I: pbuilder: network access will be disabled during build I: Current time: Thu Mar 5 15:55:51 +14 2026 I: pbuilder-time-stamp: 1772675751 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/unstable-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [ataqv_1.3.1+ds-2.dsc] I: copying [./ataqv_1.3.1+ds.orig.tar.xz] I: copying [./ataqv_1.3.1+ds-2.debian.tar.xz] I: Extracting source dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2.dsc: unsupported subcommand dpkg-source: info: extracting ataqv in ataqv-1.3.1+ds dpkg-source: info: unpacking ataqv_1.3.1+ds.orig.tar.xz dpkg-source: info: unpacking ataqv_1.3.1+ds-2.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying modernize dpkg-source: info: applying no_cov dpkg-source: info: applying python3 dpkg-source: info: applying packaged_js dpkg-source: info: applying spelling dpkg-source: info: applying clean_less dpkg-source: info: applying reproducible_build I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/226865/tmp/hooks/D01_modify_environment starting debug: Running on codethink03-arm64. I: Changing host+domainname to test build reproducibility I: Adding a custom variable just for the fun of it... I: Changing /bin/sh to bash '/bin/sh' -> '/bin/bash' lrwxrwxrwx 1 root root 9 Mar 5 01:55 /bin/sh -> /bin/bash I: Setting pbuilder2's login shell to /bin/bash I: Setting pbuilder2's GECOS to second user,second room,second work-phone,second home-phone,second other I: user script /srv/workspace/pbuilder/226865/tmp/hooks/D01_modify_environment finished I: user script /srv/workspace/pbuilder/226865/tmp/hooks/D02_print_environment starting I: set BASH=/bin/sh BASHOPTS=checkwinsize:cmdhist:complete_fullquote:extquote:force_fignore:globasciiranges:globskipdots:hostcomplete:interactive_comments:patsub_replacement:progcomp:promptvars:sourcepath BASH_ALIASES=() BASH_ARGC=() BASH_ARGV=() BASH_CMDS=() BASH_LINENO=([0]="12" [1]="0") BASH_LOADABLES_PATH=/usr/local/lib/bash:/usr/lib/bash:/opt/local/lib/bash:/usr/pkg/lib/bash:/opt/pkg/lib/bash:. BASH_SOURCE=([0]="/tmp/hooks/D02_print_environment" [1]="/tmp/hooks/D02_print_environment") BASH_VERSINFO=([0]="5" [1]="2" [2]="37" [3]="1" [4]="release" [5]="aarch64-unknown-linux-gnu") BASH_VERSION='5.2.37(1)-release' BUILDDIR=/build/reproducible-path BUILDUSERGECOS='second user,second room,second work-phone,second home-phone,second other' BUILDUSERNAME=pbuilder2 BUILD_ARCH=arm64 DEBIAN_FRONTEND=noninteractive DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=12 ' DIRSTACK=() DISTRIBUTION=unstable EUID=0 FUNCNAME=([0]="Echo" [1]="main") GROUPS=() HOME=/root HOSTNAME=i-capture-the-hostname HOSTTYPE=aarch64 HOST_ARCH=arm64 IFS=' ' INVOCATION_ID=5eb40ad07db64189806695bd230de361 LANG=C LANGUAGE=nl_BE:nl LC_ALL=C MACHTYPE=aarch64-unknown-linux-gnu MAIL=/var/mail/root OPTERR=1 OPTIND=1 OSTYPE=linux-gnu PATH=/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path PBCURRENTCOMMANDLINEOPERATION=build PBUILDER_OPERATION=build PBUILDER_PKGDATADIR=/usr/share/pbuilder PBUILDER_PKGLIBDIR=/usr/lib/pbuilder PBUILDER_SYSCONFDIR=/etc PIPESTATUS=([0]="0") POSIXLY_CORRECT=y PPID=226865 PS4='+ ' PWD=/ SHELL=/bin/bash SHELLOPTS=braceexpand:errexit:hashall:interactive-comments:posix SHLVL=3 SUDO_COMMAND='/usr/bin/timeout -k 24.1h 24h /usr/bin/ionice -c 3 /usr/bin/nice -n 11 /usr/bin/unshare --uts -- /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.63zlH0W8/pbuilderrc_xEBm --distribution unstable --hookdir /etc/pbuilder/rebuild-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/unstable-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.63zlH0W8/b2 --logfile b2/build.log ataqv_1.3.1+ds-2.dsc' SUDO_GID=109 SUDO_UID=104 SUDO_USER=jenkins TERM=unknown TZ=/usr/share/zoneinfo/Etc/GMT-14 UID=0 USER=root _='I: set' http_proxy=http://192.168.101.4:3128 I: uname -a Linux i-capture-the-hostname 6.1.0-30-cloud-arm64 #1 SMP Debian 6.1.124-1 (2025-01-12) aarch64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Nov 22 2024 /bin -> usr/bin I: user script /srv/workspace/pbuilder/226865/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: arm64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19956 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on libboost-filesystem-dev; however: Package libboost-filesystem-dev is not installed. pbuilder-satisfydepends-dummy depends on libboost-iostreams-dev; however: Package libboost-iostreams-dev is not installed. pbuilder-satisfydepends-dummy depends on libboost-system-dev; however: Package libboost-system-dev is not installed. pbuilder-satisfydepends-dummy depends on libboost-chrono-dev; however: Package libboost-chrono-dev is not installed. pbuilder-satisfydepends-dummy depends on libhts-dev; however: Package libhts-dev is not installed. pbuilder-satisfydepends-dummy depends