169 http://deb.debian.org/debian trixie/main i386 node-d3-voronoi all 1.1.4+~1.1.9-1 [19.8 kB]
Get: 170 http://deb.debian.org/debian trixie/main i386 node-d3-zoom all 1.8.3+~1.8.4-1 [26.8 kB]
Get: 171 http://deb.debian.org/debian trixie/main i386 node-d3 all 5.16.0+~cs5.28.10-2 [223 kB]
Get: 172 http://deb.debian.org/debian trixie/main i386 node-normalize.css all 8.0.1-5 [12.7 kB]
Fetched 75.4 MB in 1s (54.1 MB/s)
Preconfiguring packages ...
Selecting previously unselected package liblocale-gettext-perl.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 19794 files and directories currently installed.)
Preparing to unpack .../liblocale-gettext-perl_1.07-7+b1_i386.deb ...
Unpacking liblocale-gettext-perl (1.07-7+b1) ...
Selecting previously unselected package libpython3.13-minimal:i386.
Preparing to unpack .../libpython3.13-minimal_3.13.2-1_i386.deb ...
Unpacking libpython3.13-minimal:i386 (3.13.2-1) ...
Selecting previously unselected package libexpat1:i386.
Preparing to unpack .../libexpat1_2.6.4-1_i386.deb ...
Unpacking libexpat1:i386 (2.6.4-1) ...
Selecting previously unselected package python3.13-minimal.
Preparing to unpack .../python3.13-minimal_3.13.2-1_i386.deb ...
Unpacking python3.13-minimal (3.13.2-1) ...
Setting up libpython3.13-minimal:i386 (3.13.2-1) ...
Setting up libexpat1:i386 (2.6.4-1) ...
Setting up python3.13-minimal (3.13.2-1) ...
Selecting previously unselected package python3-minimal.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 20143 files and directories currently installed.)
Preparing to unpack .../0-python3-minimal_3.13.1-2_i386.deb ...
Unpacking python3-minimal (3.13.1-2) ...
Selecting previously unselected package media-types.
Preparing to unpack .../1-media-types_10.1.0_all.deb ...
Unpacking media-types (10.1.0) ...
Selecting previously unselected package netbase.
Preparing to unpack .../2-netbase_6.4_all.deb ...
Unpacking netbase (6.4) ...
Selecting previously unselected package tzdata.
Preparing to unpack .../3-tzdata_2025a-2_all.deb ...
Unpacking tzdata (2025a-2) ...
Selecting previously unselected package libffi8:i386.
Preparing to unpack .../4-libffi8_3.4.7-1_i386.deb ...
Unpacking libffi8:i386 (3.4.7-1) ...
Selecting previously unselected package readline-common.
Preparing to unpack .../5-readline-common_8.2-6_all.deb ...
Unpacking readline-common (8.2-6) ...
Selecting previously unselected package libreadline8t64:i386.
Preparing to unpack .../6-libreadline8t64_8.2-6_i386.deb ...
Adding 'diversion of /lib/i386-linux-gnu/libhistory.so.8 to /lib/i386-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/i386-linux-gnu/libhistory.so.8.2 to /lib/i386-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/i386-linux-gnu/libreadline.so.8 to /lib/i386-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/i386-linux-gnu/libreadline.so.8.2 to /lib/i386-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64'
Unpacking libreadline8t64:i386 (8.2-6) ...
Selecting previously unselected package libpython3.13-stdlib:i386.
Preparing to unpack .../7-libpython3.13-stdlib_3.13.2-1_i386.deb ...
Unpacking libpython3.13-stdlib:i386 (3.13.2-1) ...
Selecting previously unselected package python3.13.
Preparing to unpack .../8-python3.13_3.13.2-1_i386.deb ...
Unpacking python3.13 (3.13.2-1) ...
Selecting previously unselected package libpython3-stdlib:i386.
Preparing to unpack .../9-libpython3-stdlib_3.13.1-2_i386.deb ...
Unpacking libpython3-stdlib:i386 (3.13.1-2) ...
Setting up python3-minimal (3.13.1-2) ...
Selecting previously unselected package python3.
(Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 21153 files and directories currently installed.)
Preparing to unpack .../000-python3_3.13.1-2_i386.deb ...
Unpacking python3 (3.13.1-2) ...
Selecting previously unselected package sensible-utils.
Preparing to unpack .../001-sensible-utils_0.0.24_all.deb ...
Unpacking sensible-utils (0.0.24) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../002-libmagic-mgc_1%3a5.45-3+b1_i386.deb ...
Unpacking libmagic-mgc (1:5.45-3+b1) ...
Selecting previously unselected package libmagic1t64:i386.
Preparing to unpack .../003-libmagic1t64_1%3a5.45-3+b1_i386.deb ...
Unpacking libmagic1t64:i386 (1:5.45-3+b1) ...
Selecting previously unselected package file.
Preparing to unpack .../004-file_1%3a5.45-3+b1_i386.deb ...
Unpacking file (1:5.45-3+b1) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../005-gettext-base_0.23.1-1_i386.deb ...
Unpacking gettext-base (0.23.1-1) ...
Selecting previously unselected package libuchardet0:i386.
Preparing to unpack .../006-libuchardet0_0.0.8-1+b2_i386.deb ...
Unpacking libuchardet0:i386 (0.0.8-1+b2) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../007-groff-base_1.23.0-7_i386.deb ...
Unpacking groff-base (1.23.0-7) ...
Selecting previously unselected package bsdextrautils.
Preparing to unpack .../008-bsdextrautils_2.40.4-3_i386.deb ...
Unpacking bsdextrautils (2.40.4-3) ...
Selecting previously unselected package libpipeline1:i386.
Preparing to unpack .../009-libpipeline1_1.5.8-1_i386.deb ...
Unpacking libpipeline1:i386 (1.5.8-1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../010-man-db_2.13.0-1_i386.deb ...
Unpacking man-db (2.13.0-1) ...
Selecting previously unselected package m4.
Preparing to unpack .../011-m4_1.4.19-5_i386.deb ...
Unpacking m4 (1.4.19-5) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../012-autoconf_2.72-3_all.deb ...
Unpacking autoconf (2.72-3) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../013-autotools-dev_20220109.1_all.deb ...
Unpacking autotools-dev (20220109.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../014-automake_1%3a1.17-3_all.deb ...
Unpacking automake (1:1.17-3) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../015-autopoint_0.23.1-1_all.deb ...
Unpacking autopoint (0.23.1-1) ...
Selecting previously unselected package libcom-err2:i386.
Preparing to unpack .../016-libcom-err2_1.47.2-1_i386.deb ...
Unpacking libcom-err2:i386 (1.47.2-1) ...
Selecting previously unselected package comerr-dev:i386.
Preparing to unpack .../017-comerr-dev_2.1-1.47.2-1_i386.deb ...
Unpacking comerr-dev:i386 (2.1-1.47.2-1) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../018-libdebhelper-perl_13.24.1_all.deb ...
Unpacking libdebhelper-perl (13.24.1) ...
Selecting previously unselected package libtool.
Preparing to unpack .../019-libtool_2.5.4-3_all.deb ...
Unpacking libtool (2.5.4-3) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../020-dh-autoreconf_20_all.deb ...
Unpacking dh-autoreconf (20) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../021-libarchive-zip-perl_1.68-1_all.deb ...
Unpacking libarchive-zip-perl (1.68-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../022-libfile-stripnondeterminism-perl_1.14.1-2_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.14.1-2) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../023-dh-strip-nondeterminism_1.14.1-2_all.deb ...
Unpacking dh-strip-nondeterminism (1.14.1-2) ...
Selecting previously unselected package libelf1t64:i386.
Preparing to unpack .../024-libelf1t64_0.192-4_i386.deb ...
Unpacking libelf1t64:i386 (0.192-4) ...
Selecting previously unselected package dwz.
Preparing to unpack .../025-dwz_0.15-1+b1_i386.deb ...
Unpacking dwz (0.15-1+b1) ...
Selecting previously unselected package libunistring5:i386.
Preparing to unpack .../026-libunistring5_1.3-1_i386.deb ...
Unpacking libunistring5:i386 (1.3-1) ...
Selecting previously unselected package libicu72:i386.
Preparing to unpack .../027-libicu72_72.1-6_i386.deb ...
Unpacking libicu72:i386 (72.1-6) ...
Selecting previously unselected package libxml2:i386.
Preparing to unpack .../028-libxml2_2.12.7+dfsg+really2.9.14-0.2+b1_i386.deb ...
Unpacking libxml2:i386 (2.12.7+dfsg+really2.9.14-0.2+b1) ...
Selecting previously unselected package gettext.
Preparing to unpack .../029-gettext_0.23.1-1_i386.deb ...
Unpacking gettext (0.23.1-1) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../030-intltool-debian_0.35.0+20060710.6_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.6) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../031-po-debconf_1.0.21+nmu1_all.deb ...
Unpacking po-debconf (1.0.21+nmu1) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../032-debhelper_13.24.1_all.deb ...
Unpacking debhelper (13.24.1) ...
Selecting previously unselected package fonts-font-awesome.
Preparing to unpack .../033-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ...
Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ...
Selecting previously unselected package help2man.
Preparing to unpack .../034-help2man_1.49.3_i386.deb ...
Unpacking help2man (1.49.3) ...
Selecting previously unselected package icu-devtools.
Preparing to unpack .../035-icu-devtools_72.1-6_i386.deb ...
Unpacking icu-devtools (72.1-6) ...
Selecting previously unselected package libkrb5support0:i386.
Preparing to unpack .../036-libkrb5support0_1.21.3-4_i386.deb ...
Unpacking libkrb5support0:i386 (1.21.3-4) ...
Selecting previously unselected package libk5crypto3:i386.
Preparing to unpack .../037-libk5crypto3_1.21.3-4_i386.deb ...
Unpacking libk5crypto3:i386 (1.21.3-4) ...
Selecting previously unselected package libkeyutils1:i386.
Preparing to unpack .../038-libkeyutils1_1.6.3-4_i386.deb ...
Unpacking libkeyutils1:i386 (1.6.3-4) ...
Selecting previously unselected package libkrb5-3:i386.
Preparing to unpack .../039-libkrb5-3_1.21.3-4_i386.deb ...
Unpacking libkrb5-3:i386 (1.21.3-4) ...
Selecting previously unselected package libgssapi-krb5-2:i386.
Preparing to unpack .../040-libgssapi-krb5-2_1.21.3-4_i386.deb ...
Unpacking libgssapi-krb5-2:i386 (1.21.3-4) ...
Selecting previously unselected package libgssrpc4t64:i386.
Preparing to unpack .../041-libgssrpc4t64_1.21.3-4_i386.deb ...
Unpacking libgssrpc4t64:i386 (1.21.3-4) ...
Selecting previously unselected package libkadm5clnt-mit12:i386.
Preparing to unpack .../042-libkadm5clnt-mit12_1.21.3-4_i386.deb ...
Unpacking libkadm5clnt-mit12:i386 (1.21.3-4) ...
Selecting previously unselected package libkdb5-10t64:i386.
Preparing to unpack .../043-libkdb5-10t64_1.21.3-4_i386.deb ...
Unpacking libkdb5-10t64:i386 (1.21.3-4) ...
Selecting previously unselected package libkadm5srv-mit12:i386.
Preparing to unpack .../044-libkadm5srv-mit12_1.21.3-4_i386.deb ...
Unpacking libkadm5srv-mit12:i386 (1.21.3-4) ...
Selecting previously unselected package krb5-multidev:i386.
Preparing to unpack .../045-krb5-multidev_1.21.3-4_i386.deb ...
Unpacking krb5-multidev:i386 (1.21.3-4) ...
Selecting previously unselected package libboost1.83-dev:i386.
Preparing to unpack .../046-libboost1.83-dev_1.83.0-4.1_i386.deb ...
Unpacking libboost1.83-dev:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-atomic1.83.0:i386.
Preparing to unpack .../047-libboost-atomic1.83.0_1.83.0-4.1_i386.deb ...
Unpacking libboost-atomic1.83.0:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-atomic1.83-dev:i386.
Preparing to unpack .../048-libboost-atomic1.83-dev_1.83.0-4.1_i386.deb ...
Unpacking libboost-atomic1.83-dev:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-chrono1.83.0t64:i386.
Preparing to unpack .../049-libboost-chrono1.83.0t64_1.83.0-4.1_i386.deb ...
Unpacking libboost-chrono1.83.0t64:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-chrono1.83-dev:i386.
Preparing to unpack .../050-libboost-chrono1.83-dev_1.83.0-4.1_i386.deb ...
Unpacking libboost-chrono1.83-dev:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-chrono-dev:i386.
Preparing to unpack .../051-libboost-chrono-dev_1.83.0.2+b2_i386.deb ...
Unpacking libboost-chrono-dev:i386 (1.83.0.2+b2) ...
Selecting previously unselected package libboost-filesystem1.83.0:i386.
Preparing to unpack .../052-libboost-filesystem1.83.0_1.83.0-4.1_i386.deb ...
Unpacking libboost-filesystem1.83.0:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-system1.83.0:i386.
Preparing to unpack .../053-libboost-system1.83.0_1.83.0-4.1_i386.deb ...
Unpacking libboost-system1.83.0:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-system1.83-dev:i386.
Preparing to unpack .../054-libboost-system1.83-dev_1.83.0-4.1_i386.deb ...
Unpacking libboost-system1.83-dev:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-filesystem1.83-dev:i386.
Preparing to unpack .../055-libboost-filesystem1.83-dev_1.83.0-4.1_i386.deb ...
Unpacking libboost-filesystem1.83-dev:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-filesystem-dev:i386.
Preparing to unpack .../056-libboost-filesystem-dev_1.83.0.2+b2_i386.deb ...
Unpacking libboost-filesystem-dev:i386 (1.83.0.2+b2) ...
Selecting previously unselected package libboost-regex1.83.0:i386.
Preparing to unpack .../057-libboost-regex1.83.0_1.83.0-4.1_i386.deb ...
Unpacking libboost-regex1.83.0:i386 (1.83.0-4.1) ...
Selecting previously unselected package libicu-dev:i386.
Preparing to unpack .../058-libicu-dev_72.1-6_i386.deb ...
Unpacking libicu-dev:i386 (72.1-6) ...
Selecting previously unselected package libboost-regex1.83-dev:i386.
Preparing to unpack .../059-libboost-regex1.83-dev_1.83.0-4.1_i386.deb ...
Unpacking libboost-regex1.83-dev:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-iostreams1.83-dev:i386.
Preparing to unpack .../060-libboost-iostreams1.83-dev_1.83.0-4.1_i386.deb ...
Unpacking libboost-iostreams1.83-dev:i386 (1.83.0-4.1) ...
Selecting previously unselected package libboost-iostreams-dev:i386.
Preparing to unpack .../061-libboost-iostreams-dev_1.83.0.2+b2_i386.deb ...
Unpacking libboost-iostreams-dev:i386 (1.83.0.2+b2) ...
Selecting previously unselected package libboost-system-dev:i386.
Preparing to unpack .../062-libboost-system-dev_1.83.0.2+b2_i386.deb ...
Unpacking libboost-system-dev:i386 (1.83.0.2+b2) ...
Selecting previously unselected package libbrotli1:i386.
Preparing to unpack .../063-libbrotli1_1.1.0-2+b6_i386.deb ...
Unpacking libbrotli1:i386 (1.1.0-2+b6) ...
Selecting previously unselected package libbrotli-dev:i386.
Preparing to unpack .../064-libbrotli-dev_1.1.0-2+b6_i386.deb ...
Unpacking libbrotli-dev:i386 (1.1.0-2+b6) ...
Selecting previously unselected package libbz2-dev:i386.
Preparing to unpack .../065-libbz2-dev_1.0.8-6_i386.deb ...
Unpacking libbz2-dev:i386 (1.0.8-6) ...
Selecting previously unselected package libidn2-0:i386.
Preparing to unpack .../066-libidn2-0_2.3.7-2+b1_i386.deb ...
Unpacking libidn2-0:i386 (2.3.7-2+b1) ...
Selecting previously unselected package libp11-kit0:i386.
Preparing to unpack .../067-libp11-kit0_0.25.5-3_i386.deb ...
Unpacking libp11-kit0:i386 (0.25.5-3) ...
Selecting previously unselected package libtasn1-6:i386.
Preparing to unpack .../068-libtasn1-6_4.20.0-2_i386.deb ...
Unpacking libtasn1-6:i386 (4.20.0-2) ...
Selecting previously unselected package libgnutls30t64:i386.
Preparing to unpack .../069-libgnutls30t64_3.8.9-2_i386.deb ...
Unpacking libgnutls30t64:i386 (3.8.9-2) ...
Selecting previously unselected package libsasl2-modules-db:i386.
Preparing to unpack .../070-libsasl2-modules-db_2.1.28+dfsg1-8+b1_i386.deb ...
Unpacking libsasl2-modules-db:i386 (2.1.28+dfsg1-8+b1) ...
Selecting previously unselected package libsasl2-2:i386.
Preparing to unpack .../071-libsasl2-2_2.1.28+dfsg1-8+b1_i386.deb ...
Unpacking libsasl2-2:i386 (2.1.28+dfsg1-8+b1) ...
Selecting previously unselected package libldap2:i386.
Preparing to unpack .../072-libldap2_2.6.9+dfsg-1_i386.deb ...
Unpacking libldap2:i386 (2.6.9+dfsg-1) ...
Selecting previously unselected package libnghttp2-14:i386.
Preparing to unpack .../073-libnghttp2-14_1.64.0-1_i386.deb ...
Unpacking libnghttp2-14:i386 (1.64.0-1) ...
Selecting previously unselected package libnghttp3-9:i386.
Preparing to unpack .../074-libnghttp3-9_1.6.0-2_i386.deb ...
Unpacking libnghttp3-9:i386 (1.6.0-2) ...
Selecting previously unselected package libngtcp2-16:i386.
Preparing to unpack .../075-libngtcp2-16_1.9.1-1_i386.deb ...
Unpacking libngtcp2-16:i386 (1.9.1-1) ...
Selecting previously unselected package libngtcp2-crypto-gnutls8:i386.
Preparing to unpack .../076-libngtcp2-crypto-gnutls8_1.9.1-1_i386.deb ...
Unpacking libngtcp2-crypto-gnutls8:i386 (1.9.1-1) ...