on libncurses-dev; however: Package libncurses-dev is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. pbuilder-satisfydepends-dummy depends on libjs-jquery; however: Package libjs-jquery is not installed. pbuilder-satisfydepends-dummy depends on libjs-jquery-datatables; however: Package libjs-jquery-datatables is not installed. pbuilder-satisfydepends-dummy depends on libjs-jquery-datatables-extensions; however: Package libjs-jquery-datatables-extensions is not installed. pbuilder-satisfydepends-dummy depends on fonts-font-awesome; however: Package fonts-font-awesome is not installed. pbuilder-satisfydepends-dummy depends on node-normalize.css; however: Package node-normalize.css is not installed. pbuilder-satisfydepends-dummy depends on help2man; however: Package help2man is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on node-d3; however: Package node-d3 is not installed. pbuilder-satisfydepends-dummy depends on debhelper; however: Package debhelper is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} comerr-dev{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} fonts-font-awesome{a} gettext{a} gettext-base{a} groff-base{a} help2man{a} icu-devtools{a} intltool-debian{a} krb5-multidev{a} libarchive-zip-perl{a} libboost-atomic1.83-dev{a} libboost-atomic1.83.0{a} libboost-chrono-dev{a} libboost-chrono1.83-dev{a} libboost-chrono1.83.0t64{a} libboost-filesystem-dev{a} libboost-filesystem1.83-dev{a} libboost-filesystem1.83.0{a} libboost-iostreams-dev{a} libboost-iostreams1.83-dev{a} libboost-regex1.83-dev{a} libboost-regex1.83.0{a} libboost-system-dev{a} libboost-system1.83-dev{a} libboost-system1.83.0{a} libboost1.83-dev{a} libbrotli-dev{a} libbrotli1{a} libbz2-dev{a} libcom-err2{a} libcurl3t64-gnutls{a} libcurl4-gnutls-dev{a} libdebhelper-perl{a} libdeflate-dev{a} libdeflate0{a} libelf1t64{a} libevent-2.1-7t64{a} libexpat1{a} libffi8{a} libfile-stripnondeterminism-perl{a} libgmp-dev{a} libgmpxx4ldbl{a} libgnutls-dane0t64{a} libgnutls-openssl27t64{a} libgnutls28-dev{a} libgnutls30t64{a} libgssapi-krb5-2{a} libgssrpc4t64{a} libhts-dev{a} libhts3t64{a} libhtscodecs2{a} libicu-dev{a} libicu72{a} libidn2-0{a} libidn2-dev{a} libjs-d3-format{a} libjs-jquery{a} libjs-jquery-datatables{a} libjs-jquery-datatables-extensions{a} libk5crypto3{a} libkadm5clnt-mit12{a} libkadm5srv-mit12{a} libkdb5-10t64{a} libkeyutils1{a} libkrb5-3{a} libkrb5-dev{a} libkrb5support0{a} libldap-dev{a} libldap2{a} liblocale-gettext-perl{a} liblzma-dev{a} libmagic-mgc{a} libmagic1t64{a} libncurses-dev{a} libncurses6{a} libnghttp2-14{a} libnghttp2-dev{a} libnghttp3-9{a} libnghttp3-dev{a} libngtcp2-16{a} libngtcp2-crypto-gnutls-dev{a} libngtcp2-crypto-gnutls8{a} libngtcp2-dev{a} libp11-kit-dev{a} libp11-kit0{a} libpipeline1{a} libpkgconf3{a} libpsl-dev{a} libpsl5t64{a} libpython3-stdlib{a} libpython3.13-minimal{a} libpython3.13-stdlib{a} libreadline8t64{a} librtmp-dev{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libssh2-1-dev{a} libssh2-1t64{a} libssl-dev{a} libtasn1-6{a} libtasn1-6-dev{a} libtool{a} libuchardet0{a} libunbound8{a} libunistring5{a} libxml2{a} libzstd-dev{a} m4{a} man-db{a} media-types{a} netbase{a} nettle-dev{a} node-commander{a} node-d3{a} node-d3-array{a} node-d3-axis{a} node-d3-brush{a} node-d3-chord{a} node-d3-collection{a} node-d3-color{a} node-d3-contour{a} node-d3-dispatch{a} node-d3-drag{a} node-d3-dsv{a} node-d3-ease{a} node-d3-fetch{a} node-d3-force{a} node-d3-format{a} node-d3-geo{a} node-d3-hierarchy{a} node-d3-interpolate{a} node-d3-path{a} node-d3-polygon{a} node-d3-quadtree{a} node-d3-queue{a} node-d3-random{a} node-d3-scale{a} node-d3-scale-chromatic{a} node-d3-selection{a} node-d3-shape{a} node-d3-time{a} node-d3-time-format{a} node-d3-timer{a} node-d3-transition{a} node-d3-voronoi{a} node-d3-zoom{a} node-iconv-lite{a} node-normalize.css{a} node-rw{a} node-safe-buffer{a} pkgconf{a} pkgconf-bin{a} po-debconf{a} python3{a} python3-minimal{a} python3.13{a} python3.13-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: bzip2-doc ca-certificates curl javascript-common krb5-locales libarchive-cpio-perl libgpm2 libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules libtasn1-doc lynx publicsuffix wget 0 packages upgraded, 172 newly installed, 0 to remove and 0 not upgraded. Need to get 73.1 MB of archives. After unpacking 430 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian unstable/main arm64 liblocale-gettext-perl arm64 1.07-7+b1 [15.2 kB] Get: 2 http://deb.debian.org/debian unstable/main arm64 libpython3.13-minimal arm64 3.13.1-3 [852 kB] Get: 3 http://deb.debian.org/debian unstable/main arm64 libexpat1 arm64 2.6.4-1 [90.7 kB] Get: 4 http://deb.debian.org/debian unstable/main arm64 python3.13-minimal arm64 3.13.1-3 [1990 kB] Get: 5 http://deb.debian.org/debian unstable/main arm64 python3-minimal arm64 3.13.1-2 [27.0 kB] Get: 6 http://deb.debian.org/debian unstable/main arm64 media-types all 10.1.0 [26.9 kB] Get: 7 http://deb.debian.org/debian unstable/main arm64 netbase all 6.4 [12.8 kB] Get: 8 http://deb.debian.org/debian unstable/main arm64 tzdata all 2025a-1 [259 kB] Get: 9 http://deb.debian.org/debian unstable/main arm64 libffi8 arm64 3.4.6-1 [20.9 kB] Get: 10 http://deb.debian.org/debian unstable/main arm64 readline-common all 8.2-6 [69.4 kB] Get: 11 http://deb.debian.org/debian unstable/main arm64 libreadline8t64 arm64 8.2-6 [159 kB] Get: 12 http://deb.debian.org/debian unstable/main arm64 libpython3.13-stdlib arm64 3.13.1-3 [1912 kB] Get: 13 http://deb.debian.org/debian unstable/main arm64 python3.13 arm64 3.13.1-3 [740 kB] Get: 14 http://deb.debian.org/debian unstable/main arm64 libpython3-stdlib arm64 3.13.1-2 [9952 B] Get: 15 http://deb.debian.org/debian unstable/main arm64 python3 arm64 3.13.1-2 [28.0 kB] Get: 16 http://deb.debian.org/debian unstable/main arm64 sensible-utils all 0.0.24 [24.8 kB] Get: 17 http://deb.debian.org/debian unstable/main arm64 libmagic-mgc arm64 1:5.45-3+b1 [314 kB] Get: 18 http://deb.debian.org/debian unstable/main arm64 libmagic1t64 arm64 1:5.45-3+b1 [102 kB] Get: 19 http://deb.debian.org/debian unstable/main arm64 file arm64 1:5.45-3+b1 [43.4 kB] Get: 20 http://deb.debian.org/debian unstable/main arm64 gettext-base arm64 0.23.1-1 [241 kB] Get: 21 http://deb.debian.org/debian unstable/main arm64 libuchardet0 arm64 0.0.8-1+b2 [69.2 kB] Get: 22 http://deb.debian.org/debian unstable/main arm64 groff-base arm64 1.23.0-7 [1129 kB] Get: 23 http://deb.debian.org/debian unstable/main arm64 bsdextrautils arm64 2.40.4-2 [91.5 kB] Get: 24 http://deb.debian.org/debian unstable/main arm64 libpipeline1 arm64 1.5.8-1 [40.2 kB] Get: 25 http://deb.debian.org/debian unstable/main arm64 man-db arm64 2.13.0-1 [1404 kB] Get: 26 http://deb.debian.org/debian unstable/main arm64 m4 arm64 1.4.19-5 [284 kB] Get: 27 http://deb.debian.org/debian unstable/main arm64 autoconf all 2.72-3 [493 kB] Get: 28 http://deb.debian.org/debian unstable/main arm64 autotools-dev all 20220109.1 [51.6 kB] Get: 29 http://deb.debian.org/debian unstable/main arm64 automake all 1:1.17-2 [861 kB] Get: 30 http://deb.debian.org/debian unstable/main arm64 autopoint all 0.23.1-1 [770 kB] Get: 31 http://deb.debian.org/debian unstable/main arm64 libcom-err2 arm64 1.47.2-1 [23.9 kB] Get: 32 http://deb.debian.org/debian unstable/main arm64 comerr-dev arm64 2.1-1.47.2-1 [55.9 kB] Get: 33 http://deb.debian.org/debian unstable/main arm64 libdebhelper-perl all 13.24.1 [90.9 kB] Get: 34 http://deb.debian.org/debian unstable/main arm64 libtool all 2.5.4-2.1 [539 kB] Get: 35 http://deb.debian.org/debian unstable/main arm64 dh-autoreconf all 20 [17.1 kB] Get: 36 http://deb.debian.org/debian unstable/main arm64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 37 http://deb.debian.org/debian unstable/main arm64 libfile-stripnondeterminism-perl all 1.14.1-1 [19.6 kB] Get: 38 http://deb.debian.org/debian unstable/main arm64 dh-strip-nondeterminism all 1.14.1-1 [8584 B] Get: 39 http://deb.debian.org/debian unstable/main arm64 libelf1t64 arm64 0.192-4 [189 kB] Get: 40 http://deb.debian.org/debian unstable/main arm64 dwz arm64 0.15-1+b1 [102 kB] Get: 41 http://deb.debian.org/debian unstable/main arm64 libunistring5 arm64 1.3-1 [449 kB] Get: 42 http://deb.debian.org/debian unstable/main arm64 libicu72 arm64 72.1-6 [9239 kB] Get: 43 http://deb.debian.org/debian unstable/main arm64 libxml2 arm64 2.12.7+dfsg+really2.9.14-0.2+b1 [630 kB] Get: 44 http://deb.debian.org/debian unstable/main arm64 gettext arm64 0.23.1-1 [1610 kB] Get: 45 http://deb.debian.org/debian unstable/main arm64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 46 http://deb.debian.org/debian unstable/main arm64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 47 http://deb.debian.org/debian unstable/main arm64 debhelper all 13.24.1 [920 kB] Get: 48 http://deb.debian.org/debian unstable/main arm64 fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [517 kB] Get: 49 http://deb.debian.org/debian unstable/main arm64 help2man arm64 1.49.3+b1 [198 kB] Get: 50 http://deb.debian.org/debian unstable/main arm64 icu-devtools arm64 72.1-6 [196 kB] Get: 51 http://deb.debian.org/debian unstable/main arm64 libkrb5support0 arm64 1.21.3-4 [32.2 kB] Get: 52 http://deb.debian.org/debian unstable/main arm64 libk5crypto3 arm64 1.21.3-4 [81.5 kB] Get: 53 http://deb.debian.org/debian unstable/main arm64 libkeyutils1 arm64 1.6.3-4 [9352 B] Get: 54 http://deb.debian.org/debian unstable/main arm64 libkrb5-3 arm64 1.21.3-4 [308 kB] Get: 55 http://deb.debian.org/debian unstable/main arm64 libgssapi-krb5-2 arm64 1.21.3-4 [127 kB] Get: 