Selecting previously unselected package libpsl5t64:i386.
Preparing to unpack .../077-libpsl5t64_0.21.2-1.1+b1_i386.deb ...
Unpacking libpsl5t64:i386 (0.21.2-1.1+b1) ...
Selecting previously unselected package librtmp1:i386.
Preparing to unpack .../078-librtmp1_2.4+20151223.gitfa8646d.1-2+b5_i386.deb ...
Unpacking librtmp1:i386 (2.4+20151223.gitfa8646d.1-2+b5) ...
Selecting previously unselected package libssh2-1t64:i386.
Preparing to unpack .../079-libssh2-1t64_1.11.1-1_i386.deb ...
Unpacking libssh2-1t64:i386 (1.11.1-1) ...
Selecting previously unselected package libcurl3t64-gnutls:i386.
Preparing to unpack .../080-libcurl3t64-gnutls_8.12.1-2_i386.deb ...
Unpacking libcurl3t64-gnutls:i386 (8.12.1-2) ...
Selecting previously unselected package libevent-2.1-7t64:i386.
Preparing to unpack .../081-libevent-2.1-7t64_2.1.12-stable-10+b1_i386.deb ...
Unpacking libevent-2.1-7t64:i386 (2.1.12-stable-10+b1) ...
Selecting previously unselected package libunbound8:i386.
Preparing to unpack .../082-libunbound8_1.22.0-1+b1_i386.deb ...
Unpacking libunbound8:i386 (1.22.0-1+b1) ...
Selecting previously unselected package libgnutls-dane0t64:i386.
Preparing to unpack .../083-libgnutls-dane0t64_3.8.9-2_i386.deb ...
Unpacking libgnutls-dane0t64:i386 (3.8.9-2) ...
Selecting previously unselected package libgnutls-openssl27t64:i386.
Preparing to unpack .../084-libgnutls-openssl27t64_3.8.9-2_i386.deb ...
Unpacking libgnutls-openssl27t64:i386 (3.8.9-2) ...
Selecting previously unselected package libidn2-dev:i386.
Preparing to unpack .../085-libidn2-dev_2.3.7-2+b1_i386.deb ...
Unpacking libidn2-dev:i386 (2.3.7-2+b1) ...
Selecting previously unselected package libp11-kit-dev:i386.
Preparing to unpack .../086-libp11-kit-dev_0.25.5-3_i386.deb ...
Unpacking libp11-kit-dev:i386 (0.25.5-3) ...
Selecting previously unselected package libtasn1-6-dev:i386.
Preparing to unpack .../087-libtasn1-6-dev_4.20.0-2_i386.deb ...
Unpacking libtasn1-6-dev:i386 (4.20.0-2) ...
Selecting previously unselected package libgmpxx4ldbl:i386.
Preparing to unpack .../088-libgmpxx4ldbl_2%3a6.3.0+dfsg-3_i386.deb ...
Unpacking libgmpxx4ldbl:i386 (2:6.3.0+dfsg-3) ...
Selecting previously unselected package libgmp-dev:i386.
Preparing to unpack .../089-libgmp-dev_2%3a6.3.0+dfsg-3_i386.deb ...
Unpacking libgmp-dev:i386 (2:6.3.0+dfsg-3) ...
Selecting previously unselected package nettle-dev:i386.
Preparing to unpack .../090-nettle-dev_3.10-1+b1_i386.deb ...
Unpacking nettle-dev:i386 (3.10-1+b1) ...
Selecting previously unselected package libgnutls28-dev:i386.
Preparing to unpack .../091-libgnutls28-dev_3.8.9-2_i386.deb ...
Unpacking libgnutls28-dev:i386 (3.8.9-2) ...
Selecting previously unselected package libkrb5-dev:i386.
Preparing to unpack .../092-libkrb5-dev_1.21.3-4_i386.deb ...
Unpacking libkrb5-dev:i386 (1.21.3-4) ...
Selecting previously unselected package libldap-dev:i386.
Preparing to unpack .../093-libldap-dev_2.6.9+dfsg-1_i386.deb ...
Unpacking libldap-dev:i386 (2.6.9+dfsg-1) ...
Selecting previously unselected package libpkgconf3:i386.
Preparing to unpack .../094-libpkgconf3_1.8.1-4_i386.deb ...
Unpacking libpkgconf3:i386 (1.8.1-4) ...
Selecting previously unselected package pkgconf-bin.
Preparing to unpack .../095-pkgconf-bin_1.8.1-4_i386.deb ...
Unpacking pkgconf-bin (1.8.1-4) ...
Selecting previously unselected package pkgconf:i386.
Preparing to unpack .../096-pkgconf_1.8.1-4_i386.deb ...
Unpacking pkgconf:i386 (1.8.1-4) ...
Selecting previously unselected package libnghttp2-dev:i386.
Preparing to unpack .../097-libnghttp2-dev_1.64.0-1_i386.deb ...
Unpacking libnghttp2-dev:i386 (1.64.0-1) ...
Selecting previously unselected package libnghttp3-dev:i386.
Preparing to unpack .../098-libnghttp3-dev_1.6.0-2_i386.deb ...
Unpacking libnghttp3-dev:i386 (1.6.0-2) ...
Selecting previously unselected package libngtcp2-crypto-gnutls-dev:i386.
Preparing to unpack .../099-libngtcp2-crypto-gnutls-dev_1.9.1-1_i386.deb ...
Unpacking libngtcp2-crypto-gnutls-dev:i386 (1.9.1-1) ...
Selecting previously unselected package libngtcp2-dev:i386.
Preparing to unpack .../100-libngtcp2-dev_1.9.1-1_i386.deb ...
Unpacking libngtcp2-dev:i386 (1.9.1-1) ...
Selecting previously unselected package libpsl-dev:i386.
Preparing to unpack .../101-libpsl-dev_0.21.2-1.1+b1_i386.deb ...
Unpacking libpsl-dev:i386 (0.21.2-1.1+b1) ...
Selecting previously unselected package zlib1g-dev:i386.
Preparing to unpack .../102-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_i386.deb ...
Unpacking zlib1g-dev:i386 (1:1.3.dfsg+really1.3.1-1+b1) ...
Selecting previously unselected package librtmp-dev:i386.
Preparing to unpack .../103-librtmp-dev_2.4+20151223.gitfa8646d.1-2+b5_i386.deb ...
Unpacking librtmp-dev:i386 (2.4+20151223.gitfa8646d.1-2+b5) ...
Selecting previously unselected package libssl-dev:i386.
Preparing to unpack .../104-libssl-dev_3.4.1-1_i386.deb ...
Unpacking libssl-dev:i386 (3.4.1-1) ...
Selecting previously unselected package libssh2-1-dev:i386.
Preparing to unpack .../105-libssh2-1-dev_1.11.1-1_i386.deb ...
Unpacking libssh2-1-dev:i386 (1.11.1-1) ...
Selecting previously unselected package libzstd-dev:i386.
Preparing to unpack .../106-libzstd-dev_1.5.6+dfsg-2_i386.deb ...
Unpacking libzstd-dev:i386 (1.5.6+dfsg-2) ...
Selecting previously unselected package libcurl4-gnutls-dev:i386.
Preparing to unpack .../107-libcurl4-gnutls-dev_8.12.1-2_i386.deb ...
Unpacking libcurl4-gnutls-dev:i386 (8.12.1-2) ...
Selecting previously unselected package libdeflate0:i386.
Preparing to unpack .../108-libdeflate0_1.23-1+b1_i386.deb ...
Unpacking libdeflate0:i386 (1.23-1+b1) ...
Selecting previously unselected package libdeflate-dev:i386.
Preparing to unpack .../109-libdeflate-dev_1.23-1+b1_i386.deb ...
Unpacking libdeflate-dev:i386 (1.23-1+b1) ...
Selecting previously unselected package libhtscodecs2:i386.
Preparing to unpack .../110-libhtscodecs2_1.6.1-2_i386.deb ...
Unpacking libhtscodecs2:i386 (1.6.1-2) ...
Selecting previously unselected package libhts3t64:i386.
Preparing to unpack .../111-libhts3t64_1.21+ds-1_i386.deb ...
Unpacking libhts3t64:i386 (1.21+ds-1) ...
Selecting previously unselected package liblzma-dev:i386.
Preparing to unpack .../112-liblzma-dev_5.6.3-1+b1_i386.deb ...
Unpacking liblzma-dev:i386 (5.6.3-1+b1) ...
Selecting previously unselected package libhts-dev:i386.
Preparing to unpack .../113-libhts-dev_1.21+ds-1_i386.deb ...
Unpacking libhts-dev:i386 (1.21+ds-1) ...
Selecting previously unselected package libjs-d3-format.
Preparing to unpack .../114-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ...
Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ...
Selecting previously unselected package libjs-jquery.
Preparing to unpack .../115-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ...
Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ...
Selecting previously unselected package libjs-jquery-datatables.
Preparing to unpack .../116-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ...
Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ...
Selecting previously unselected package libjs-jquery-datatables-extensions.
Preparing to unpack .../117-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ...
Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ...
Selecting previously unselected package libncurses6:i386.
Preparing to unpack .../118-libncurses6_6.5+20250125-2_i386.deb ...
Unpacking libncurses6:i386 (6.5+20250125-2) ...
Selecting previously unselected package libncurses-dev:i386.
Preparing to unpack .../119-libncurses-dev_6.5+20250125-2_i386.deb ...
Unpacking libncurses-dev:i386 (6.5+20250125-2) ...
Selecting previously unselected package node-commander.
Preparing to unpack .../120-node-commander_9.4.1-1_all.deb ...
Unpacking node-commander (9.4.1-1) ...
Selecting previously unselected package node-d3-array.
Preparing to unpack .../121-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ...
Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ...
Selecting previously unselected package node-d3-axis.
Preparing to unpack .../122-node-d3-axis_1.0.12+~1.0.16-1_all.deb ...
Unpacking node-d3-axis (1.0.12+~1.0.16-1) ...
Selecting previously unselected package node-d3-dispatch.
Preparing to unpack .../123-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ...
Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ...
Selecting previously unselected package node-d3-selection.
Preparing to unpack .../124-node-d3-selection_1.4.1+~1.4.3-1_all.deb ...
Unpacking node-d3-selection (1.4.1+~1.4.3-1) ...
Selecting previously unselected package node-d3-drag.
Preparing to unpack .../125-node-d3-drag_1.2.5+~1.2.5-1_all.deb ...
Unpacking node-d3-drag (1.2.5+~1.2.5-1) ...
Selecting previously unselected package node-d3-color.
Preparing to unpack .../126-node-d3-color_1.4.1+~1.4.2-1_all.deb ...
Unpacking node-d3-color (1.4.1+~1.4.2-1) ...
Selecting previously unselected package node-d3-interpolate.
Preparing to unpack .../127-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ...
Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ...
Selecting previously unselected package node-d3-ease.
Preparing to unpack .../128-node-d3-ease_1.0.7+~1.0.11-1_all.deb ...
Unpacking node-d3-ease (1.0.7+~1.0.11-1) ...
Selecting previously unselected package node-d3-timer.
Preparing to unpack .../129-node-d3-timer_1.0.10+~1.0.10-1_all.deb ...
Unpacking node-d3-timer (1.0.10+~1.0.10-1) ...
Selecting previously unselected package node-d3-transition.
Preparing to unpack .../130-node-d3-transition_1.3.2+~1.3.2-1_all.deb ...
Unpacking node-d3-transition (1.3.2+~1.3.2-1) ...
Selecting previously unselected package node-d3-brush.
Preparing to unpack .../131-node-d3-brush_1.1.6+~1.1.5-1_all.deb ...
Unpacking node-d3-brush (1.1.6+~1.1.5-1) ...
Selecting previously unselected package node-d3-path.
Preparing to unpack .../132-node-d3-path_1.0.9+~1.0.9-1_all.deb ...
Unpacking node-d3-path (1.0.9+~1.0.9-1) ...
Selecting previously unselected package node-d3-chord.
Preparing to unpack .../133-node-d3-chord_1.0.6+~1.0.11-1_all.deb ...
Unpacking node-d3-chord (1.0.6+~1.0.11-1) ...
Selecting previously unselected package node-d3-collection.
Preparing to unpack .../134-node-d3-collection_1.0.7+~1.0.10-1_all.deb ...
Unpacking node-d3-collection (1.0.7+~1.0.10-1) ...
Selecting previously unselected package node-d3-contour.
Preparing to unpack .../135-node-d3-contour_1.3.2+~1.3.3-1_all.deb ...
Unpacking node-d3-contour (1.3.2+~1.3.3-1) ...
Selecting previously unselected package node-safe-buffer.
Preparing to unpack .../136-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ...
Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ...
Selecting previously unselected package node-iconv-lite.
Preparing to unpack .../137-node-iconv-lite_0.6.3-3_all.deb ...
Unpacking node-iconv-lite (0.6.3-3) ...
Selecting previously unselected package node-d3-queue.
Preparing to unpack .../138-node-d3-queue_3.0.7-13_all.deb ...
Unpacking node-d3-queue (3.0.7-13) ...
Selecting previously unselected package node-rw.
Preparing to unpack .../139-node-rw_1.3.3-5_all.deb ...
Unpacking node-rw (1.3.3-5) ...
Selecting previously unselected package node-d3-dsv.
Preparing to unpack .../140-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ...
Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ...
Selecting previously unselected package node-d3-fetch.
Preparing to unpack .../141-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ...
Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ...
Selecting previously unselected package node-d3-quadtree.
Preparing to unpack .../142-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ...
Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ...
Selecting previously unselected package node-d3-force.
Preparing to unpack .../143-node-d3-force_2.1.1+~2.1.4-1_all.deb ...
Unpacking node-d3-force (2.1.1+~2.1.4-1) ...
Selecting previously unselected package node-d3-format.
Preparing to unpack .../144-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ...
Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ...
Selecting previously unselected package node-d3-geo.
Preparing to unpack .../145-node-d3-geo_1.12.1+~1.12.4-1_all.deb ...
Unpacking node-d3-geo (1.12.1+~1.12.4-1) ...
Selecting previously unselected package node-d3-hierarchy.
Preparing to unpack .../146-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ...
Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ...
Selecting previously unselected package node-d3-polygon.
Preparing to unpack .../147-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ...
Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ...
Selecting previously unselected package node-d3-random.
Preparing to unpack .../148-node-d3-random_1.1.2+~1.1.3-1_all.deb ...
Unpacking node-d3-random (1.1.2+~1.1.3-1) ...
Selecting previously unselected package node-d3-time.
Preparing to unpack .../149-node-d3-time_1.1.0+~1.1.1-1_all.deb ...
Unpacking node-d3-time (1.1.0+~1.1.1-1) ...
Selecting previously unselected package node-d3-time-format.
Preparing to unpack .../150-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ...
Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ...
Selecting previously unselected package node-d3-scale.
Preparing to unpack .../151-node-d3-scale_2.2.2+~2.2.6-1_all.deb ...
Unpacking node-d3-scale (2.2.2+~2.2.6-1) ...
Selecting previously unselected package node-d3-scale-chromatic.
Preparing to unpack .../152-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ...
Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ...
Selecting previously unselected package node-d3-shape.
Preparing to unpack .../153-node-d3-shape_1.3.7+~1.3.8-1_all.deb ...
Unpacking node-d3-shape (1.3.7+~1.3.8-1) ...
Selecting previously unselected package node-d3-voronoi.
Preparing to unpack .../154-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ...
Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ...
Selecting previously unselected package node-d3-zoom.
Preparing to unpack .../155-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ...
Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ...
Selecting previously unselected package node-d3.
Preparing to unpack .../156-node-d3_5.16.0+~cs5.28.10-2_all.deb ...
Unpacking node-d3 (5.16.0+~cs5.28.10-2) ...
Selecting previously unselected package node-normalize.css.
Preparing to unpack .../157-node-normalize.css_8.0.1-5_all.deb ...
Unpacking node-normalize.css (8.0.1-5) ...
Setting up libhtscodecs2:i386 (1.6.1-2) ...
Setting up media-types (10.1.0) ...
Setting up libpipeline1:i386 (1.5.8-1) ...
Setting up node-d3-timer (1.0.10+~1.0.10-1) ...
Setting up node-d3-color (1.4.1+~1.4.2-1) ...
Setting up libkeyutils1:i386 (1.6.3-4) ...
Setting up libboost1.83-dev:i386 (1.83.0-4.1) ...
Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ...
Setting up node-d3-queue (3.0.7-13) ...
Setting up libicu72:i386 (72.1-6) ...
Setting up libzstd-dev:i386 (1.5.6+dfsg-2) ...
Setting up bsdextrautils (2.40.4-3) ...
Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ...
Setting up node-d3-ease (1.0.7+~1.0.11-1) ...
Setting up libmagic-mgc (1:5.45-3+b1) ...
Setting up libarchive-zip-perl (1.68-1) ...
Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ...
Setting up libboost-regex1.83.0:i386 (1.83.0-4.1) ...
Setting up libdebhelper-perl (13.24.1) ...
Setting up libbrotli1:i386 (1.1.0-2+b6) ...
Setting up libboost-system1.83.0:i386 (1.83.0-4.1) ...
Setting up libmagic1t64:i386 (1:5.45-3+b1) ...
Setting up libnghttp2-14:i386 (1.64.0-1) ...
Setting up libdeflate0:i386 (1.23-1+b1) ...
Setting up gettext-base (0.23.1-1) ...
Setting up m4 (1.4.19-5) ...
Setting up libevent-2.1-7t64:i386 (2.1.12-stable-10+b1) ...
Setting up node-d3-selection (1.4.1+~1.4.3-1) ...
Setting up libcom-err2:i386 (1.47.2-1) ...
Setting up node-d3-axis (1.0.12+~1.0.16-1) ...
Setting up file (1:5.45-3+b1) ...
Setting up libboost-filesystem1.83.0:i386 (1.83.0-4.1) ...
Setting up node-d3-path (1.0.9+~1.0.9-1) ...
Setting up libelf1t64:i386 (0.192-4) ...
Setting up libkrb5support0:i386 (1.21.3-4) ...
Setting up libsasl2-modules-db:i386 (2.1.28+dfsg1-8+b1) ...
Setting up tzdata (2025a-2) ...