56 http://deb.debian.org/debian unstable/main arm64 libgssrpc4t64 arm64 1.21.3-4 [56.9 kB] Get: 57 http://deb.debian.org/debian unstable/main arm64 libkadm5clnt-mit12 arm64 1.21.3-4 [41.0 kB] Get: 58 http://deb.debian.org/debian unstable/main arm64 libkdb5-10t64 arm64 1.21.3-4 [41.0 kB] Get: 59 http://deb.debian.org/debian unstable/main arm64 libkadm5srv-mit12 arm64 1.21.3-4 [53.1 kB] Get: 60 http://deb.debian.org/debian unstable/main arm64 krb5-multidev arm64 1.21.3-4 [126 kB] Get: 61 http://deb.debian.org/debian unstable/main arm64 libboost1.83-dev arm64 1.83.0-4 [10.6 MB] Get: 62 http://deb.debian.org/debian unstable/main arm64 libboost-atomic1.83.0 arm64 1.83.0-4 [233 kB] Get: 63 http://deb.debian.org/debian unstable/main arm64 libboost-atomic1.83-dev arm64 1.83.0-4 [234 kB] Get: 64 http://deb.debian.org/debian unstable/main arm64 libboost-chrono1.83.0t64 arm64 1.83.0-4 [239 kB] Get: 65 http://deb.debian.org/debian unstable/main arm64 libboost-chrono1.83-dev arm64 1.83.0-4 [245 kB] Get: 66 http://deb.debian.org/debian unstable/main arm64 libboost-chrono-dev arm64 1.83.0.2+b2 [4212 B] Get: 67 http://deb.debian.org/debian unstable/main arm64 libboost-filesystem1.83.0 arm64 1.83.0-4 [273 kB] Get: 68 http://deb.debian.org/debian unstable/main arm64 libboost-system1.83.0 arm64 1.83.0-4 [231 kB] Get: 69 http://deb.debian.org/debian unstable/main arm64 libboost-system1.83-dev arm64 1.83.0-4 [231 kB] Get: 70 http://deb.debian.org/debian unstable/main arm64 libboost-filesystem1.83-dev arm64 1.83.0-4 [293 kB] Get: 71 http://deb.debian.org/debian unstable/main arm64 libboost-filesystem-dev arm64 1.83.0.2+b2 [3616 B] Get: 72 http://deb.debian.org/debian unstable/main arm64 libboost-regex1.83.0 arm64 1.83.0-4 [314 kB] Get: 73 http://deb.debian.org/debian unstable/main arm64 libicu-dev arm64 72.1-6 [10.3 MB] Get: 74 http://deb.debian.org/debian unstable/main arm64 libboost-regex1.83-dev arm64 1.83.0-4 [338 kB] Get: 75 http://deb.debian.org/debian unstable/main arm64 libboost-iostreams1.83-dev arm64 1.83.0-4 [261 kB] Get: 76 http://deb.debian.org/debian unstable/main arm64 libboost-iostreams-dev arm64 1.83.0.2+b2 [3568 B] Get: 77 http://deb.debian.org/debian unstable/main arm64 libboost-system-dev arm64 1.83.0.2+b2 [3720 B] Get: 78 http://deb.debian.org/debian unstable/main arm64 libbrotli1 arm64 1.1.0-2+b6 [297 kB] Get: 79 http://deb.debian.org/debian unstable/main arm64 libbrotli-dev arm64 1.1.0-2+b6 [308 kB] Get: 80 http://deb.debian.org/debian unstable/main arm64 libbz2-dev arm64 1.0.8-6 [31.9 kB] Get: 81 http://deb.debian.org/debian unstable/main arm64 libidn2-0 arm64 2.3.7-2+b1 [127 kB] Get: 82 http://deb.debian.org/debian unstable/main arm64 libp11-kit0 arm64 0.25.5-3 [409 kB] Get: 83 http://deb.debian.org/debian unstable/main arm64 libtasn1-6 arm64 4.19.0-3+b3 [46.9 kB] Get: 84 http://deb.debian.org/debian unstable/main arm64 libgnutls30t64 arm64 3.8.8-2 [1363 kB] Get: 85 http://deb.debian.org/debian unstable/main arm64 libsasl2-modules-db arm64 2.1.28+dfsg1-8+b1 [20.3 kB] Get: 86 http://deb.debian.org/debian unstable/main arm64 libsasl2-2 arm64 2.1.28+dfsg1-8+b1 [55.7 kB] Get: 87 http://deb.debian.org/debian unstable/main arm64 libldap2 arm64 2.6.9+dfsg-1 [179 kB] Get: 88 http://deb.debian.org/debian unstable/main arm64 libnghttp2-14 arm64 1.64.0-1 [71.3 kB] Get: 89 http://deb.debian.org/debian unstable/main arm64 libnghttp3-9 arm64 1.6.0-2 [60.5 kB] Get: 90 http://deb.debian.org/debian unstable/main arm64 libngtcp2-16 arm64 1.9.1-1 [109 kB] Get: 91 http://deb.debian.org/debian unstable/main arm64 libngtcp2-crypto-gnutls8 arm64 1.9.1-1 [17.3 kB] Get: 92 http://deb.debian.org/debian unstable/main arm64 libpsl5t64 arm64 0.21.2-1.1+b1 [57.1 kB] Get: 93 http://deb.debian.org/debian unstable/main arm64 librtmp1 arm64 2.4+20151223.gitfa8646d.1-2+b5 [56.8 kB] Get: 94 http://deb.debian.org/debian unstable/main arm64 libssh2-1t64 arm64 1.11.1-1 [235 kB] Get: 95 http://deb.debian.org/debian unstable/main arm64 libcurl3t64-gnutls arm64 8.11.1-1+b1 [331 kB] Get: 96 http://deb.debian.org/debian unstable/main arm64 libevent-2.1-7t64 arm64 2.1.12-stable-10+b1 [170 kB] Get: 97 http://deb.debian.org/debian unstable/main arm64 libunbound8 arm64 1.22.0-1+b1 [553 kB] Get: 98 http://deb.debian.org/debian unstable/main arm64 libgnutls-dane0t64 arm64 3.8.8-2 [446 kB] Get: 99 http://deb.debian.org/debian unstable/main arm64 libgnutls-openssl27t64 arm64 3.8.8-2 [446 kB] Get: 100 http://deb.debian.org/debian unstable/main arm64 libidn2-dev arm64 2.3.7-2+b1 [122 kB] Get: 101 http://deb.debian.org/debian unstable/main arm64 libp11-kit-dev arm64 0.25.5-3 [208 kB] Get: 102 http://deb.debian.org/debian unstable/main arm64 libtasn1-6-dev arm64 4.19.0-3+b3 [96.5 kB] Get: 103 http://deb.debian.org/debian unstable/main arm64 