Current default time zone: 'Etc/UTC'
Local time is now:      Sat Feb 22 13:11:34 UTC 2025.
Universal Time is now:  Sat Feb 22 13:11:34 UTC 2025.
Run 'dpkg-reconfigure tzdata' if you wish to change it.

Setting up libboost-atomic1.83.0:i386 (1.83.0-4.1) ...
Setting up autotools-dev (20220109.1) ...
Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ...
Setting up node-rw (1.3.3-5) ...
Setting up libunbound8:i386 (1.22.0-1+b1) ...
Setting up libpkgconf3:i386 (1.8.1-4) ...
Setting up node-d3-polygon (1.0.6+~1.0.8-1) ...
Setting up libgmpxx4ldbl:i386 (2:6.3.0+dfsg-3) ...
Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ...
Setting up libboost-chrono1.83.0t64:i386 (1.83.0-4.1) ...
Setting up libncurses6:i386 (6.5+20250125-2) ...
Setting up comerr-dev:i386 (2.1-1.47.2-1) ...
Setting up libunistring5:i386 (1.3-1) ...
Setting up libssl-dev:i386 (3.4.1-1) ...
Setting up node-d3-collection (1.0.7+~1.0.10-1) ...
Setting up autopoint (0.23.1-1) ...
Setting up icu-devtools (72.1-6) ...
Setting up pkgconf-bin (1.8.1-4) ...
Setting up libk5crypto3:i386 (1.21.3-4) ...
Setting up libsasl2-2:i386 (2.1.28+dfsg1-8+b1) ...
Setting up libboost-atomic1.83-dev:i386 (1.83.0-4.1) ...
Setting up autoconf (2.72-3) ...
Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ...
Setting up libnghttp3-9:i386 (1.6.0-2) ...
Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ...
Setting up node-d3-time (1.1.0+~1.1.1-1) ...
Setting up libnghttp3-dev:i386 (1.6.0-2) ...
Setting up liblzma-dev:i386 (5.6.3-1+b1) ...
Setting up zlib1g-dev:i386 (1:1.3.dfsg+really1.3.1-1+b1) ...
Setting up node-commander (9.4.1-1) ...
Setting up libffi8:i386 (3.4.7-1) ...
Setting up dwz (0.15-1+b1) ...
Setting up node-d3-array (3.2.0+~cs5.0.6-2) ...
Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ...
Setting up sensible-utils (0.0.24) ...
Setting up libuchardet0:i386 (0.0.8-1+b2) ...
Setting up libtasn1-6:i386 (4.20.0-2) ...
Setting up netbase (6.4) ...
Setting up libngtcp2-16:i386 (1.9.1-1) ...
Setting up libkrb5-3:i386 (1.21.3-4) ...
Setting up libboost-system1.83-dev:i386 (1.83.0-4.1) ...
Setting up libssh2-1t64:i386 (1.11.1-1) ...
Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ...
Setting up node-d3-geo (1.12.1+~1.12.4-1) ...
Setting up libtasn1-6-dev:i386 (4.20.0-2) ...
Setting up libdeflate-dev:i386 (1.23-1+b1) ...
Setting up node-normalize.css (8.0.1-5) ...
Setting up node-d3-transition (1.3.2+~1.3.2-1) ...
Setting up readline-common (8.2-6) ...
Setting up libicu-dev:i386 (72.1-6) ...
Setting up libxml2:i386 (2.12.7+dfsg+really2.9.14-0.2+b1) ...
Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ...
Setting up libldap2:i386 (2.6.9+dfsg-1) ...
Setting up liblocale-gettext-perl (1.07-7+b1) ...
Setting up libbrotli-dev:i386 (1.1.0-2+b6) ...
Setting up node-d3-random (1.1.2+~1.1.3-1) ...
Setting up libbz2-dev:i386 (1.0.8-6) ...
Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ...
Setting up automake (1:1.17-3) ...
update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode
Setting up libfile-stripnondeterminism-perl (1.14.1-2) ...
Setting up libncurses-dev:i386 (6.5+20250125-2) ...
Setting up gettext (0.23.1-1) ...
Setting up node-d3-format (1:1.4.5+~1.4.2-2) ...
Setting up libgmp-dev:i386 (2:6.3.0+dfsg-3) ...
Setting up libboost-chrono1.83-dev:i386 (1.83.0-4.1) ...
Setting up nettle-dev:i386 (3.10-1+b1) ...
Setting up libtool (2.5.4-3) ...
Setting up libboost-chrono-dev:i386 (1.83.0.2+b2) ...
Setting up node-d3-time-format (2.3.0+~2.3.1-1) ...
Setting up libboost-system-dev:i386 (1.83.0.2+b2) ...
Setting up node-d3-chord (1.0.6+~1.0.11-1) ...
Setting up libidn2-0:i386 (2.3.7-2+b1) ...
Setting up libboost-filesystem1.83-dev:i386 (1.83.0-4.1) ...
Setting up libngtcp2-dev:i386 (1.9.1-1) ...
Setting up node-d3-shape (1.3.7+~1.3.8-1) ...
Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ...
Setting up pkgconf:i386 (1.8.1-4) ...
Setting up intltool-debian (0.35.0+20060710.6) ...
Setting up help2man (1.49.3) ...
Setting up dh-autoreconf (20) ...
Setting up node-d3-drag (1.2.5+~1.2.5-1) ...
Setting up node-iconv-lite (0.6.3-3) ...
Setting up libldap-dev:i386 (2.6.9+dfsg-1) ...
Setting up node-d3-scale (2.2.2+~2.2.6-1) ...
Setting up libp11-kit0:i386 (0.25.5-3) ...
Setting up libgssapi-krb5-2:i386 (1.21.3-4) ...
Setting up libboost-regex1.83-dev:i386 (1.83.0-4.1) ...
Setting up libssh2-1-dev:i386 (1.11.1-1) ...
Setting up libidn2-dev:i386 (2.3.7-2+b1) ...
Setting up node-d3-force (2.1.1+~2.1.4-1) ...
Setting up node-d3-contour (1.3.2+~1.3.3-1) ...
Setting up libreadline8t64:i386 (8.2-6) ...
Setting up dh-strip-nondeterminism (1.14.1-2) ...
Setting up node-d3-brush (1.1.6+~1.1.5-1) ...
Setting up groff-base (1.23.0-7) ...
Setting up node-d3-dsv (1.2.0+~1.2.3-1) ...
Setting up libpython3.13-stdlib:i386 (3.13.2-1) ...
Setting up libboost-filesystem-dev:i386 (1.83.0.2+b2) ...
Setting up libp11-kit-dev:i386 (0.25.5-3) ...
Setting up libpython3-stdlib:i386 (3.13.1-2) ...
Setting up libgnutls30t64:i386 (3.8.9-2) ...
Setting up libgnutls-openssl27t64:i386 (3.8.9-2) ...
Setting up libnghttp2-dev:i386 (1.64.0-1) ...
Setting up python3.13 (3.13.2-1) ...
Setting up libboost-iostreams1.83-dev:i386 (1.83.0-4.1) ...
Setting up node-d3-zoom (1.8.3+~1.8.4-1) ...
Setting up po-debconf (1.0.21+nmu1) ...
Setting up libpsl5t64:i386 (0.21.2-1.1+b1) ...
Setting up node-d3-fetch (1.2.0+~1.2.2-1) ...
Setting up python3 (3.13.1-2) ...
Setting up libboost-iostreams-dev:i386 (1.83.0.2+b2) ...
Setting up node-d3 (5.16.0+~cs5.28.10-2) ...
Setting up man-db (2.13.0-1) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libpsl-dev:i386 (0.21.2-1.1+b1) ...
Setting up libgnutls-dane0t64:i386 (3.8.9-2) ...
Setting up librtmp1:i386 (2.4+20151223.gitfa8646d.1-2+b5) ...
Setting up libgssrpc4t64:i386 (1.21.3-4) ...
Setting up libngtcp2-crypto-gnutls8:i386 (1.9.1-1) ...
Setting up libkadm5clnt-mit12:i386 (1.21.3-4) ...
Setting up libgnutls28-dev:i386 (3.8.9-2) ...
Setting up libkdb5-10t64:i386 (1.21.3-4) ...
Setting up libcurl3t64-gnutls:i386 (8.12.1-2) ...
Setting up debhelper (13.24.1) ...
Setting up libngtcp2-crypto-gnutls-dev:i386 (1.9.1-1) ...
Setting up librtmp-dev:i386 (2.4+20151223.gitfa8646d.1-2+b5) ...
Setting up libkadm5srv-mit12:i386 (1.21.3-4) ...
Setting up libhts3t64:i386 (1.21+ds-1) ...
Setting up krb5-multidev:i386 (1.21.3-4) ...
Setting up libkrb5-dev:i386 (1.21.3-4) ...
Setting up libcurl4-gnutls-dev:i386 (8.12.1-2) ...
Setting up libhts-dev:i386 (1.21+ds-1) ...
Processing triggers for libc-bin (2.40-7) ...
Reading package lists...
Building dependency tree...
Reading state information...
Reading extended state information...
Initializing package states...
Writing extended state information...
Building tag database...
 -> Finished parsing the build-deps
I: Building the package
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/A99_set_merged_usr starting
Not re-configuring usrmerge for trixie
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/A99_set_merged_usr finished
hostname: Name or service not known
I: Running cd /build/reproducible-path/ataqv-1.3.1+ds/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S  > ../ataqv_1.3.1+ds-2_source.changes
dpkg-buildpackage: info: source package ataqv
dpkg-buildpackage: info: source version 1.3.1+ds-2
dpkg-buildpackage: info: source distribution unstable
dpkg-buildpackage: info: source changed by Lance Lin <lq27267@gmail.com>
 dpkg-source --before-build .
dpkg-buildpackage: info: host architecture i386
 debian/rules clean
dh clean
   dh_auto_clean
	make -j10 clean
make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
   dh_clean
 debian/rules binary
dh binary
   dh_update_autotools_config
   dh_autoreconf
   debian/rules override_dh_auto_configure
make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js
cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js
cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css
cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css
cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css
cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css
cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/
cp -s /usr/share/javascript/jquery/jquery.min.js \
	/usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \
	/usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \
	/usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \
	src/web/js/
rm -f src/web/js/datatables.min.js
make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
   debian/rules override_dh_auto_build
make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
dh_auto_build -- all testing/run_ataqv_tests
	make -j10 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests
make[2]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/ataqv.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/ataqv.cpp
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Features.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Features.cpp
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/HTS.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/HTS.cpp
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/IO.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/IO.cpp
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Metrics.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Peaks.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Peaks.cpp
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Utils.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Utils.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/run_ataqv_tests.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/run_ataqv_tests.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/test_features.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/test_hts.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp
In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp:1:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=]
  171 |     REQUIRE_THROWS_AS(collection.add(f), std::out_of_range);
      |                                               ^~~~~~~~~~~~
In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp:3:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=]
  200 |     REQUIRE_THROWS_AS(record_to_string(header, record), HTSException);
      |                                                         ^~~~~~~~~~~~
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/test_io.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_io.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/test_metrics.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/test_peaks.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp
In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp:1:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=]
  181 |     REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range);
      |                                            ^~~~~~~~~~~~
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/test_utils.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_utils.cpp
In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:3:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  173 |         REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                        ^~~~~~~~~~~~~
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  178 |         REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                        ^~~~~~~~~~~~~
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  249 |     REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                    ^~~~~~~~~~~~~
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=]
  259 |     REQUIRE_THROWS_AS(collector.load_alignments(), FileException);
      |                                                    ^~~~~~~~~~~~~
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/Features.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Features.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/HTS.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/HTS.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/IO.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/IO.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/Metrics.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/Peaks.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Peaks.cpp
g++  -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX   -o testing/Utils.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Utils.cpp
In file included from /usr/include/c++/14/bits/stl_pair.h:61,
                 from /usr/include/c++/14/tuple:38,
                 from /usr/include/c++/14/mutex:40,
                 from /usr/include/c++/14/future:40,
                 from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp:10:
In function ‘std::_Require<std::__not_<std::__is_tuple_like<_Tp> >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::value_type& nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::operator=(nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2554:13,
    inlined from ‘static void nlohmann::detail::external_constructor<nlohmann::detail::value_t::number_float>::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:277:15,
    inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if<std::is_floating_point<FloatType>::value, int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:545:59,
    inlined from ‘decltype ((nlohmann::detail::to_json(j, forward<T>(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:837:23,
    inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:852:20,
    inlined from ‘static void nlohmann::adl_serializer< <template-parameter-1-1>, <template-parameter-1-2> >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const long double&; <template-parameter-1-1> = long double; <template-parameter-1-2> = void]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:942:28,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::basic_json(CompatibleType&&) [with CompatibleType = const long double&; U = long double; typename std::enable_if<((((! std::is_base_of<std::basic_istream<char>, U>::value) && (! std::is_same<U, nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer> >::value)) && (! nlohmann::detail::is_basic_json_nested_type<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value)) && nlohmann::detail::has_to_json<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value), int>::type <anonymous> = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2009:35,
    inlined from ‘void std::_Construct(_Tp*, _Args&& ...) [with _Tp = nlohmann::basic_json<>; _Args = {const long double&}]’ at /usr/include/c++/14/bits/stl_construct.h:119:7,
    inlined from ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/14/bits/stl_uninitialized.h:120:21,
    inlined from ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, std::vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*; bool _TrivialValueTypes = false]’ at /usr/include/c++/14/bits/stl_uninitialized.h:137:32,
    inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/14/bits/stl_uninitialized.h:185:15,
    inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*; _Tp = nlohmann::basic_json<>]’ at /usr/include/c++/14/bits/stl_uninitialized.h:373:37,
    inlined from ‘void std::vector<_Tp, _Alloc>::_M_range_initialize(_ForwardIterator, _ForwardIterator, std::forward_iterator_tag) [with _ForwardIterator = __gnu_cxx::__normal_iterator<const long double*, std::vector<long double> >; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator<nlohmann::basic_json<> >]’ at /usr/include/c++/14/bits/stl_vector.h:1697:33,
    inlined from ‘std::vector<_Tp, _Alloc>::vector(_InputIterator, _InputIterator, const allocator_type&) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, std::vector<long double> >; <template-parameter-2-2> = void; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator<nlohmann::basic_json<> >]’ at /usr/include/c++/14/bits/stl_vector.h:711:23,
    inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::vector<nlohmann::basic_json<>, std::allocator<nlohmann::basic_json<> > >; _Args = {__gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >, __gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >}; _Tp = std::vector<nlohmann::basic_json<>, std::allocator<nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/new_allocator.h:191:4,
    inlined from ‘static T* nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::create(Args&& ...) [with T = std::vector<nlohmann::basic_json<>, std::allocator<nlohmann::basic_json<> > >; Args = {__gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >, __gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:1634:24,
    inlined from ‘static void nlohmann::detail::external_constructor<nlohmann::detail::value_t::array>::construct(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector<long double>; typename std::enable_if<(! std::is_same<CompatibleArrayType, typename BasicJsonType::array_t>::value), int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:332:77,
    inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector<long double>; typename std::enable_if<(is_compatible_array_type<BasicJsonType, CompatibleArrayType>::value || std::is_same<typename BasicJsonType::array_t, CompatibleArrayType>::value), int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:581:52,
    inlined from ‘decltype ((nlohmann::detail::to_json(j, forward<T>(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector<long double>&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:837:23,
    inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector<long double>&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:852:20,
    inlined from ‘static void nlohmann::adl_serializer< <template-parameter-1-1>, <template-parameter-1-2> >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const std::vector<long double>&; <template-parameter-1-1> = std::vector<long double>; <template-parameter-1-2> = void]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:942:28,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::basic_json(CompatibleType&&) [with CompatibleType = const std::vector<long double>&; U = std::vector<long double>; typename std::enable_if<((((! std::is_base_of<std::basic_istream<char>, U>::value) && (! std::is_same<U, nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer> >::value)) && (! nlohmann::detail::is_basic_json_nested_type<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value)) && nlohmann::detail::has_to_json<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value), int>::type <anonymous> = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2009:35,
    inlined from ‘constexpr std::pair<_T1, _T2>::pair(const std::pair<_U1, _U2>&) [with _U1 = const std::__cxx11::basic_string<char>; _U2 = std::vector<long double>; typename std::enable_if<(std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ConstructiblePair<_U1, _U2>() && std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ImplicitlyConvertiblePair<_U1, _U2>()), bool>::type <anonymous> = true; _T1 = const std::__cxx11::basic_string<char>; _T2 = nlohmann::basic_json<>]’ at /usr/include/c++/14/bits/stl_pair.h:780:22,
    inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Tp = std::_Rb_tree_node<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/new_allocator.h:191:4,
    inlined from ‘static void std::allocator_traits<std::allocator<_Tp1> >::construct(allocator_type&, _Up*, _Args&& ...) [with _Up = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Tp = std::_Rb_tree_node<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/alloc_traits.h:575:17,
    inlined from ‘void std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_construct_node(_Link_type, _Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:593:32,
    inlined from ‘std::_Rb_tree_node<_Val>* std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_create_node(_Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:610:21,
    inlined from ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_Auto_node::_Auto_node(std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>&, _Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:1633:32,
    inlined from ‘std::pair<std::_Rb_tree_iterator<_Val>, bool> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_unique(_Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:2430:13,
    inlined from ‘std::__enable_if_t<((bool)(! std::is_same<_Val, typename std::iterator_traits<_InputIterator>::value_type>::value))> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_insert_range_unique(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char>, std::vector<long double> > >; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:1108:23,
    inlined from ‘std::map<_Key, _Tp, _Compare, _Alloc>::map(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char>, std::vector<long double> > >; _Key = std::__cxx11::basic_string<char>; _Tp = nlohmann::basic_json<>; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_map.h:287:31,
    inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::map<std::__cxx11::basic_string<char>, nlohmann::basic_json<>, std::less<std::__cxx11::basic_string<char> >, std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > > >; _Args = {std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >, std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >}; _Tp = std::map<std::__cxx11::basic_string<char>, nlohmann::basic_json<>, std::less<std::__cxx11::basic_string<char> >, std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > > >]’ at /usr/include/c++/14/bits/new_allocator.h:191:4,
    inlined from ‘static T* nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::create(Args&& ...) [with T = std::map<std::__cxx11::basic_string<char>, nlohmann::basic_json<>, std::less<std::__cxx11::basic_string<char> >, std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > > >; Args = {std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >, std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:1634:24,
    inlined from ‘static void nlohmann::detail::external_constructor<nlohmann::detail::value_t::object>::construct(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; typename std::enable_if<(! std::is_same<CompatibleObjectType, typename BasicJsonType::object_t>::value), int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:358:79,
    inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; typename std::enable_if<is_compatible_object_type<BasicJsonType, CompatibleObjectType>::value, int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:590:53,
    inlined from ‘decltype ((nlohmann::detail::to_json(j, forward<T>(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:837:23,
    inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:852:20,
    inlined from ‘static void nlohmann::adl_serializer< <template-parameter-1-1>, <template-parameter-1-2> >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&; <template-parameter-1-1> = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; <template-parameter-1-2> = void]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:942:28,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::basic_json(CompatibleType&&) [with CompatibleType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&; U = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; typename std::enable_if<((((! std::is_base_of<std::basic_istream<char>, U>::value) && (! std::is_same<U, nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer> >::value)) && (! nlohmann::detail::is_basic_json_nested_type<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value)) && nlohmann::detail::has_to_json<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value), int>::type <anonymous> = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2009:35,
    inlined from ‘nlohmann::json Metrics::to_json()’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp:1570:1:
/usr/include/c++/14/bits/move.h:235:7: warning: ‘<unnamed>.nlohmann::basic_json<std::map, std::vector, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized]
  235 |       __a = _GLIBCXX_MOVE(__b);
      |       ^~~
In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.hpp:16,
                 from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp:21:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:277:15: note: ‘<anonymous>’ declared here
  277 |             j = BasicJsonType{};
      |             ~~^~~~~~~~~~~~~~~~~
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread
In file included from /usr/include/c++/14/bits/stl_pair.h:61,
                 from /usr/include/c++/14/tuple:38,
                 from /usr/include/c++/14/mutex:40,
                 from /usr/include/c++/14/future:40,
                 from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp:10:
In function ‘std::_Require<std::__not_<std::__is_tuple_like<_Tp> >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::value_type& nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::operator=(nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2554:13,
    inlined from ‘static void nlohmann::detail::external_constructor<nlohmann::detail::value_t::number_float>::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:277:15,
    inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if<std::is_floating_point<FloatType>::value, int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:545:59,
    inlined from ‘decltype ((nlohmann::detail::to_json(j, forward<T>(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:837:23,
    inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:852:20,
    inlined from ‘static void nlohmann::adl_serializer< <template-parameter-1-1>, <template-parameter-1-2> >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const long double&; <template-parameter-1-1> = long double; <template-parameter-1-2> = void]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:942:28,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::basic_json(CompatibleType&&) [with CompatibleType = const long double&; U = long double; typename std::enable_if<((((! std::is_base_of<std::basic_istream<char>, U>::value) && (! std::is_same<U, nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer> >::value)) && (! nlohmann::detail::is_basic_json_nested_type<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value)) && nlohmann::detail::has_to_json<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value), int>::type <anonymous> = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2009:35,
    inlined from ‘void std::_Construct(_Tp*, _Args&& ...) [with _Tp = nlohmann::basic_json<>; _Args = {const long double&}]’ at /usr/include/c++/14/bits/stl_construct.h:119:7,
    inlined from ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/14/bits/stl_uninitialized.h:120:21,
    inlined from ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, std::vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*; bool _TrivialValueTypes = false]’ at /usr/include/c++/14/bits/stl_uninitialized.h:137:32,
    inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/14/bits/stl_uninitialized.h:185:15,
    inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, vector<long double> >; _ForwardIterator = nlohmann::basic_json<>*; _Tp = nlohmann::basic_json<>]’ at /usr/include/c++/14/bits/stl_uninitialized.h:373:37,
    inlined from ‘void std::vector<_Tp, _Alloc>::_M_range_initialize(_ForwardIterator, _ForwardIterator, std::forward_iterator_tag) [with _ForwardIterator = __gnu_cxx::__normal_iterator<const long double*, std::vector<long double> >; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator<nlohmann::basic_json<> >]’ at /usr/include/c++/14/bits/stl_vector.h:1697:33,
    inlined from ‘std::vector<_Tp, _Alloc>::vector(_InputIterator, _InputIterator, const allocator_type&) [with _InputIterator = __gnu_cxx::__normal_iterator<const long double*, std::vector<long double> >; <template-parameter-2-2> = void; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator<nlohmann::basic_json<> >]’ at /usr/include/c++/14/bits/stl_vector.h:711:23,
    inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::vector<nlohmann::basic_json<>, std::allocator<nlohmann::basic_json<> > >; _Args = {__gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >, __gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >}; _Tp = std::vector<nlohmann::basic_json<>, std::allocator<nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/new_allocator.h:191:4,
    inlined from ‘static T* nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::create(Args&& ...) [with T = std::vector<nlohmann::basic_json<>, std::allocator<nlohmann::basic_json<> > >; Args = {__gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >, __gnu_cxx::__normal_iterator<const long double*, std::vector<long double, std::allocator<long double> > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:1634:24,
    inlined from ‘static void nlohmann::detail::external_constructor<nlohmann::detail::value_t::array>::construct(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector<long double>; typename std::enable_if<(! std::is_same<CompatibleArrayType, typename BasicJsonType::array_t>::value), int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:332:77,
    inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector<long double>; typename std::enable_if<(is_compatible_array_type<BasicJsonType, CompatibleArrayType>::value || std::is_same<typename BasicJsonType::array_t, CompatibleArrayType>::value), int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:581:52,
    inlined from ‘decltype ((nlohmann::detail::to_json(j, forward<T>(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector<long double>&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:837:23,
    inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector<long double>&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:852:20,
    inlined from ‘static void nlohmann::adl_serializer< <template-parameter-1-1>, <template-parameter-1-2> >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const std::vector<long double>&; <template-parameter-1-1> = std::vector<long double>; <template-parameter-1-2> = void]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:942:28,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::basic_json(CompatibleType&&) [with CompatibleType = const std::vector<long double>&; U = std::vector<long double>; typename std::enable_if<((((! std::is_base_of<std::basic_istream<char>, U>::value) && (! std::is_same<U, nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer> >::value)) && (! nlohmann::detail::is_basic_json_nested_type<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value)) && nlohmann::detail::has_to_json<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value), int>::type <anonymous> = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2009:35,
    inlined from ‘constexpr std::pair<_T1, _T2>::pair(const std::pair<_U1, _U2>&) [with _U1 = const std::__cxx11::basic_string<char>; _U2 = std::vector<long double>; typename std::enable_if<(std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ConstructiblePair<_U1, _U2>() && std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ImplicitlyConvertiblePair<_U1, _U2>()), bool>::type <anonymous> = true; _T1 = const std::__cxx11::basic_string<char>; _T2 = nlohmann::basic_json<>]’ at /usr/include/c++/14/bits/stl_pair.h:780:22,
    inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Tp = std::_Rb_tree_node<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/new_allocator.h:191:4,
    inlined from ‘static void std::allocator_traits<std::allocator<_Tp1> >::construct(allocator_type&, _Up*, _Args&& ...) [with _Up = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Tp = std::_Rb_tree_node<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/alloc_traits.h:575:17,
    inlined from ‘void std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_construct_node(_Link_type, _Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:593:32,
    inlined from ‘std::_Rb_tree_node<_Val>* std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_create_node(_Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:610:21,
    inlined from ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_Auto_node::_Auto_node(std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>&, _Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:1633:32,
    inlined from ‘std::pair<std::_Rb_tree_iterator<_Val>, bool> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_unique(_Args&& ...) [with _Args = {const std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > >&}; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:2430:13,
    inlined from ‘std::__enable_if_t<((bool)(! std::is_same<_Val, typename std::iterator_traits<_InputIterator>::value_type>::value))> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_insert_range_unique(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char>, std::vector<long double> > >; _Key = std::__cxx11::basic_string<char>; _Val = std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_tree.h:1108:23,
    inlined from ‘std::map<_Key, _Tp, _Compare, _Alloc>::map(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char>, std::vector<long double> > >; _Key = std::__cxx11::basic_string<char>; _Tp = nlohmann::basic_json<>; _Compare = std::less<std::__cxx11::basic_string<char> >; _Alloc = std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > >]’ at /usr/include/c++/14/bits/stl_map.h:287:31,
    inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::map<std::__cxx11::basic_string<char>, nlohmann::basic_json<>, std::less<std::__cxx11::basic_string<char> >, std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > > >; _Args = {std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >, std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >}; _Tp = std::map<std::__cxx11::basic_string<char>, nlohmann::basic_json<>, std::less<std::__cxx11::basic_string<char> >, std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > > >]’ at /usr/include/c++/14/bits/new_allocator.h:191:4,
    inlined from ‘static T* nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::create(Args&& ...) [with T = std::map<std::__cxx11::basic_string<char>, nlohmann::basic_json<>, std::less<std::__cxx11::basic_string<char> >, std::allocator<std::pair<const std::__cxx11::basic_string<char>, nlohmann::basic_json<> > > >; Args = {std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >, std::_Rb_tree_const_iterator<std::pair<const std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::vector<long double, std::allocator<long double> > > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:1634:24,
    inlined from ‘static void nlohmann::detail::external_constructor<nlohmann::detail::value_t::object>::construct(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; typename std::enable_if<(! std::is_same<CompatibleObjectType, typename BasicJsonType::object_t>::value), int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:358:79,
    inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; typename std::enable_if<is_compatible_object_type<BasicJsonType, CompatibleObjectType>::value, int>::type <anonymous> = 0]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:590:53,
    inlined from ‘decltype ((nlohmann::detail::to_json(j, forward<T>(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:837:23,
    inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:852:20,
    inlined from ‘static void nlohmann::adl_serializer< <template-parameter-1-1>, <template-parameter-1-2> >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&; <template-parameter-1-1> = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; <template-parameter-1-2> = void]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:942:28,
    inlined from ‘nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>::basic_json(CompatibleType&&) [with CompatibleType = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >&; U = std::map<std::__cxx11::basic_string<char>, std::vector<long double> >; typename std::enable_if<((((! std::is_base_of<std::basic_istream<char>, U>::value) && (! std::is_same<U, nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer> >::value)) && (! nlohmann::detail::is_basic_json_nested_type<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value)) && nlohmann::detail::has_to_json<nlohmann::basic_json<ObjectType, ArrayType, StringType, BooleanType, NumberIntegerType, NumberUnsignedType, NumberFloatType, AllocatorType, JSONSerializer>, U>::value), int>::type <anonymous> = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string<char>; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:2009:35,
    inlined from ‘nlohmann::json Metrics::to_json()’ at /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp:1570:1:
/usr/include/c++/14/bits/move.h:235:7: warning: ‘<unnamed>.nlohmann::basic_json<std::map, std::vector, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized]
  235 |       __a = _GLIBCXX_MOVE(__b);
      |       ^~~
In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.hpp:16,
                 from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp:21:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’:
/build/reproducible-path/ataqv-1.3.1+ds/src/cpp/json.hpp:277:15: note: ‘<anonymous>’ declared here
  277 |             j = BasicJsonType{};
      |             ~~^~~~~~~~~~~~~~~~~
g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread
make[2]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
   dh_auto_test
	make -j10 test
make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
[E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 flag 83
Reading human autosomal references from autosomal_references.gz.
Autosomal references for human:
	I
	II
	III
Reading human autosomal references from autosomal_references.gz.
Autosomal references for human:
	I
	II
	III
Reading human autosomal references from autosomal_references.gz.
Autosomal references for human:
	I
	II
	III
Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Loading TSS file 'hg19.tss.refseq.bed.gz'.
Excluding TSS [chr11	10530722	10530723	MTRNR2L8	0	-] which overlaps excluded region [chr11	10529403	10531969	Low_mappability_island	1000	.]
Excluding TSS [chr12	118573688	118573689	PEBP1	0	+] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000	.]
Excluding TSS [chr14	105196180	105196181	ADSSL1	0	+] which overlaps excluded region [chr14	105195912	105196275	TAR1	1000	.]
Excluding TSS [chr17	22022436	22022437	MTRNR2L1	0	+] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000	.]
Excluding TSS [chr20	55934877	55934878	MTRNR2L3	0	-] which overlaps excluded region [chr20	55932703	55936114	chrM	1000	.]
Excluding TSS [chr5	79946853	79946854	MTRNR2L2	0	-] which overlaps excluded region [chr5	79945807	79948223	Low_mappability_island	1000	.]
Excluding TSS [chr6	62284007	62284008	MTRNR2L9	0	+] which overlaps excluded region [chr6	62283966	62284581	Low_mappability_island	1000	.]
Excluding TSS [chr7	57207570	57207571	ZNF479	0	-] which overlaps excluded region [chr7	57205319	57210318	BSR/Beta	1000	.]
Excluding TSS [chr7	63688851	63688852	ZNF679	0	+] which overlaps excluded region [chr7	63686197	63693336	BSR/Beta	1000	.]
Excluding TSS [chr7	142374130	142374131	MTRNR2L6	0	+] which overlaps excluded region [chr7	142372972	142375638	Low_mappability_island	1000	.]
Excluding TSS [chrX	55208943	55208944	MTRNR2L10	0	-] which overlaps excluded region [chrX	55204685	55210460	chrM	1000	.]
Excluding TSS [chrY	25130409	25130410	BPY2B	0	+] which overlaps excluded region [chrY	25122419	25160800	BSR/Beta	1000	.]
Excluding TSS [chrY	26764150	26764151	BPY2B	0	+] which overlaps excluded region [chrY	26756160	26794538	BSR/Beta	1000	.]
Excluding TSS [chrY	27198250	27198251	BPY2B	0	-] which overlaps excluded region [chrY	27167859	27206241	BSR/Beta	1000	.]
chr1 feature count: 2687
chr2 feature count: 1715
chr3 feature count: 1490
chr4 feature count: 1004
chr5 feature count: 1132
chr6 feature count: 1368
chr7 feature count: 1169
chr8 feature count: 913
chr9 feature count: 1025
chr10 feature count: 1039
chr11 feature count: 1642
chr12 feature count: 1350
chr13 feature count: 433
chr14 feature count: 785
chr15 feature count: 812
chr16 feature count: 1106
chr17 feature count: 1528
chr18 feature count: 398
chr19 feature count: 1785
chr20 feature count: 694
chr21 feature count: 321
chr22 feature count: 593
Loaded 24989 TSS in 3.30005 seconds. (7572.31 TSS/second).