libgmpxx4ldbl arm64 2:6.3.0+dfsg-3 [329 kB] Get: 104 http://deb.debian.org/debian unstable/main arm64 libgmp-dev arm64 2:6.3.0+dfsg-3 [621 kB] Get: 105 http://deb.debian.org/debian unstable/main arm64 nettle-dev arm64 3.10-1+b1 [1324 kB] Get: 106 http://deb.debian.org/debian unstable/main arm64 libgnutls28-dev arm64 3.8.8-2 [1404 kB] Get: 107 http://deb.debian.org/debian unstable/main arm64 libkrb5-dev arm64 1.21.3-4 [15.9 kB] Get: 108 http://deb.debian.org/debian unstable/main arm64 libldap-dev arm64 2.6.9+dfsg-1 [305 kB] Get: 109 http://deb.debian.org/debian unstable/main arm64 libpkgconf3 arm64 1.8.1-4 [35.3 kB] Get: 110 http://deb.debian.org/debian unstable/main arm64 pkgconf-bin arm64 1.8.1-4 [29.6 kB] Get: 111 http://deb.debian.org/debian unstable/main arm64 pkgconf arm64 1.8.1-4 [26.1 kB] Get: 112 http://deb.debian.org/debian unstable/main arm64 libnghttp2-dev arm64 1.64.0-1 [112 kB] Get: 113 http://deb.debian.org/debian unstable/main arm64 libnghttp3-dev arm64 1.6.0-2 [86.5 kB] Get: 114 http://deb.debian.org/debian unstable/main arm64 libngtcp2-crypto-gnutls-dev arm64 1.9.1-1 [23.0 kB] Get: 115 http://deb.debian.org/debian unstable/main arm64 libngtcp2-dev arm64 1.9.1-1 [162 kB] Get: 116 http://deb.debian.org/debian unstable/main arm64 libpsl-dev arm64 0.21.2-1.1+b1 [77.9 kB] Get: 117 http://deb.debian.org/debian unstable/main arm64 zlib1g-dev arm64 1:1.3.dfsg+really1.3.1-1+b1 [917 kB] Get: 118 http://deb.debian.org/debian unstable/main arm64 librtmp-dev arm64 2.4+20151223.gitfa8646d.1-2+b5 [67.5 kB] Get: 119 http://deb.debian.org/debian unstable/main arm64 libssl-dev arm64 3.4.0-2 [3234 kB] Get: 120 http://deb.debian.org/debian unstable/main arm64 libssh2-1-dev arm64 1.11.1-1 [388 kB] Get: 121 http://deb.debian.org/debian unstable/main arm64 libzstd-dev arm64 1.5.6+dfsg-2 [329 kB] Get: 122 http://deb.debian.org/debian unstable/main arm64 libcurl4-gnutls-dev arm64 8.11.1-1+b1 [461 kB] Get: 123 http://deb.debian.org/debian unstable/main arm64 libdeflate0 arm64 1.23-1+b1 [42.5 kB] Get: 124 http://deb.debian.org/debian unstable/main arm64 libdeflate-dev arm64 1.23-1+b1 [51.4 kB] Get: 125 http://deb.debian.org/debian unstable/main arm64 libhtscodecs2 arm64 1.6.1-1 [74.6 kB] Get: 126 http://deb.debian.org/debian unstable/main arm64 libhts3t64 arm64 1.20+ds-2 [420 kB] Get: 127 http://deb.debian.org/debian unstable/main arm64 liblzma-dev arm64 5.6.3-1+b1 [312 kB] Get: 128 http://deb.debian.org/debian unstable/main arm64 libhts-dev arm64 1.20+ds-2 [1626 kB] Get: 129 http://deb.debian.org/debian unstable/main arm64 libjs-d3-format all 1:1.4.5+~1.4.2-2 [17.7 kB] Get: 130 http://deb.debian.org/debian unstable/main arm64 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [326 kB] Get: 131 http://deb.debian.org/debian unstable/main arm64 libjs-jquery-datatables all 1.11.5+dfsg-2 [144 kB] Get: 132 http://deb.debian.org/debian unstable/main arm64 libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] Get: 133 http://deb.debian.org/debian unstable/main arm64 libncurses6 arm64 6.5-2+b1 [96.1 kB] Get: 134 http://deb.debian.org/debian unstable/main arm64 libncurses-dev arm64 6.5-2+b1 [338 kB] Get: 135 http://deb.debian.org/debian unstable/main arm64 node-commander all 9.4.1-1 [65.3 kB] Get: 136 http://deb.debian.org/debian unstable/main arm64 node-d3-array all 3.2.0+~cs5.0.6-2 [44.1 kB] Get: 137 http://deb.debian.org/debian unstable/main arm64 node-d3-axis all 1.0.12+~1.0.16-1 [13.7 kB] Get: 138 http://deb.debian.org/debian unstable/main arm64 node-d3-dispatch all 1.0.6+~1.0.9-1 [9560 B] Get: 139 http://deb.debian.org/debian unstable/main arm64 node-d3-selection all 1.4.1+~1.4.3-1 [42.1 kB] Get: 140 http://deb.debian.org/debian unstable/main arm64 node-d3-drag all 1.2.5+~1.2.5-1 [18.7 kB] Get: 141 http://deb.debian.org/debian unstable/main arm64 node-d3-color all 1.4.1+~1.4.2-1 [19.1 kB] Get: 142 http://deb.debian.org/debian unstable/main arm64 node-d3-interpolate all 1.4.0+~1.4.2-1 [23.3 kB] Get: 143 http://deb.debian.org/debian unstable/main arm64 node-d3-ease all 1.0.7+~1.0.11-1 [12.2 kB] Get: 144 http://deb.debian.org/debian unstable/main arm64 node-d3-timer all 1.0.10+~1.0.10-1 [10.3 kB] Get: 145 http://deb.debian.org/debian unstable/main arm64 node-d3-transition all 1.3.2+~1.3.2-1 [28.2 kB] Get: 146 http://deb.debian.org/debian unstable/main arm64 node-d3-brush all 1.1.6+~1.1.5-1 [185 kB] Get: 147 http://deb.debian.org/debian unstable/main arm64 node-d3-path all 1.0.9+~1.0.9-1 [10.2 kB] Get: 148 http://deb.debian.org/debian unstable/main arm64 node-d3-chord all 1.0.6+~1.0.11-1 [13.9 kB] Get: 149 http://deb.debian.org/debian unstable/main arm64 node-d3-collection all 1.0.7+~1.0.10-1 [16.9 kB] Get: 150 http://deb.debian.org/debian unstable/main arm64 node-d3-contour all 1.3.2+~1.3.3-1 [17.2 