Collecting metrics from test.bam.

Logging problematic reads to SRR891275.problems.

Loading peaks for read group SRR891275 from test.peaks.gz.
Excluding peak [chr1	569780	570073	both.broad_peak_1] which overlaps excluded region [chr1	564449	570371	High_Mappability_island	1000	.]
Excluding peak [chr1	5727305	5727512	both.broad_peak_97] which overlaps excluded region [chr1	5725866	5736651	Low_mappability_island	1000	.]
Excluding peak [chr1	16840415	16841121	both.broad_peak_297] which overlaps excluded region [chr1	16839923	16841396	Low_mappability_island	1000	.]
Excluding peak [chr1	121354253	121354849	both.broad_peak_1896] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121478396	121478755	both.broad_peak_1897] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121484326	121485516	both.broad_peak_1898] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	142538265	142538603	both.broad_peak_1899] which overlaps excluded region [chr1	142535434	142543081	Satellite_repeat	1000	.]
Excluding peak [chr1	148928074	148928756	both.broad_peak_1971] which overlaps excluded region [chr1	148927799	148928362	TAR1	1000	.]
Excluding peak [chr10	38804202	38804431	both.broad_peak_4296] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38817221	38818020	both.broad_peak_4297] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38872037	38872278	both.broad_peak_4298] which overlaps excluded region [chr10	38868892	38889025	Satellite_repeat	1000	.]
Excluding peak [chr10	42355450	42355650	both.broad_peak_4299] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42358135	42358433	both.broad_peak_4300] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42364634	42365245	both.broad_peak_4301] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42379790	42380383	both.broad_peak_4302] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42384574	42385679	both.broad_peak_4303] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42392602	42392861	both.broad_peak_4304] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42396775	42396995	both.broad_peak_4305] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42398498	42400769	both.broad_peak_4306] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42404317	42404537	both.broad_peak_4307] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42408166	42408438	both.broad_peak_4308] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42442445	42442676	both.broad_peak_4309] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42527244	42528189	both.broad_peak_4310] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42529217	42530048	both.broad_peak_4311] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42534598	42534872	both.broad_peak_4312] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42596780	42597198	both.broad_peak_4313] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42599471	42600289	both.broad_peak_4314] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42817448	42818278	both.broad_peak_4315] which overlaps excluded region [chr10	42790522	42818398	Satellite_repeat	1000	.]
Excluding peak [chr11	189746	190314	both.broad_peak_5511] which overlaps excluded region [chr11	189419	190691	TAR1	1000	.]
Excluding peak [chr11	50731852	50732074	both.broad_peak_6138] which overlaps excluded region [chr11	50318471	50784078	centromeric_repeat	1000	.]
Excluding peak [chr11	51572059	51572261	both.broad_peak_6139] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51579362	51580694	both.broad_peak_6140] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51591018	51591457	both.broad_peak_6141] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	55006615	55007430	both.broad_peak_6142] which overlaps excluded region [chr11	54694046	55027975	centromeric_repeat	1000	.]
Excluding peak [chr11	73221686	73221937	both.broad_peak_6590] which overlaps excluded region [chr11	73221660	73221946	Low_mappability_island	1000	.]
Excluding peak [chr12	94193	94658	both.broad_peak_7396] which overlaps excluded region [chr12	94147	95158	TAR1	1000	.]
Excluding peak [chr12	34841382	34841617	both.broad_peak_7957] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	34846246	34846543	both.broad_peak_7958] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	38008155	38008894	both.broad_peak_7959] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	38023173	38023373	both.broad_peak_7960] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	118573678	118574095	both.broad_peak_9235] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr12	127650467	127651165	both.broad_peak_9421] which overlaps excluded region [chr12	127650407	127651075	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr14	32953483	32953821	both.broad_peak_10712] which overlaps excluded region [chr14	32953263	32954381	Low_mappability_island	1000	.]
Excluding peak [chr15	80444564	80445859	both.broad_peak_12630] which overlaps excluded region [chr15	80445513	80445569	(GAGTG)n	1000	.]
Excluding peak [chr16	60436	61192	both.broad_peak_12924] which overlaps excluded region [chr16	60058	61142	TAR1	1000	.]
Excluding peak [chr16	33866265	33866524	both.broad_peak_13513] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	33918664	33919304	both.broad_peak_13514] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	34009313	34009561	both.broad_peak_13515] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	46386270	46386795	both.broad_peak_13516] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46391235	46392140	both.broad_peak_13517] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46403548	46403849	both.broad_peak_13518] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46416804	46417405	both.broad_peak_13519] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46427429	46427991	both.broad_peak_13520] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr17	22020593	22020916	both.broad_peak_14569] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000	.]
Excluding peak [chr17	22252084	22253296	both.broad_peak_14570] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	22261278	22261740	both.broad_peak_14571] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	25264883	25265249	both.broad_peak_14572] which overlaps excluded region [chr17	25263010	25268059	Satellite_repeat	1000	.]
Excluding peak [chr17	41381728	41382265	both.broad_peak_14950] which overlaps excluded region [chr17	41381502	41382591	High_Mappability_island	1000	.]
Excluding peak [chr17	41465631	41466936	both.broad_peak_14957] which overlaps excluded region [chr17	41465562	41467288	High_Mappability_island	1000	.]
Excluding peak [chr17	51183057	51183341	both.broad_peak_15172] which overlaps excluded region [chr17	51183038	51183763	Low_mappability_island	1000	.]
Excluding peak [chr17	58602907	58603721	both.broad_peak_15290] which overlaps excluded region [chr17	58603715	58603738	(GAGTG)n	1000	.]
Excluding peak [chr18	111564	112042	both.broad_peak_15816] which overlaps excluded region [chr18	105658	112233	Satellite_repeat	1000	.]
Excluding peak [chr18	18512827	18513193	both.broad_peak_16011] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr18	18516045	18520399	both.broad_peak_16012] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr19	21776802	21777550	both.broad_peak_17342] which overlaps excluded region [chr19	21776132	21780768	BSR/Beta	1000	.]
Excluding peak [chr19	24169382	24170027	both.broad_peak_17364] which overlaps excluded region [chr19	24156856	24171961	BSR/Beta	1000	.]
Excluding peak [chr19	24474565	24474765	both.broad_peak_17369] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	24526069	24526320	both.broad_peak_17370] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	27731880	27733339	both.broad_peak_17371] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27738359	27738668	both.broad_peak_17372] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27756701	27756901	both.broad_peak_17373] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27801311	27801531	both.broad_peak_17374] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	37784325	37784692	both.broad_peak_17536] which overlaps excluded region [chr19	37759473	37797722	centromeric_repeat	1000	.]
Excluding peak [chr19	42069917	42070450	both.broad_peak_17680] which overlaps excluded region [chr19	42069989	42071891	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr2	89848588	89848836	both.broad_peak_19338] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89872032	89872646	both.broad_peak_19339] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89878336	89879257	both.broad_peak_19340] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	90449580	90449808	both.broad_peak_19342] which overlaps excluded region [chr2	90443001	90545431	Low_mappability_island	1000	.]
Excluding peak [chr2	91847848	91848177	both.broad_peak_19344] which overlaps excluded region [chr2	91847957	91848503	TAR1	1000	.]
Excluding peak [chr2	92272876	92273767	both.broad_peak_19345] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92281197	92281779	both.broad_peak_19346] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92284237	92284462	both.broad_peak_19347] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92290435	92291262	both.broad_peak_19348] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92296588	92297023	both.broad_peak_19349] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92305535	92305892	both.broad_peak_19350] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92317234	92317870	both.broad_peak_19351] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	114361072	114362020	both.broad_peak_19697] which overlaps excluded region [chr2	114361054	114362417	TAR1	1000	.]
Excluding peak [chr2	132559385	132560425	both.broad_peak_19833] which overlaps excluded region [chr2	132560214	132560696	TAR1	1000	.]
Excluding peak [chr2	132996509	132996755	both.broad_peak_19834] which overlaps excluded region [chr2	132994855	133007983	ALR/Alpha	1000	.]
Excluding peak [chr2	149639210	149639450	both.broad_peak_19986] which overlaps excluded region [chr2	149639207	149639515	Low_mappability_island	1000	.]
Excluding peak [chr2	162135291	162136055	both.broad_peak_20150] which overlaps excluded region [chr2	162135000	162139241	Low_mappability_island	1000	.]
Excluding peak [chr20	26269111	26270030	both.broad_peak_21666] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26278258	26278484	both.broad_peak_21667] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26289332	26290609	both.broad_peak_21668] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26305634	26305887	both.broad_peak_21669] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26317322	26318676	both.broad_peak_21670] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	29512475	29512675	both.broad_peak_21671] which overlaps excluded region [chr20	29511127	29514978	ALR/Alpha	1000	.]
Excluding peak [chr20	29517798	29518922	both.broad_peak_21672] which overlaps excluded region [chr20	29517710	29521147	centromeric_repeat	1000	.]
Excluding peak [chr20	29813756	29813985	both.broad_peak_21678] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	29831826	29832026	both.broad_peak_21679] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	62917250	62917592	both.broad_peak_22240] which overlaps excluded region [chr20	62916702	62918053	telomeric_repeat	1000	.]
Excluding peak [chr21	9825749	9827187	both.broad_peak_22241] which overlaps excluded region [chr21	9825451	9827612	High_Mappability_island	1000	.]
Excluding peak [chr21	10773372	10773572	both.broad_peak_22242] which overlaps excluded region [chr21	10697886	10860890	centromeric_repeat	1000	.]
Excluding peak [chr21	11186125	11187338	both.broad_peak_22243] which overlaps excluded region [chr21	11186054	11188131	Satellite_repeat	1000	.]
Excluding peak [chr22	18878342	18878659	both.broad_peak_22759] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18879876	18880128	both.broad_peak_22760] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18883583	18883799	both.broad_peak_22761] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	22652231	22653042	both.broad_peak_22847] which overlaps excluded region [chr22	22652105	22652554	TAR1	1000	.]
Excluding peak [chr3	25508907	25509133	both.broad_peak_23723] which overlaps excluded region [chr3	25508897	25509131	Low_mappability_island	1000	.]
Excluding peak [chr3	73159761	73160669	both.broad_peak_24512] which overlaps excluded region [chr3	73159606	73161131	snRNA	1000	.]
Excluding peak [chr3	96336804	96337073	both.broad_peak_24578] which overlaps excluded region [chr3	96335934	96337436	Low_mappability_island	1000	.]
Excluding peak [chr3	196625608	196625808	both.broad_peak_25903] which overlaps excluded region [chr3	196625514	196625860	Satellite_repeat	1000	.]
Excluding peak [chr4	49094768	49094968	both.broad_peak_26437] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49107449	49107766	both.broad_peak_26438] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49122928	49123231	both.broad_peak_26439] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49151102	49151911	both.broad_peak_26440] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49645060	49645303	both.broad_peak_26441] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	49659456	49659760	both.broad_peak_26442] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	56194226	56194485	both.broad_peak_26481] which overlaps excluded region [chr4	56194229	56194584	Low_mappability_island	1000	.]
Excluding peak [chr4	68264592	68266730	both.broad_peak_26530] which overlaps excluded region [chr4	68264186	68266830	centromeric_repeat	1000	.]
Excluding peak [chr4	191032545	191032745	both.broad_peak_27751] which overlaps excluded region [chr4	191026302	191044344	telomeric_repeat	1000	.]
Excluding peak [chr5	46364115	46364315	both.broad_peak_28116] which overlaps excluded region [chr5	45908253	46411114	centromeric_repeat	1000	.]
Excluding peak [chr5	49450550	49450756	both.broad_peak_28117] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	49547478	49547699	both.broad_peak_28118] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	134259765	134260404	both.broad_peak_29117] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr5	134262625	134262877	both.broad_peak_29118] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr6	58776533	58779369	both.broad_peak_30874] which overlaps excluded region [chr6	58745955	58780547	centromeric_repeat	1000	.]
Excluding peak [chr7	43878412	43878832	both.broad_peak_32927] which overlaps excluded region [chr7	43878355	43878530	TAR1	1000	.]
Excluding peak [chr7	45291476	45291676	both.broad_peak_32976] which overlaps excluded region [chr7	45291517	45291740	Low_mappability_island	1000	.]
Excluding peak [chr7	57549361	57549585	both.broad_peak_33054] which overlaps excluded region [chr7	57544726	57556913	Satellite_repeat	1000	.]
Excluding peak [chr7	57957789	57957996	both.broad_peak_33055] which overlaps excluded region [chr7	57939184	58055539	centromeric_repeat	1000	.]
Excluding peak [chr7	61968705	61969761	both.broad_peak_33056] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	61986136	61986336	both.broad_peak_33057] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	64099785	64100002	both.broad_peak_33067] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	64100838	64101105	both.broad_peak_33068] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	100550706	100551292	both.broad_peak_33481] which overlaps excluded region [chr7	100550640	100551321	Low_mappability_island	1000	.]
Excluding peak [chr8	43092778	43097038	both.broad_peak_34830] which overlaps excluded region [chr8	43092737	43097573	Satellite_repeat	1000	.]
Excluding peak [chr8	43779474	43779699	both.broad_peak_34831] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43794100	43794746	both.broad_peak_34832] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43820539	43820739	both.broad_peak_34833] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43821992	43822192	both.broad_peak_34834] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	46845309	46845549	both.broad_peak_34835] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	46852362	46852861	both.broad_peak_34836] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	100507997	100508253	both.broad_peak_35355] which overlaps excluded region [chr8	100508010	100508287	Low_mappability_island	1000	.]
Excluding peak [chr9	45356920	45357350	both.broad_peak_36413] which overlaps excluded region [chr9	45355954	45357644	telomeric_repeat	1000	.]
Excluding peak [chr9	45439723	45439970	both.broad_peak_36414] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	45441747	45442443	both.broad_peak_36415] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	66494045	66494608	both.broad_peak_36419] which overlaps excluded region [chr9	66494170	66494805	TAR1	1000	.]
Excluding peak [chr9	66824178	66824684	both.broad_peak_36421] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	66833083	66833633	both.broad_peak_36422] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	67339988	67340844	both.broad_peak_36425] which overlaps excluded region [chr9	67340080	67340661	TAR1	1000	.]
Excluding peak [chr9	68377361	68377574	both.broad_peak_36426] which overlaps excluded region [chr9	68376841	68377466	TAR1	1000	.]
Excluding peak [chr9	68412991	68414393	both.broad_peak_36427] which overlaps excluded region [chr9	68410775	68435115	Low_mappability_island	1000	.]
Excluding peak [chr9	70648541	70648768	both.broad_peak_36436] which overlaps excluded region [chr9	70648394	70648886	TAR1	1000	.]
chr1 peak count: 3667
chr2 peak count: 3154
chr3 peak count: 2528
chr4 peak count: 1814
chr5 peak count: 2042
chr6 peak count: 2483
chr7 peak count: 1999
chr8 peak count: 1647
chr9 peak count: 1475
chr10 peak count: 1815
chr11 peak count: 1878
chr12 peak count: 2078
chr13 peak count: 1026
chr14 peak count: 1275
chr15 peak count: 1140
chr16 peak count: 1211
chr17 peak count: 1664
chr18 peak count: 772
chr19 peak count: 1595
chr20 peak count: 864
chr21 peak count: 487
chr22 peak count: 662
Loaded 37276 peaks in 29.6042 seconds. (1259.15 peaks/second).

Logging problematic reads to SRR891278.problems.

Loading peaks for read group SRR891278 from test.peaks.gz.
Excluding peak [chr1	569780	570073	both.broad_peak_1] which overlaps excluded region [chr1	564449	570371	High_Mappability_island	1000	.]
Excluding peak [chr1	5727305	5727512	both.broad_peak_97] which overlaps excluded region [chr1	5725866	5736651	Low_mappability_island	1000	.]
Excluding peak [chr1	16840415	16841121	both.broad_peak_297] which overlaps excluded region [chr1	16839923	16841396	Low_mappability_island	1000	.]
Excluding peak [chr1	121354253	121354849	both.broad_peak_1896] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121478396	121478755	both.broad_peak_1897] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	121484326	121485516	both.broad_peak_1898] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000	.]
Excluding peak [chr1	142538265	142538603	both.broad_peak_1899] which overlaps excluded region [chr1	142535434	142543081	Satellite_repeat	1000	.]
Excluding peak [chr1	148928074	148928756	both.broad_peak_1971] which overlaps excluded region [chr1	148927799	148928362	TAR1	1000	.]
Excluding peak [chr10	38804202	38804431	both.broad_peak_4296] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38817221	38818020	both.broad_peak_4297] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000	.]
Excluding peak [chr10	38872037	38872278	both.broad_peak_4298] which overlaps excluded region [chr10	38868892	38889025	Satellite_repeat	1000	.]
Excluding peak [chr10	42355450	42355650	both.broad_peak_4299] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42358135	42358433	both.broad_peak_4300] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42364634	42365245	both.broad_peak_4301] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42379790	42380383	both.broad_peak_4302] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42384574	42385679	both.broad_peak_4303] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42392602	42392861	both.broad_peak_4304] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42396775	42396995	both.broad_peak_4305] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42398498	42400769	both.broad_peak_4306] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42404317	42404537	both.broad_peak_4307] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42408166	42408438	both.broad_peak_4308] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42442445	42442676	both.broad_peak_4309] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42527244	42528189	both.broad_peak_4310] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42529217	42530048	both.broad_peak_4311] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42534598	42534872	both.broad_peak_4312] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000	.]
Excluding peak [chr10	42596780	42597198	both.broad_peak_4313] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42599471	42600289	both.broad_peak_4314] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000	.]
Excluding peak [chr10	42817448	42818278	both.broad_peak_4315] which overlaps excluded region [chr10	42790522	42818398	Satellite_repeat	1000	.]
Excluding peak [chr11	189746	190314	both.broad_peak_5511] which overlaps excluded region [chr11	189419	190691	TAR1	1000	.]
Excluding peak [chr11	50731852	50732074	both.broad_peak_6138] which overlaps excluded region [chr11	50318471	50784078	centromeric_repeat	1000	.]
Excluding peak [chr11	51572059	51572261	both.broad_peak_6139] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51579362	51580694	both.broad_peak_6140] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	51591018	51591457	both.broad_peak_6141] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000	.]
Excluding peak [chr11	55006615	55007430	both.broad_peak_6142] which overlaps excluded region [chr11	54694046	55027975	centromeric_repeat	1000	.]
Excluding peak [chr11	73221686	73221937	both.broad_peak_6590] which overlaps excluded region [chr11	73221660	73221946	Low_mappability_island	1000	.]
Excluding peak [chr12	94193	94658	both.broad_peak_7396] which overlaps excluded region [chr12	94147	95158	TAR1	1000	.]
Excluding peak [chr12	34841382	34841617	both.broad_peak_7957] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	34846246	34846543	both.broad_peak_7958] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000	.]
Excluding peak [chr12	38008155	38008894	both.broad_peak_7959] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	38023173	38023373	both.broad_peak_7960] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000	.]
Excluding peak [chr12	118573678	118574095	both.broad_peak_9235] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr12	127650467	127651165	both.broad_peak_9421] which overlaps excluded region [chr12	127650407	127651075	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr14	32953483	32953821	both.broad_peak_10712] which overlaps excluded region [chr14	32953263	32954381	Low_mappability_island	1000	.]
Excluding peak [chr15	80444564	80445859	both.broad_peak_12630] which overlaps excluded region [chr15	80445513	80445569	(GAGTG)n	1000	.]
Excluding peak [chr16	60436	61192	both.broad_peak_12924] which overlaps excluded region [chr16	60058	61142	TAR1	1000	.]
Excluding peak [chr16	33866265	33866524	both.broad_peak_13513] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	33918664	33919304	both.broad_peak_13514] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	34009313	34009561	both.broad_peak_13515] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000	.]
Excluding peak [chr16	46386270	46386795	both.broad_peak_13516] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46391235	46392140	both.broad_peak_13517] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46403548	46403849	both.broad_peak_13518] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46416804	46417405	both.broad_peak_13519] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr16	46427429	46427991	both.broad_peak_13520] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000	.]
Excluding peak [chr17	22020593	22020916	both.broad_peak_14569] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000	.]
Excluding peak [chr17	22252084	22253296	both.broad_peak_14570] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	22261278	22261740	both.broad_peak_14571] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000	.]
Excluding peak [chr17	25264883	25265249	both.broad_peak_14572] which overlaps excluded region [chr17	25263010	25268059	Satellite_repeat	1000	.]
Excluding peak [chr17	41381728	41382265	both.broad_peak_14950] which overlaps excluded region [chr17	41381502	41382591	High_Mappability_island	1000	.]
Excluding peak [chr17	41465631	41466936	both.broad_peak_14957] which overlaps excluded region [chr17	41465562	41467288	High_Mappability_island	1000	.]
Excluding peak [chr17	51183057	51183341	both.broad_peak_15172] which overlaps excluded region [chr17	51183038	51183763	Low_mappability_island	1000	.]
Excluding peak [chr17	58602907	58603721	both.broad_peak_15290] which overlaps excluded region [chr17	58603715	58603738	(GAGTG)n	1000	.]
Excluding peak [chr18	111564	112042	both.broad_peak_15816] which overlaps excluded region [chr18	105658	112233	Satellite_repeat	1000	.]
Excluding peak [chr18	18512827	18513193	both.broad_peak_16011] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr18	18516045	18520399	both.broad_peak_16012] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000	.]
Excluding peak [chr19	21776802	21777550	both.broad_peak_17342] which overlaps excluded region [chr19	21776132	21780768	BSR/Beta	1000	.]
Excluding peak [chr19	24169382	24170027	both.broad_peak_17364] which overlaps excluded region [chr19	24156856	24171961	BSR/Beta	1000	.]
Excluding peak [chr19	24474565	24474765	both.broad_peak_17369] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	24526069	24526320	both.broad_peak_17370] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000	.]
Excluding peak [chr19	27731880	27733339	both.broad_peak_17371] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27738359	27738668	both.broad_peak_17372] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27756701	27756901	both.broad_peak_17373] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	27801311	27801531	both.broad_peak_17374] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000	.]
Excluding peak [chr19	37784325	37784692	both.broad_peak_17536] which overlaps excluded region [chr19	37759473	37797722	centromeric_repeat	1000	.]
Excluding peak [chr19	42069917	42070450	both.broad_peak_17680] which overlaps excluded region [chr19	42069989	42071891	LSU-rRNA_Hsa	1000	.]
Excluding peak [chr2	89848588	89848836	both.broad_peak_19338] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89872032	89872646	both.broad_peak_19339] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	89878336	89879257	both.broad_peak_19340] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000	.]
Excluding peak [chr2	90449580	90449808	both.broad_peak_19342] which overlaps excluded region [chr2	90443001	90545431	Low_mappability_island	1000	.]
Excluding peak [chr2	91847848	91848177	both.broad_peak_19344] which overlaps excluded region [chr2	91847957	91848503	TAR1	1000	.]
Excluding peak [chr2	92272876	92273767	both.broad_peak_19345] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92281197	92281779	both.broad_peak_19346] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92284237	92284462	both.broad_peak_19347] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92290435	92291262	both.broad_peak_19348] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92296588	92297023	both.broad_peak_19349] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92305535	92305892	both.broad_peak_19350] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	92317234	92317870	both.broad_peak_19351] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000	.]
Excluding peak [chr2	114361072	114362020	both.broad_peak_19697] which overlaps excluded region [chr2	114361054	114362417	TAR1	1000	.]
Excluding peak [chr2	132559385	132560425	both.broad_peak_19833] which overlaps excluded region [chr2	132560214	132560696	TAR1	1000	.]
Excluding peak [chr2	132996509	132996755	both.broad_peak_19834] which overlaps excluded region [chr2	132994855	133007983	ALR/Alpha	1000	.]
Excluding peak [chr2	149639210	149639450	both.broad_peak_19986] which overlaps excluded region [chr2	149639207	149639515	Low_mappability_island	1000	.]
Excluding peak [chr2	162135291	162136055	both.broad_peak_20150] which overlaps excluded region [chr2	162135000	162139241	Low_mappability_island	1000	.]
Excluding peak [chr20	26269111	26270030	both.broad_peak_21666] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26278258	26278484	both.broad_peak_21667] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26289332	26290609	both.broad_peak_21668] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26305634	26305887	both.broad_peak_21669] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	26317322	26318676	both.broad_peak_21670] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000	.]
Excluding peak [chr20	29512475	29512675	both.broad_peak_21671] which overlaps excluded region [chr20	29511127	29514978	ALR/Alpha	1000	.]
Excluding peak [chr20	29517798	29518922	both.broad_peak_21672] which overlaps excluded region [chr20	29517710	29521147	centromeric_repeat	1000	.]
Excluding peak [chr20	29813756	29813985	both.broad_peak_21678] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	29831826	29832026	both.broad_peak_21679] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000	.]
Excluding peak [chr20	62917250	62917592	both.broad_peak_22240] which overlaps excluded region [chr20	62916702	62918053	telomeric_repeat	1000	.]
Excluding peak [chr21	9825749	9827187	both.broad_peak_22241] which overlaps excluded region [chr21	9825451	9827612	High_Mappability_island	1000	.]
Excluding peak [chr21	10773372	10773572	both.broad_peak_22242] which overlaps excluded region [chr21	10697886	10860890	centromeric_repeat	1000	.]
Excluding peak [chr21	11186125	11187338	both.broad_peak_22243] which overlaps excluded region [chr21	11186054	11188131	Satellite_repeat	1000	.]
Excluding peak [chr22	18878342	18878659	both.broad_peak_22759] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18879876	18880128	both.broad_peak_22760] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	18883583	18883799	both.broad_peak_22761] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000	.]
Excluding peak [chr22	22652231	22653042	both.broad_peak_22847] which overlaps excluded region [chr22	22652105	22652554	TAR1	1000	.]
Excluding peak [chr3	25508907	25509133	both.broad_peak_23723] which overlaps excluded region [chr3	25508897	25509131	Low_mappability_island	1000	.]
Excluding peak [chr3	73159761	73160669	both.broad_peak_24512] which overlaps excluded region [chr3	73159606	73161131	snRNA	1000	.]
Excluding peak [chr3	96336804	96337073	both.broad_peak_24578] which overlaps excluded region [chr3	96335934	96337436	Low_mappability_island	1000	.]
Excluding peak [chr3	196625608	196625808	both.broad_peak_25903] which overlaps excluded region [chr3	196625514	196625860	Satellite_repeat	1000	.]
Excluding peak [chr4	49094768	49094968	both.broad_peak_26437] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49107449	49107766	both.broad_peak_26438] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49122928	49123231	both.broad_peak_26439] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49151102	49151911	both.broad_peak_26440] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000	.]
Excluding peak [chr4	49645060	49645303	both.broad_peak_26441] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	49659456	49659760	both.broad_peak_26442] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000	.]
Excluding peak [chr4	56194226	56194485	both.broad_peak_26481] which overlaps excluded region [chr4	56194229	56194584	Low_mappability_island	1000	.]
Excluding peak [chr4	68264592	68266730	both.broad_peak_26530] which overlaps excluded region [chr4	68264186	68266830	centromeric_repeat	1000	.]
Excluding peak [chr4	191032545	191032745	both.broad_peak_27751] which overlaps excluded region [chr4	191026302	191044344	telomeric_repeat	1000	.]
Excluding peak [chr5	46364115	46364315	both.broad_peak_28116] which overlaps excluded region [chr5	45908253	46411114	centromeric_repeat	1000	.]
Excluding peak [chr5	49450550	49450756	both.broad_peak_28117] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	49547478	49547699	both.broad_peak_28118] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000	.]
Excluding peak [chr5	134259765	134260404	both.broad_peak_29117] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr5	134262625	134262877	both.broad_peak_29118] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000	.]
Excluding peak [chr6	58776533	58779369	both.broad_peak_30874] which overlaps excluded region [chr6	58745955	58780547	centromeric_repeat	1000	.]
Excluding peak [chr7	43878412	43878832	both.broad_peak_32927] which overlaps excluded region [chr7	43878355	43878530	TAR1	1000	.]
Excluding peak [chr7	45291476	45291676	both.broad_peak_32976] which overlaps excluded region [chr7	45291517	45291740	Low_mappability_island	1000	.]
Excluding peak [chr7	57549361	57549585	both.broad_peak_33054] which overlaps excluded region [chr7	57544726	57556913	Satellite_repeat	1000	.]
Excluding peak [chr7	57957789	57957996	both.broad_peak_33055] which overlaps excluded region [chr7	57939184	58055539	centromeric_repeat	1000	.]
Excluding peak [chr7	61968705	61969761	both.broad_peak_33056] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	61986136	61986336	both.broad_peak_33057] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000	.]
Excluding peak [chr7	64099785	64100002	both.broad_peak_33067] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	64100838	64101105	both.broad_peak_33068] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000	.]
Excluding peak [chr7	100550706	100551292	both.broad_peak_33481] which overlaps excluded region [chr7	100550640	100551321	Low_mappability_island	1000	.]
Excluding peak [chr8	43092778	43097038	both.broad_peak_34830] which overlaps excluded region [chr8	43092737	43097573	Satellite_repeat	1000	.]
Excluding peak [chr8	43779474	43779699	both.broad_peak_34831] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43794100	43794746	both.broad_peak_34832] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43820539	43820739	both.broad_peak_34833] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	43821992	43822192	both.broad_peak_34834] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000	.]
Excluding peak [chr8	46845309	46845549	both.broad_peak_34835] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	46852362	46852861	both.broad_peak_34836] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000	.]
Excluding peak [chr8	100507997	100508253	both.broad_peak_35355] which overlaps excluded region [chr8	100508010	100508287	Low_mappability_island	1000	.]
Excluding peak [chr9	45356920	45357350	both.broad_peak_36413] which overlaps excluded region [chr9	45355954	45357644	telomeric_repeat	1000	.]
Excluding peak [chr9	45439723	45439970	both.broad_peak_36414] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	45441747	45442443	both.broad_peak_36415] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000	.]
Excluding peak [chr9	66494045	66494608	both.broad_peak_36419] which overlaps excluded region [chr9	66494170	66494805	TAR1	1000	.]
Excluding peak [chr9	66824178	66824684	both.broad_peak_36421] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	66833083	66833633	both.broad_peak_36422] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000	.]
Excluding peak [chr9	67339988	67340844	both.broad_peak_36425] which overlaps excluded region [chr9	67340080	67340661	TAR1	1000	.]
Excluding peak [chr9	68377361	68377574	both.broad_peak_36426] which overlaps excluded region [chr9	68376841	68377466	TAR1	1000	.]
Excluding peak [chr9	68412991	68414393	both.broad_peak_36427] which overlaps excluded region [chr9	68410775	68435115	Low_mappability_island	1000	.]
Excluding peak [chr9	70648541	70648768	both.broad_peak_36436] which overlaps excluded region [chr9	70648394	70648886	TAR1	1000	.]
chr1 peak count: 3667
chr2 peak count: 3154
chr3 peak count: 2528
chr4 peak count: 1814
chr5 peak count: 2042
chr6 peak count: 2483
chr7 peak count: 1999
chr8 peak count: 1647
chr9 peak count: 1475
chr10 peak count: 1815
chr11 peak count: 1878
chr12 peak count: 2078
chr13 peak count: 1026
chr14 peak count: 1275
chr15 peak count: 1140
chr16 peak count: 1211
chr17 peak count: 1664
chr18 peak count: 772
chr19 peak count: 1595
chr20 peak count: 864
chr21 peak count: 487
chr22 peak count: 662
Loaded 37276 peaks in 35.3334 seconds. (1054.98 peaks/second).

New maximum proper pair fragment length: 42 from [SRR891275.608	1123	chr1	569907	57	42M	=	569907	42	CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA	@@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG	XA:Z:chrM,+9359,42M,1;	MD:Z:42	NM:i:0	AS:i:42	XS:i:37	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 330 from [SRR891278.50	1123	chr1	569913	27	50M	=	570193	330	NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC	#1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH	XA:Z:chrM,+9365,50M,2;	MD:Z:0C49	NM:i:1	AS:i:49	XS:i:44	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 53 from [SRR891275.421	1187	chr1	569924	15	50M	=	569927	53	TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC	CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI	XA:Z:chrM,+9376,50M,1;	MD:Z:50	NM:i:0	AS:i:50	XS:i:47	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 67 from [SRR891275.1617	99	chr1	2059335	60	50M	=	2059352	67	CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT	???DB?D8C:CD42C<EB))3ACDEAEAD6D><<*?DB<9?BBBD?9DD4	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 112 from [SRR891275.176	99	chr1	2419720	60	50M	=	2419782	112	ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA	@BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 361 from [SRR891278.227	99	chr1	17047555	60	50M	=	17047866	361	GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT	@CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC	XA:Z:chr1,+144886802,48M2S,2;	MD:Z:50	NM:i:0	AS:i:50	XS:i:42	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 216 from [SRR891275.1770	163	chr1	18154381	60	50M	=	18154547	216	CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC	C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ	MD:Z:50	NM:i:0	AS:i:50	XS:i:21	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 562 from [SRR891275.385	163	chr1	43042844	60	50M	=	43043356	562	AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA	CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 609 from [SRR891275.714	99	chr1	79875808	60	50M	=	79876367	609	GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG	@@@DDDFFFHAH<EFGGGG@EGECHIDHHAE<<*11?DB?9*?*:336?B	MD:Z:50	NM:i:0	AS:i:50	XS:i:30	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 424 from [SRR891278.592	163	chr1	238449255	60	50M	=	238449629	424	CCTGCAATTCTGAATAGGTCTGTGAATATACAGACTTTTTATTTGTACAT	B@@BDDFFHGHGHJGEHDFHGHDHHJCEGIIGGEHIJGIGEHIIIIGEIH	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 633 from [SRR891278.342	99	chr2	4228733	60	50M	=	4229316	633	CATTTAATGCAAACTAATCTAGCTATTATCATCTGGAGCTGCAGGCTATA	CCCFFFFDHHGFHABDIGIIEGIIGCHCHIIIIIGHAEF):CCF;F;BDH	MD:Z:50	NM:i:0	AS:i:50	XS:i:20	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 649 from [SRR891278.1592	99	chr2	55845390	60	50M	=	55845989	649	GTGTGTTGACGATTTCCTGTTTCTTGCAGAGCGATTCACCGTTAAGGCTC	;1=+AB3BB<<?AC?EEAE+3A<B4CC93*:9C)?;DBD?68)?######	MD:Z:33C16	NM:i:1	AS:i:45	XS:i:0	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
Calculating TSS coverage...
Added TSS coverage for chr22; thread count=1
Added TSS coverage for chr21; thread count=1
Added TSS coverage for chr20; thread count=1
Added TSS coverage for chr19; thread count=1
Added TSS coverage for chr18; thread count=1
Added TSS coverage for chr17; thread count=1
Added TSS coverage for chr16; thread count=1
Added TSS coverage for chr15; thread count=1
Added TSS coverage for chr14; thread count=1
Added TSS coverage for chr13; thread count=1
Added TSS coverage for chr12; thread count=1
Added TSS coverage for chr11; thread count=1
Added TSS coverage for chr10; thread count=1
Added TSS coverage for chr9; thread count=1
Added TSS coverage for chr8; thread count=1
Added TSS coverage for chr7; thread count=1
Added TSS coverage for chr6; thread count=1
Added TSS coverage for chr5; thread count=1
Added TSS coverage for chr4; thread count=1
Added TSS coverage for chr3; thread count=1
Added TSS coverage for chr2; thread count=1
Added TSS coverage for chr1; thread count=1
All TSS jobs started. Waiting for last ones to complete.
Calculated TSS coverage in 0.321004 seconds.
Calculating TSS metrics...
Calculated TSS metrics in 0.000488631 seconds.
Calculating TSS metrics...
Calculated TSS metrics in 0.00052002 seconds.
Analyzed 1040 reads in 0.454172 seconds (2289.88 reads/second).

ataqv 1.3.1

Operating parameters
====================
Thread limit: 1
Ignoring read groups: no
Is single nucleus: no
TSS extension: 1000

Experiment information
======================
Organism: human
Description: a collector for unit tests
URL: https://theparkerlab.org

Reference genome configuration
==============================
Mitochondrial reference: chrM
Autosomal references: 
  1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
  20, 21, 22, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9,
  chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18,
  chr19, chr20, chr21, chr22


Read Group
==========
ID: SRR891275
Library: SRR891275
Sample: GSM1155964
Description: a library of brutal tests?