kB] Get: 151 http://deb.debian.org/debian unstable/main arm64 node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.5 kB] Get: 152 http://deb.debian.org/debian unstable/main arm64 node-iconv-lite all 0.6.3-3 [115 kB] Get: 153 http://deb.debian.org/debian unstable/main arm64 node-d3-queue all 3.0.7-13 [10.2 kB] Get: 154 http://deb.debian.org/debian unstable/main arm64 node-rw all 1.3.3-5 [7428 B] Get: 155 http://deb.debian.org/debian unstable/main arm64 node-d3-dsv all 1.2.0+~1.2.3-1 [17.4 kB] Get: 156 http://deb.debian.org/debian unstable/main arm64 node-d3-fetch all 1.2.0+~1.2.2-1 [9844 B] Get: 157 http://deb.debian.org/debian unstable/main arm64 node-d3-quadtree all 1.0.7+~1.0.9-1 [16.0 kB] Get: 158 http://deb.debian.org/debian unstable/main arm64 node-d3-force all 2.1.1+~2.1.4-1 [30.2 kB] Get: 159 http://deb.debian.org/debian unstable/main arm64 node-d3-format all 1:1.4.5+~1.4.2-2 [12.6 kB] Get: 160 http://deb.debian.org/debian unstable/main arm64 node-d3-geo all 1.12.1+~1.12.4-1 [65.5 kB] Get: 161 http://deb.debian.org/debian unstable/main arm64 node-d3-hierarchy all 1.1.9+~1.1.8-1 [34.1 kB] Get: 162 http://deb.debian.org/debian unstable/main arm64 node-d3-polygon all 1.0.6+~1.0.8-1 [8580 B] Get: 163 http://deb.debian.org/debian unstable/main arm64 node-d3-random all 1.1.2+~1.1.3-1 [8908 B] Get: 164 http://deb.debian.org/debian unstable/main arm64 node-d3-time all 1.1.0+~1.1.1-1 [18.7 kB] Get: 165 http://deb.debian.org/debian unstable/main arm64 node-d3-time-format all 2.3.0+~2.3.1-1 [22.9 kB] Get: 166 http://deb.debian.org/debian unstable/main arm64 node-d3-scale all 2.2.2+~2.2.6-1 [42.7 kB] Get: 167 http://deb.debian.org/debian unstable/main arm64 node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [21.4 kB] Get: 168 http://deb.debian.org/debian unstable/main arm64 node-d3-shape all 1.3.7+~1.3.8-1 [54.8 kB] Get: 169 http://deb.debian.org/debian unstable/main arm64 node-d3-voronoi all 1.1.4+~1.1.9-1 [19.8 kB] Get: 170 http://deb.debian.org/debian unstable/main arm64 node-d3-zoom all 1.8.3+~1.8.4-1 [26.8 kB] Get: 171 http://deb.debian.org/debian unstable/main arm64 node-d3 all 5.16.0+~cs5.28.10-2 [223 kB] Get: 172 http://deb.debian.org/debian unstable/main arm64 node-normalize.css all 8.0.1-5 [12.7 kB] Fetched 73.1 MB in 0s (222 MB/s) Preconfiguring packages ... Selecting previously unselected package liblocale-gettext-perl. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19956 files and directories currently installed.) Preparing to unpack .../liblocale-gettext-perl_1.07-7+b1_arm64.deb ... Unpacking liblocale-gettext-perl (1.07-7+b1) ... Selecting previously unselected package libpython3.13-minimal:arm64. Preparing to unpack .../libpython3.13-minimal_3.13.1-3_arm64.deb ... Unpacking libpython3.13-minimal:arm64 (3.13.1-3) ... Selecting previously unselected package libexpat1:arm64. Preparing to unpack .../libexpat1_2.6.4-1_arm64.deb ... Unpacking libexpat1:arm64 (2.6.4-1) ... Selecting previously unselected package python3.13-minimal. Preparing to unpack .../python3.13-minimal_3.13.1-3_arm64.deb ... Unpacking python3.13-minimal (3.13.1-3) ... Setting up libpython3.13-minimal:arm64 (3.13.1-3) ... Setting up libexpat1:arm64 (2.6.4-1) ... Setting up python3.13-minimal (3.13.1-3) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20305 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.13.1-2_arm64.deb ... Unpacking python3-minimal (3.13.1-2) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package tzdata. Preparing to unpack .../3-tzdata_2025a-1_all.deb ... Unpacking tzdata (2025a-1) ... Selecting previously unselected package libffi8:arm64. Preparing to unpack .../4-libffi8_3.4.6-1_arm64.deb ... Unpacking libffi8:arm64 (3.4.6-1) ... Selecting previously unselected package readline-common. Preparing to unpack .../5-readline-common_8.2-6_all.deb ... Unpacking readline-common (8.2-6) ... Selecting previously unselected package libreadline8t64:arm64. Preparing to unpack .../6-libreadline8t64_8.2-6_arm64.deb ... Adding 'diversion of /lib/aarch64-linux-gnu/libhistory.so.8 to /lib/aarch64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/aarch64-linux-gnu/libhistory.so.8.2 to /lib/aarch64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/aarch64-linux-gnu/libreadline.so.8 to /lib/aarch64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/aarch64-linux-gnu/libreadline.so.8.2 to /lib/aarch64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:arm64 (8.2-6) ... Selecting previously unselected package libpython3.13-stdlib:arm64. Preparing to unpack .../7-libpython3.13-stdlib_3.13.1-3_arm64.deb ... Unpacking libpython3.13-stdlib:arm64 (3.13.1-3) ... Selecting previously unselected package python3.13. Preparing to unpack .../8-python3.13_3.13.1-3_arm64.deb ... Unpacking python3.13 (3.13.1-3) ... Selecting previously unselected package libpython3-stdlib:arm64. Preparing to unpack .../9-libpython3-stdlib_3.13.1-2_arm64.deb ... Unpacking libpython3-stdlib:arm64 (3.13.1-2) ... Setting up python3-minimal (3.13.1-2) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21315 files and directories currently installed.) Preparing to unpack .../000-python3_3.13.1-2_arm64.deb ... Unpacking python3 (3.13.1-2) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../001-sensible-utils_0.0.24_all.deb ... Unpacking sensible-utils (0.0.24) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../002-libmagic-mgc_1%3a5.45-3+b1_arm64.deb ... Unpacking libmagic-mgc (1:5.45-3+b1) ... Selecting previously unselected package libmagic1t64:arm64. Preparing to unpack .../003-libmagic1t64_1%3a5.45-3+b1_arm64.deb ... Unpacking libmagic1t64:arm64 (1:5.45-3+b1) ... Selecting previously unselected package file. Preparing to unpack .../004-file_1%3a5.45-3+b1_arm64.deb ... Unpacking file (1:5.45-3+b1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../005-gettext-base_0.23.1-1_arm64.deb ... Unpacking gettext-base (0.23.1-1) ... Selecting previously unselected package libuchardet0:arm64. Preparing to unpack .../006-libuchardet0_0.0.8-1+b2_arm64.deb ... Unpacking libuchardet0:arm64 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../007-groff-base_1.23.0-7_arm64.deb ... Unpacking groff-base (1.23.0-7) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../008-bsdextrautils_2.40.4-2_arm64.deb ... Unpacking bsdextrautils (2.40.4-2) ... Selecting previously unselected package libpipeline1:arm64. Preparing to unpack .../009-libpipeline1_1.5.8-1_arm64.deb ... Unpacking libpipeline1:arm64 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../010-man-db_2.13.0-1_arm64.deb ... Unpacking man-db (2.13.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../011-m4_1.4.19-5_arm64.deb ... Unpacking m4 (1.4.19-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../012-autoconf_2.72-3_all.deb ... Unpacking autoconf (2.72-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../013-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../014-automake_1%3a1.17-2_all.deb ... Unpacking automake (1:1.17-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../015-autopoint_0.23.1-1_all.deb ... Unpacking autopoint (0.23.1-1) ... Selecting previously unselected package libcom-err2:arm64. Preparing to unpack .../016-libcom-err2_1.47.2-1_arm64.deb ... Unpacking libcom-err2:arm64 (1.47.2-1) ... Selecting previously unselected package comerr-dev:arm64. Preparing to unpack .../017-comerr-dev_2.1-1.47.2-1_arm64.deb ... Unpacking comerr-dev:arm64 (2.1-1.47.2-1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../018-libdebhelper-perl_13.24.1_all.deb ... Unpacking libdebhelper-perl (13.24.1) ... Selecting previously unselected package libtool. Preparing to unpack .../019-libtool_2.5.4-2.1_all.deb ... Unpacking libtool (2.5.4-2.1) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../020-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../021-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../022-libfile-stripnondeterminism-perl_1.14.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../023-dh-strip-nondeterminism_1.14.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.14.1-1) ... Selecting previously unselected package libelf1t64:arm64. Preparing to unpack .../024-libelf1t64_0.192-4_arm64.deb ... Unpacking libelf1t64:arm64 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../025-dwz_0.15-1+b1_arm64.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libunistring5:arm64. Preparing to unpack .../026-libunistring5_1.3-1_arm64.deb ... Unpacking libunistring5:arm64 (1.3-1) ... Selecting previously unselected package libicu72:arm64. Preparing to unpack .../027-libicu72_72.1-6_arm64.deb ... Unpacking libicu72:arm64 (72.1-6) ... Selecting previously unselected package libxml2:arm64. Preparing to unpack .../028-libxml2_2.12.7+dfsg+really2.9.14-0.2+b1_arm64.deb ... Unpacking libxml2:arm64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Selecting previously unselected package gettext. Preparing to unpack .../029-gettext_0.23.1-1_arm64.deb ... Unpacking gettext (0.23.1-1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../030-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../031-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../032-debhelper_13.24.1_all.deb ... Unpacking debhelper (13.24.1) ... Selecting previously unselected package fonts-font-awesome. Preparing to unpack .../033-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Selecting previously unselected package help2man. Preparing to unpack .../034-help2man_1.49.3+b1_arm64.deb ... Unpacking help2man (1.49.3+b1) ... Selecting previously