Sequencing center: 
Sequencing date: 
Sequencing platform: ILLUMINA
Platform model: 
Platform unit: 
Flow order: 
Key sequence: 
Predicted median insert size: 
Programs: 

Metrics
-------

  Read Mapping Metrics
  --------------------
  Total reads: 520
  Total problems: 104 (20.000%)
  Properly paired and mapped reads: 416 (80.000%)
  Secondary reads: 10 (1.923%)
  Supplementary reads: 0 (0.000%)
  Duplicate reads: 155 (29.808% of all reads)

  Quality Indicators
  ------------------
  Short to mononucleosomal ratio: 1.281
  High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200
    as a percentage of autosomal reads: 91.324%
    as a percentage of all reads: 38.462%
  TSS enrichment: 6.000

  Paired Read Metrics
  -------------------
  Paired reads: 520 (100.000%)
  Paired and mapped reads: 424 (81.538%)
  FR reads: 416 (80.000000%)
  First of pair: 260 (50.000%)
  Second of pair: 260 (50.000%)
  Forward reads: 268 (51.538%)
  Reverse reads: 252 (48.462%)
  Forward mate reads: 261 (50.192%)
  Reverse mate reads: 259 (49.808%)

  Unmapped Read Metrics
  ---------------------
  Unmapped reads:                       9 (1.731%)
  Unmapped mate reads:                  2 (0.385%)
  Reads not passing quality controls:   0 (0.000%)
  Unpaired reads:                       0 (0.000%)
  Reads with zero mapping quality:      62 (11.923%)

  Aberrant Mapping Metrics
  ------------------------
  RF reads:                             9 (1.730769%)
  FF reads:                             6 (1.153846%)
  RR reads:                             8 (1.538462%)
  Reads that paired and mapped but...   
    on different chromosomes:           6 (1.154%)
    probably too far from their mates:  2 (0.385%) (longest proper fragment seems to be 609)
    just not properly:                  0 (0.000%)

  Autosomal/Mitochondrial Metrics
  -------------------------------
  Total autosomal reads: 219 (42.115% of all reads)
  Total mitochondrial reads: 177 (34.038% of all reads)
  Duplicate autosomal reads: 18 (8.219% of all autosomal reads)
  Duplicate mitochondrial reads: 93 (52.542% of all mitochondrial reads)


  Mapping Quality
  ---------------
  Mean MAPQ: 47.033
  Median MAPQ: 60.000
  Reads with MAPQ >=...
                   5: 439 (84.423%)
                  10: 439 (84.423%)
                  15: 438 (84.231%)
                  20: 436 (83.846%)
                  25: 435 (83.654%)
                  30: 420 (80.769%)

  Peak Metrics
  ------------
  Peak count: 37276

  High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments)
  Number of high quality autosomal alignments overlapping the top 10,000 peaks: 
          Top peak: 2 (1.000% of all high quality autosomal alignments)
      Top 10 peaks: 20 (10.000% of all high quality autosomal alignments)
     Top 100 peaks: 23 (11.500% of all high quality autosomal alignments)
    Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments)
  Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments)

Read Group
==========
ID: SRR891278
Library: SRR891278
Sample: GSM1155967
Description: a library of brutal tests?

Sequencing center: 
Sequencing date: 
Sequencing platform: ILLUMINA
Platform model: 
Platform unit: 
Flow order: 
Key sequence: 
Predicted median insert size: 
Programs: 

Metrics
-------

  Read Mapping Metrics
  --------------------
  Total reads: 520
  Total problems: 90 (17.308%)
  Properly paired and mapped reads: 430 (82.692%)
  Secondary reads: 10 (1.923%)
  Supplementary reads: 0 (0.000%)
  Duplicate reads: 158 (30.385% of all reads)

  Quality Indicators
  ------------------
  Short to mononucleosomal ratio: 2.357
  High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200
    as a percentage of autosomal reads: 91.743%
    as a percentage of all reads: 38.462%
  TSS enrichment: 3.687

  Paired Read Metrics
  -------------------
  Paired reads: 520 (100.000%)
  Paired and mapped reads: 440 (84.615%)
  FR reads: 430 (82.692308%)
  First of pair: 259 (49.808%)
  Second of pair: 261 (50.192%)
  Forward reads: 261 (50.192%)
  Reverse reads: 259 (49.808%)
  Forward mate reads: 260 (50.000%)
  Reverse mate reads: 260 (50.000%)

  Unmapped Read Metrics
  ---------------------
  Unmapped reads:                       8 (1.538%)
  Unmapped mate reads:                  4 (0.769%)
  Reads not passing quality controls:   0 (0.000%)
  Unpaired reads:                       0 (0.000%)
  Reads with zero mapping quality:      49 (9.423%)

  Aberrant Mapping Metrics
  ------------------------
  RF reads:                             6 (1.153846%)
  FF reads:                             4 (0.769231%)
  RR reads:                             9 (1.730769%)
  Reads that paired and mapped but...   
    on different chromosomes:           8 (1.538%)
    probably too far from their mates:  2 (0.385%) (longest proper fragment seems to be 649)
    just not properly:                  0 (0.000%)

  Autosomal/Mitochondrial Metrics
  -------------------------------
  Total autosomal reads: 218 (41.923% of all reads)
  Total mitochondrial reads: 192 (36.923% of all reads)
  Duplicate autosomal reads: 17 (7.798% of all autosomal reads)
  Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads)


  Mapping Quality
  ---------------
  Mean MAPQ: 48.044
  Median MAPQ: 60.000
  Reads with MAPQ >=...
                   5: 449 (86.346%)
                  10: 445 (85.577%)
                  15: 443 (85.192%)
                  20: 442 (85.000%)
                  25: 442 (85.000%)
                  30: 417 (80.192%)

  Peak Metrics
  ------------
  Peak count: 37276

  High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments)
  Number of high quality autosomal alignments overlapping the top 10,000 peaks: 
          Top peak: 2 (1.000% of all high quality autosomal alignments)
      Top 10 peaks: 20 (10.000% of all high quality autosomal alignments)
     Top 100 peaks: 92 (46.000% of all high quality autosomal alignments)
    Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments)
  Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments)


[E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory
Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Collecting metrics from test.bam.

Logging problematic reads to Test collector.problems.

Loading peaks for read group Test collector from test.peaks.gz.
Excluding peak [chr1	569780	570073	both.broad_peak_1] which overlaps excluded region [chr1	564449	570371	High_Mappability_island	1000.000	.]
Excluding peak [chr1	5727305	5727512	both.broad_peak_97] which overlaps excluded region [chr1	5725866	5736651	Low_mappability_island	1000.000	.]
Excluding peak [chr1	16840415	16841121	both.broad_peak_297] which overlaps excluded region [chr1	16839923	16841396	Low_mappability_island	1000.000	.]
Excluding peak [chr1	121354253	121354849	both.broad_peak_1896] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000.000	.]
Excluding peak [chr1	121478396	121478755	both.broad_peak_1897] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000.000	.]
Excluding peak [chr1	121484326	121485516	both.broad_peak_1898] which overlaps excluded region [chr1	121351474	121487059	centromeric_repeat	1000.000	.]
Excluding peak [chr1	142538265	142538603	both.broad_peak_1899] which overlaps excluded region [chr1	142535434	142543081	Satellite_repeat	1000.000	.]
Excluding peak [chr1	148928074	148928756	both.broad_peak_1971] which overlaps excluded region [chr1	148927799	148928362	TAR1	1000.000	.]
Excluding peak [chr10	38804202	38804431	both.broad_peak_4296] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000.000	.]
Excluding peak [chr10	38817221	38818020	both.broad_peak_4297] which overlaps excluded region [chr10	38772277	38819357	Satellite_repeat	1000.000	.]
Excluding peak [chr10	38872037	38872278	both.broad_peak_4298] which overlaps excluded region [chr10	38868892	38889025	Satellite_repeat	1000.000	.]
Excluding peak [chr10	42355450	42355650	both.broad_peak_4299] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42358135	42358433	both.broad_peak_4300] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42364634	42365245	both.broad_peak_4301] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42379790	42380383	both.broad_peak_4302] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42384574	42385679	both.broad_peak_4303] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42392602	42392861	both.broad_peak_4304] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42396775	42396995	both.broad_peak_4305] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42398498	42400769	both.broad_peak_4306] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42404317	42404537	both.broad_peak_4307] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42408166	42408438	both.broad_peak_4308] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42442445	42442676	both.broad_peak_4309] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42527244	42528189	both.broad_peak_4310] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42529217	42530048	both.broad_peak_4311] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42534598	42534872	both.broad_peak_4312] which overlaps excluded region [chr10	42354835	42548642	centromeric_repeat	1000.000	.]
Excluding peak [chr10	42596780	42597198	both.broad_peak_4313] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000.000	.]
Excluding peak [chr10	42599471	42600289	both.broad_peak_4314] which overlaps excluded region [chr10	42596676	42602082	Satellite_repeat	1000.000	.]
Excluding peak [chr10	42817448	42818278	both.broad_peak_4315] which overlaps excluded region [chr10	42790522	42818398	Satellite_repeat	1000.000	.]
Excluding peak [chr11	189746	190314	both.broad_peak_5511] which overlaps excluded region [chr11	189419	190691	TAR1	1000.000	.]
Excluding peak [chr11	50731852	50732074	both.broad_peak_6138] which overlaps excluded region [chr11	50318471	50784078	centromeric_repeat	1000.000	.]
Excluding peak [chr11	51572059	51572261	both.broad_peak_6139] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000.000	.]
Excluding peak [chr11	51579362	51580694	both.broad_peak_6140] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000.000	.]
Excluding peak [chr11	51591018	51591457	both.broad_peak_6141] which overlaps excluded region [chr11	51567242	51594226	centromeric_repeat	1000.000	.]
Excluding peak [chr11	55006615	55007430	both.broad_peak_6142] which overlaps excluded region [chr11	54694046	55027975	centromeric_repeat	1000.000	.]
Excluding peak [chr11	73221686	73221937	both.broad_peak_6590] which overlaps excluded region [chr11	73221660	73221946	Low_mappability_island	1000.000	.]
Excluding peak [chr12	94193	94658	both.broad_peak_7396] which overlaps excluded region [chr12	94147	95158	TAR1	1000.000	.]
Excluding peak [chr12	34841382	34841617	both.broad_peak_7957] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000.000	.]
Excluding peak [chr12	34846246	34846543	both.broad_peak_7958] which overlaps excluded region [chr12	34432130	34857010	centromeric_repeat	1000.000	.]
Excluding peak [chr12	38008155	38008894	both.broad_peak_7959] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000.000	.]
Excluding peak [chr12	38023173	38023373	both.broad_peak_7960] which overlaps excluded region [chr12	37989447	38441828	centromeric_repeat	1000.000	.]
Excluding peak [chr12	118573678	118574095	both.broad_peak_9235] which overlaps excluded region [chr12	118573638	118573695	LSU-rRNA_Hsa	1000.000	.]
Excluding peak [chr12	127650467	127651165	both.broad_peak_9421] which overlaps excluded region [chr12	127650407	127651075	LSU-rRNA_Hsa	1000.000	.]
Excluding peak [chr14	32953483	32953821	both.broad_peak_10712] which overlaps excluded region [chr14	32953263	32954381	Low_mappability_island	1000.000	.]
Excluding peak [chr15	80444564	80445859	both.broad_peak_12630] which overlaps excluded region [chr15	80445513	80445569	(GAGTG)n	1000.000	.]
Excluding peak [chr16	60436	61192	both.broad_peak_12924] which overlaps excluded region [chr16	60058	61142	TAR1	1000.000	.]
Excluding peak [chr16	33866265	33866524	both.broad_peak_13513] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000.000	.]
Excluding peak [chr16	33918664	33919304	both.broad_peak_13514] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000.000	.]
Excluding peak [chr16	34009313	34009561	both.broad_peak_13515] which overlaps excluded region [chr16	33864355	34023306	centromeric_repeat	1000.000	.]
Excluding peak [chr16	46386270	46386795	both.broad_peak_13516] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46391235	46392140	both.broad_peak_13517] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46403548	46403849	both.broad_peak_13518] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46416804	46417405	both.broad_peak_13519] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr16	46427429	46427991	both.broad_peak_13520] which overlaps excluded region [chr16	46385718	46456668	Satellite_repeat	1000.000	.]
Excluding peak [chr17	22020593	22020916	both.broad_peak_14569] which overlaps excluded region [chr17	22018524	22032049	Low_mappability_island	1000.000	.]
Excluding peak [chr17	22252084	22253296	both.broad_peak_14570] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000.000	.]
Excluding peak [chr17	22261278	22261740	both.broad_peak_14571] which overlaps excluded region [chr17	22221073	22263006	centromeric_repeat	1000.000	.]
Excluding peak [chr17	25264883	25265249	both.broad_peak_14572] which overlaps excluded region [chr17	25263010	25268059	Satellite_repeat	1000.000	.]
Excluding peak [chr17	41381728	41382265	both.broad_peak_14950] which overlaps excluded region [chr17	41381502	41382591	High_Mappability_island	1000.000	.]
Excluding peak [chr17	41465631	41466936	both.broad_peak_14957] which overlaps excluded region [chr17	41465562	41467288	High_Mappability_island	1000.000	.]
Excluding peak [chr17	51183057	51183341	both.broad_peak_15172] which overlaps excluded region [chr17	51183038	51183763	Low_mappability_island	1000.000	.]
Excluding peak [chr17	58602907	58603721	both.broad_peak_15290] which overlaps excluded region [chr17	58603715	58603738	(GAGTG)n	1000.000	.]
Excluding peak [chr18	111564	112042	both.broad_peak_15816] which overlaps excluded region [chr18	105658	112233	Satellite_repeat	1000.000	.]
Excluding peak [chr18	18512827	18513193	both.broad_peak_16011] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000.000	.]
Excluding peak [chr18	18516045	18520399	both.broad_peak_16012] which overlaps excluded region [chr18	18510894	18520356	centromeric_repeat	1000.000	.]
Excluding peak [chr19	21776802	21777550	both.broad_peak_17342] which overlaps excluded region [chr19	21776132	21780768	BSR/Beta	1000.000	.]
Excluding peak [chr19	24169382	24170027	both.broad_peak_17364] which overlaps excluded region [chr19	24156856	24171961	BSR/Beta	1000.000	.]
Excluding peak [chr19	24474565	24474765	both.broad_peak_17369] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000.000	.]
Excluding peak [chr19	24526069	24526320	both.broad_peak_17370] which overlaps excluded region [chr19	24385474	24633168	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27731880	27733339	both.broad_peak_17371] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27738359	27738668	both.broad_peak_17372] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27756701	27756901	both.broad_peak_17373] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	27801311	27801531	both.broad_peak_17374] which overlaps excluded region [chr19	27730611	28262682	centromeric_repeat	1000.000	.]
Excluding peak [chr19	37784325	37784692	both.broad_peak_17536] which overlaps excluded region [chr19	37759473	37797722	centromeric_repeat	1000.000	.]
Excluding peak [chr19	42069917	42070450	both.broad_peak_17680] which overlaps excluded region [chr19	42069989	42071891	LSU-rRNA_Hsa	1000.000	.]
Excluding peak [chr2	89848588	89848836	both.broad_peak_19338] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000.000	.]
Excluding peak [chr2	89872032	89872646	both.broad_peak_19339] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000.000	.]
Excluding peak [chr2	89878336	89879257	both.broad_peak_19340] which overlaps excluded region [chr2	89830421	89880514	Satellite_repeat	1000.000	.]
Excluding peak [chr2	90449580	90449808	both.broad_peak_19342] which overlaps excluded region [chr2	90443001	90545431	Low_mappability_island	1000.000	.]
Excluding peak [chr2	91847848	91848177	both.broad_peak_19344] which overlaps excluded region [chr2	91847957	91848503	TAR1	1000.000	.]
Excluding peak [chr2	92272876	92273767	both.broad_peak_19345] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92281197	92281779	both.broad_peak_19346] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92284237	92284462	both.broad_peak_19347] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92290435	92291262	both.broad_peak_19348] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92296588	92297023	both.broad_peak_19349] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92305535	92305892	both.broad_peak_19350] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	92317234	92317870	both.broad_peak_19351] which overlaps excluded region [chr2	92267428	92326280	centromeric_repeat	1000.000	.]
Excluding peak [chr2	114361072	114362020	both.broad_peak_19697] which overlaps excluded region [chr2	114361054	114362417	TAR1	1000.000	.]
Excluding peak [chr2	132559385	132560425	both.broad_peak_19833] which overlaps excluded region [chr2	132560214	132560696	TAR1	1000.000	.]
Excluding peak [chr2	132996509	132996755	both.broad_peak_19834] which overlaps excluded region [chr2	132994855	133007983	ALR/Alpha	1000.000	.]
Excluding peak [chr2	149639210	149639450	both.broad_peak_19986] which overlaps excluded region [chr2	149639207	149639515	Low_mappability_island	1000.000	.]
Excluding peak [chr2	162135291	162136055	both.broad_peak_20150] which overlaps excluded region [chr2	162135000	162139241	Low_mappability_island	1000.000	.]
Excluding peak [chr20	26269111	26270030	both.broad_peak_21666] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26278258	26278484	both.broad_peak_21667] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26289332	26290609	both.broad_peak_21668] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26305634	26305887	both.broad_peak_21669] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	26317322	26318676	both.broad_peak_21670] which overlaps excluded region [chr20	26257032	26320267	centromeric_repeat	1000.000	.]
Excluding peak [chr20	29512475	29512675	both.broad_peak_21671] which overlaps excluded region [chr20	29511127	29514978	ALR/Alpha	1000.000	.]
Excluding peak [chr20	29517798	29518922	both.broad_peak_21672] which overlaps excluded region [chr20	29517710	29521147	centromeric_repeat	1000.000	.]
Excluding peak [chr20	29813756	29813985	both.broad_peak_21678] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000.000	.]
Excluding peak [chr20	29831826	29832026	both.broad_peak_21679] which overlaps excluded region [chr20	29803876	29833334	centromeric_repeat	1000.000	.]
Excluding peak [chr20	62917250	62917592	both.broad_peak_22240] which overlaps excluded region [chr20	62916702	62918053	telomeric_repeat	1000.000	.]
Excluding peak [chr21	9825749	9827187	both.broad_peak_22241] which overlaps excluded region [chr21	9825451	9827612	High_Mappability_island	1000.000	.]
Excluding peak [chr21	10773372	10773572	both.broad_peak_22242] which overlaps excluded region [chr21	10697886	10860890	centromeric_repeat	1000.000	.]
Excluding peak [chr21	11186125	11187338	both.broad_peak_22243] which overlaps excluded region [chr21	11186054	11188131	Satellite_repeat	1000.000	.]
Excluding peak [chr22	18878342	18878659	both.broad_peak_22759] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000.000	.]
Excluding peak [chr22	18879876	18880128	both.broad_peak_22760] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000.000	.]
Excluding peak [chr22	18883583	18883799	both.broad_peak_22761] which overlaps excluded region [chr22	18876789	18884510	Satellite_repeat	1000.000	.]
Excluding peak [chr22	22652231	22653042	both.broad_peak_22847] which overlaps excluded region [chr22	22652105	22652554	TAR1	1000.000	.]
Excluding peak [chr3	25508907	25509133	both.broad_peak_23723] which overlaps excluded region [chr3	25508897	25509131	Low_mappability_island	1000.000	.]
Excluding peak [chr3	73159761	73160669	both.broad_peak_24512] which overlaps excluded region [chr3	73159606	73161131	snRNA	1000.000	.]
Excluding peak [chr3	96336804	96337073	both.broad_peak_24578] which overlaps excluded region [chr3	96335934	96337436	Low_mappability_island	1000.000	.]
Excluding peak [chr3	196625608	196625808	both.broad_peak_25903] which overlaps excluded region [chr3	196625514	196625860	Satellite_repeat	1000.000	.]
Excluding peak [chr4	49094768	49094968	both.broad_peak_26437] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49107449	49107766	both.broad_peak_26438] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49122928	49123231	both.broad_peak_26439] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49151102	49151911	both.broad_peak_26440] which overlaps excluded region [chr4	49085372	49342114	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49645060	49645303	both.broad_peak_26441] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000.000	.]
Excluding peak [chr4	49659456	49659760	both.broad_peak_26442] which overlaps excluded region [chr4	49488472	49662085	centromeric_repeat	1000.000	.]
Excluding peak [chr4	56194226	56194485	both.broad_peak_26481] which overlaps excluded region [chr4	56194229	56194584	Low_mappability_island	1000.000	.]
Excluding peak [chr4	68264592	68266730	both.broad_peak_26530] which overlaps excluded region [chr4	68264186	68266830	centromeric_repeat	1000.000	.]
Excluding peak [chr4	191032545	191032745	both.broad_peak_27751] which overlaps excluded region [chr4	191026302	191044344	telomeric_repeat	1000.000	.]
Excluding peak [chr5	46364115	46364315	both.broad_peak_28116] which overlaps excluded region [chr5	45908253	46411114	centromeric_repeat	1000.000	.]
Excluding peak [chr5	49450550	49450756	both.broad_peak_28117] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000.000	.]
Excluding peak [chr5	49547478	49547699	both.broad_peak_28118] which overlaps excluded region [chr5	49405493	49554574	centromeric_repeat	1000.000	.]
Excluding peak [chr5	134259765	134260404	both.broad_peak_29117] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000.000	.]
Excluding peak [chr5	134262625	134262877	both.broad_peak_29118] which overlaps excluded region [chr5	134258949	134264271	Low_mappability_island	1000.000	.]
Excluding peak [chr6	58776533	58779369	both.broad_peak_30874] which overlaps excluded region [chr6	58745955	58780547	centromeric_repeat	1000.000	.]
Excluding peak [chr7	43878412	43878832	both.broad_peak_32927] which overlaps excluded region [chr7	43878355	43878530	TAR1	1000.000	.]
Excluding peak [chr7	45291476	45291676	both.broad_peak_32976] which overlaps excluded region [chr7	45291517	45291740	Low_mappability_island	1000.000	.]
Excluding peak [chr7	57549361	57549585	both.broad_peak_33054] which overlaps excluded region [chr7	57544726	57556913	Satellite_repeat	1000.000	.]
Excluding peak [chr7	57957789	57957996	both.broad_peak_33055] which overlaps excluded region [chr7	57939184	58055539	centromeric_repeat	1000.000	.]
Excluding peak [chr7	61968705	61969761	both.broad_peak_33056] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000.000	.]
Excluding peak [chr7	61986136	61986336	both.broad_peak_33057] which overlaps excluded region [chr7	61054285	62454680	centromeric_repeat	1000.000	.]
Excluding peak [chr7	64099785	64100002	both.broad_peak_33067] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000.000	.]
Excluding peak [chr7	64100838	64101105	both.broad_peak_33068] which overlaps excluded region [chr7	64090864	64105357	BSR/Beta	1000.000	.]
Excluding peak [chr7	100550706	100551292	both.broad_peak_33481] which overlaps excluded region [chr7	100550640	100551321	Low_mappability_island	1000.000	.]
Excluding peak [chr8	43092778	43097038	both.broad_peak_34830] which overlaps excluded region [chr8	43092737	43097573	Satellite_repeat	1000.000	.]
Excluding peak [chr8	43779474	43779699	both.broad_peak_34831] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	43794100	43794746	both.broad_peak_34832] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	43820539	43820739	both.broad_peak_34833] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	43821992	43822192	both.broad_peak_34834] which overlaps excluded region [chr8	43399486	43843604	centromeric_repeat	1000.000	.]
Excluding peak [chr8	46845309	46845549	both.broad_peak_34835] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000.000	.]
Excluding peak [chr8	46852362	46852861	both.broad_peak_34836] which overlaps excluded region [chr8	46838215	47457541	centromeric_repeat	1000.000	.]
Excluding peak [chr8	100507997	100508253	both.broad_peak_35355] which overlaps excluded region [chr8	100508010	100508287	Low_mappability_island	1000.000	.]
Excluding peak [chr9	45356920	45357350	both.broad_peak_36413] which overlaps excluded region [chr9	45355954	45357644	telomeric_repeat	1000.000	.]
Excluding peak [chr9	45439723	45439970	both.broad_peak_36414] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000.000	.]
Excluding peak [chr9	45441747	45442443	both.broad_peak_36415] which overlaps excluded region [chr9	45435109	45443517	centromeric_repeat	1000.000	.]
Excluding peak [chr9	66494045	66494608	both.broad_peak_36419] which overlaps excluded region [chr9	66494170	66494805	TAR1	1000.000	.]
Excluding peak [chr9	66824178	66824684	both.broad_peak_36421] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000.000	.]
Excluding peak [chr9	66833083	66833633	both.broad_peak_36422] which overlaps excluded region [chr9	66767710	66864329	centromeric_repeat	1000.000	.]
Excluding peak [chr9	67339988	67340844	both.broad_peak_36425] which overlaps excluded region [chr9	67340080	67340661	TAR1	1000.000	.]
Excluding peak [chr9	68377361	68377574	both.broad_peak_36426] which overlaps excluded region [chr9	68376841	68377466	TAR1	1000.000	.]
Excluding peak [chr9	68412991	68414393	both.broad_peak_36427] which overlaps excluded region [chr9	68410775	68435115	Low_mappability_island	1000.000	.]
Excluding peak [chr9	70648541	70648768	both.broad_peak_36436] which overlaps excluded region [chr9	70648394	70648886	TAR1	1000.000	.]
chr1 peak count: 3667
chr2 peak count: 3154
chr3 peak count: 2528
chr4 peak count: 1814
chr5 peak count: 2042
chr6 peak count: 2483
chr7 peak count: 1999
chr8 peak count: 1647
chr9 peak count: 1475
chr10 peak count: 1815
chr11 peak count: 1878
chr12 peak count: 2078
chr13 peak count: 1026
chr14 peak count: 1275
chr15 peak count: 1140
chr16 peak count: 1211
chr17 peak count: 1664
chr18 peak count: 772
chr19 peak count: 1595
chr20 peak count: 864
chr21 peak count: 487
chr22 peak count: 662
Loaded 37276 peaks in 28.486 seconds. (1308.588 peaks/second).

New maximum proper pair fragment length: 42 from [SRR891275.608	1123	chr1	569907	57	42M	=	569907	42	CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA	@@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG	XA:Z:chrM,+9359,42M,1;	MD:Z:42	NM:i:0	AS:i:42	XS:i:37	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 330 from [SRR891278.50	1123	chr1	569913	27	50M	=	570193	330	NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC	#1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH	XA:Z:chrM,+9365,50M,2;	MD:Z:0C49	NM:i:1	AS:i:49	XS:i:44	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 361 from [SRR891278.227	99	chr1	17047555	60	50M	=	17047866	361	GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT	@CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC	XA:Z:chr1,+144886802,48M2S,2;	MD:Z:50	NM:i:0	AS:i:50	XS:i:42	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 562 from [SRR891275.385	163	chr1	43042844	60	50M	=	43043356	562	AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA	CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII	MD:Z:50	NM:i:0	AS:i:50	XS:i:0	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 609 from [SRR891275.714	99	chr1	79875808	60	50M	=	79876367	609	GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG	@@@DDDFFFHAH<EFGGGG@EGECHIDHHAE<<*11?DB?9*?*:336?B	MD:Z:50	NM:i:0	AS:i:50	XS:i:30	RG:Z:SRR891275	PG:Z:MarkDuplicates]
New maximum proper pair fragment length: 633 from [SRR891278.342	99	chr2	4228733	60	50M	=	4229316	633	CATTTAATGCAAACTAATCTAGCTATTATCATCTGGAGCTGCAGGCTATA	CCCFFFFDHHGFHABDIGIIEGIIGCHCHIIIIIGHAEF):CCF;F;BDH	MD:Z:50	NM:i:0	AS:i:50	XS:i:20	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
New maximum proper pair fragment length: 649 from [SRR891278.1592	99	chr2	55845390	60	50M	=	55845989	649	GTGTGTTGACGATTTCCTGTTTCTTGCAGAGCGATTCACCGTTAAGGCTC	;1=+AB3BB<<?AC?EEAE+3A<B4CC93*:9C)?;DBD?68)?######	MD:Z:33C16	NM:i:1	AS:i:45	XS:i:0	RG:Z:SRR891278	PG:Z:MarkDuplicates-4FB7F45F]
Analyzed 1040 reads in 0.048 seconds (21497.848 reads/second).

ataqv 1.3.1

Operating parameters
====================
Thread limit: 1
Ignoring read groups: yes
Is single nucleus: no

Experiment information
======================
Organism: human
Description: a collector for unit tests
URL: https://theparkerlab.org

Reference genome configuration
==============================
Mitochondrial reference: chrM
Autosomal references: 
  1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
  20, 21, 22, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9,
  chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18,
  chr19, chr20, chr21, chr22


Read Group
==========
ID: Test collector
Library: Test collector
Sample: Test collector
Description: a library of brutal tests?

Sequencing center: 
Sequencing date: 
Sequencing platform: 
Platform model: 
Platform unit: 
Flow order: 
Key sequence: 
Predicted median insert size: 
Programs: 

Metrics
-------

  Read Mapping Metrics
  --------------------
  Total reads: 1040
  Total problems: 194 (18.654%)
  Properly paired and mapped reads: 846 (81.346%)
  Secondary reads: 20 (1.923%)
  Supplementary reads: 0 (0.000%)
  Duplicate reads: 313 (30.096% of all reads)

  Quality Indicators
  ------------------
  Short to mononucleosomal ratio: 1.783
  High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 400
    as a percentage of autosomal reads: 91.533%
    as a percentage of all reads: 38.462%

  Paired Read Metrics
  -------------------
  Paired reads: 1040 (100.000%)
  Paired and mapped reads: 864 (83.077%)
  FR reads: 846 (81.346154%)
  First of pair: 519 (49.904%)
  Second of pair: 521 (50.096%)
  Forward reads: 529 (50.865%)
  Reverse reads: 511 (49.135%)
  Forward mate reads: 521 (50.096%)
  Reverse mate reads: 519 (49.904%)

  Unmapped Read Metrics
  ---------------------
  Unmapped reads:                       17 (1.635%)
  Unmapped mate reads:                  6 (0.577%)
  Reads not passing quality controls:   0 (0.000%)
  Unpaired reads:                       0 (0.000%)
  Reads with zero mapping quality:      111 (10.673%)

  Aberrant Mapping Metrics
  ------------------------
  RF reads:                             15 (1.442308%)
  FF reads:                             10 (0.961538%)
  RR reads:                             17 (1.634615%)
  Reads that paired and mapped but...   
    on different chromosomes:           14 (1.346%)
    probably too far from their mates:  4 (0.385%) (longest proper fragment seems to be 649)
    just not properly:                  0 (0.000%)

  Autosomal/Mitochondrial Metrics
  -------------------------------
  Total autosomal reads: 437 (42.019% of all reads)
  Total mitochondrial reads: 369 (35.481% of all reads)
  Duplicate autosomal reads: 35 (8.009% of all autosomal reads)
  Duplicate mitochondrial reads: 185 (50.136% of all mitochondrial reads)


  Mapping Quality
  ---------------
  Mean MAPQ: 47.538
  Median MAPQ: 60.000
  Reads with MAPQ >=...
                   5: 888 (85.385%)
                  10: 884 (85.000%)
                  15: 881 (84.712%)
                  20: 878 (84.423%)
                  25: 877 (84.327%)
                  30: 837 (80.481%)

  Peak Metrics
  ------------
  Peak count: 37276

  High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments)
  Number of high quality autosomal alignments overlapping the top 10,000 peaks: 
          Top peak: 2 (0.500% of all high quality autosomal alignments)
      Top 10 peaks: 20 (5.000% of all high quality autosomal alignments)
     Top 100 peaks: 115 (28.750% of all high quality autosomal alignments)
    Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments)
  Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments)


Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Collecting metrics from test.bam.

Logging problematic reads to Test collector.problems.

Loading peaks for read group Test collector from notthere.peaks.gz.
Read 411 excluded regions from exclude.dac.bed.gz.
Read 1649 excluded regions from exclude.duke.bed.gz.
Loading TSS file 'notthere.bed.gz'.
===============================================================================
All tests passed (241 assertions in 54 test cases)

make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
   create-stamp debian/debhelper-build-stamp
   dh_prep
   debian/rules override_dh_auto_install
make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
dh_auto_install -- prefix=/usr
	make -j10 install DESTDIR=/build/reproducible-path/ataqv-1.3.1\+ds/debian/ataqv AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" prefix=/usr
make[2]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
Installing to /usr
install -d -m 0755 /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin
install -d -m 0755 /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin
install -d -m 0755 /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web
for f in src/scripts/make_ataqv_pipeline src/scripts/mkarv src/scripts/run_ataqv_example src/scripts/srvarv; do sed -e 's/{{VERSION}}/1.3.1/g' $f > build/$(basename $f); install -m 0755 build/$(basename $f) /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin; done
install -m 0755 build/ataqv /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin
cp -a src/web/* /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web
find /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web -type d -exec chmod 755 {} \;
find /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web -type f -exec chmod 644 {} \;
make[2]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
   dh_install
   dh_installdocs
   dh_installchangelogs
   dh_installexamples
   debian/rules override_dh_installman
make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds'
help2man --no-info --name="QC metrics for ATAC-seq data" build/ataqv > debian/ataqv.1
help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1
help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.3.1+ds src/scripts/srvarv > debian/srvarv.1
dh_installman
make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds'
   dh_perl
   dh_link
   dh_strip_nondeterminism
   dh_compress
   dh_fixperms
   dh_missing
   dh_dwz -a
   dh_strip -a
   dh_makeshlibs -a
   dh_shlibdeps -a
dpkg-shlibdeps: warning: diversions involved - output may be incorrect
 diversion by libc6 from: /lib/ld-linux.so.2
dpkg-shlibdeps: warning: diversions involved - output may be incorrect
 diversion by libc6 to: /lib/ld-linux.so.2.usr-is-merged
   dh_installdeb
   dh_gencontrol
   dh_md5sums
   dh_builddeb
dpkg-deb: building package 'ataqv-dbgsym' in '../ataqv-dbgsym_1.3.1+ds-2_i386.deb'.
dpkg-deb: building package 'ataqv' in '../ataqv_1.3.1+ds-2_i386.deb'.
 dpkg-genbuildinfo --build=binary -O../ataqv_1.3.1+ds-2_i386.buildinfo
 dpkg-genchanges --build=binary -O../ataqv_1.3.1+ds-2_i386.changes
dpkg-genchanges: info: binary-only upload (no source code included)
 dpkg-source --after-build .
dpkg-buildpackage: info: binary-only upload (no source included)
dpkg-genchanges: info: not including original source code in upload
I: copying local configuration
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/B01_cleanup starting
I: user script /srv/workspace/pbuilder/12918/tmp/hooks/B01_cleanup finished
I: unmounting dev/ptmx filesystem
I: unmounting dev/pts filesystem
I: unmounting dev/shm filesystem
I: unmounting proc filesystem
I: unmounting sys filesystem
I: cleaning the build env 
I: removing directory /srv/workspace/pbuilder/12918 and its subdirectories
I: Current time: Sun Feb 23 03:14:56 +14 2025
I: pbuilder-time-stamp: 1740230096