unselected package icu-devtools. Preparing to unpack .../035-icu-devtools_72.1-6_arm64.deb ... Unpacking icu-devtools (72.1-6) ... Selecting previously unselected package libkrb5support0:arm64. Preparing to unpack .../036-libkrb5support0_1.21.3-4_arm64.deb ... Unpacking libkrb5support0:arm64 (1.21.3-4) ... Selecting previously unselected package libk5crypto3:arm64. Preparing to unpack .../037-libk5crypto3_1.21.3-4_arm64.deb ... Unpacking libk5crypto3:arm64 (1.21.3-4) ... Selecting previously unselected package libkeyutils1:arm64. Preparing to unpack .../038-libkeyutils1_1.6.3-4_arm64.deb ... Unpacking libkeyutils1:arm64 (1.6.3-4) ... Selecting previously unselected package libkrb5-3:arm64. Preparing to unpack .../039-libkrb5-3_1.21.3-4_arm64.deb ... Unpacking libkrb5-3:arm64 (1.21.3-4) ... Selecting previously unselected package libgssapi-krb5-2:arm64. Preparing to unpack .../040-libgssapi-krb5-2_1.21.3-4_arm64.deb ... Unpacking libgssapi-krb5-2:arm64 (1.21.3-4) ... Selecting previously unselected package libgssrpc4t64:arm64. Preparing to unpack .../041-libgssrpc4t64_1.21.3-4_arm64.deb ... Unpacking libgssrpc4t64:arm64 (1.21.3-4) ... Selecting previously unselected package libkadm5clnt-mit12:arm64. Preparing to unpack .../042-libkadm5clnt-mit12_1.21.3-4_arm64.deb ... Unpacking libkadm5clnt-mit12:arm64 (1.21.3-4) ... Selecting previously unselected package libkdb5-10t64:arm64. Preparing to unpack .../043-libkdb5-10t64_1.21.3-4_arm64.deb ... Unpacking libkdb5-10t64:arm64 (1.21.3-4) ... Selecting previously unselected package libkadm5srv-mit12:arm64. Preparing to unpack .../044-libkadm5srv-mit12_1.21.3-4_arm64.deb ... Unpacking libkadm5srv-mit12:arm64 (1.21.3-4) ... Selecting previously unselected package krb5-multidev:arm64. Preparing to unpack .../045-krb5-multidev_1.21.3-4_arm64.deb ... Unpacking krb5-multidev:arm64 (1.21.3-4) ... Selecting previously unselected package libboost1.83-dev:arm64. Preparing to unpack .../046-libboost1.83-dev_1.83.0-4_arm64.deb ... Unpacking libboost1.83-dev:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-atomic1.83.0:arm64. Preparing to unpack .../047-libboost-atomic1.83.0_1.83.0-4_arm64.deb ... Unpacking libboost-atomic1.83.0:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-atomic1.83-dev:arm64. Preparing to unpack .../048-libboost-atomic1.83-dev_1.83.0-4_arm64.deb ... Unpacking libboost-atomic1.83-dev:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-chrono1.83.0t64:arm64. Preparing to unpack .../049-libboost-chrono1.83.0t64_1.83.0-4_arm64.deb ... Unpacking libboost-chrono1.83.0t64:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-chrono1.83-dev:arm64. Preparing to unpack .../050-libboost-chrono1.83-dev_1.83.0-4_arm64.deb ... Unpacking libboost-chrono1.83-dev:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-chrono-dev:arm64. Preparing to unpack .../051-libboost-chrono-dev_1.83.0.2+b2_arm64.deb ... Unpacking libboost-chrono-dev:arm64 (1.83.0.2+b2) ... Selecting previously unselected package libboost-filesystem1.83.0:arm64. Preparing to unpack .../052-libboost-filesystem1.83.0_1.83.0-4_arm64.deb ... Unpacking libboost-filesystem1.83.0:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-system1.83.0:arm64. Preparing to unpack .../053-libboost-system1.83.0_1.83.0-4_arm64.deb ... Unpacking libboost-system1.83.0:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-system1.83-dev:arm64. Preparing to unpack .../054-libboost-system1.83-dev_1.83.0-4_arm64.deb ... Unpacking libboost-system1.83-dev:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-filesystem1.83-dev:arm64. Preparing to unpack .../055-libboost-filesystem1.83-dev_1.83.0-4_arm64.deb ... Unpacking libboost-filesystem1.83-dev:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-filesystem-dev:arm64. Preparing to unpack .../056-libboost-filesystem-dev_1.83.0.2+b2_arm64.deb ... Unpacking libboost-filesystem-dev:arm64 (1.83.0.2+b2) ... Selecting previously unselected package libboost-regex1.83.0:arm64. Preparing to unpack .../057-libboost-regex1.83.0_1.83.0-4_arm64.deb ... Unpacking libboost-regex1.83.0:arm64 (1.83.0-4) ... Selecting previously unselected package libicu-dev:arm64. Preparing to unpack .../058-libicu-dev_72.1-6_arm64.deb ... Unpacking libicu-dev:arm64 (72.1-6) ... Selecting previously unselected package libboost-regex1.83-dev:arm64. Preparing to unpack .../059-libboost-regex1.83-dev_1.83.0-4_arm64.deb ... Unpacking libboost-regex1.83-dev:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-iostreams1.83-dev:arm64. Preparing to unpack .../060-libboost-iostreams1.83-dev_1.83.0-4_arm64.deb ... Unpacking libboost-iostreams1.83-dev:arm64 (1.83.0-4) ... Selecting previously unselected package libboost-iostreams-dev:arm64. Preparing to unpack .../061-libboost-iostreams-dev_1.83.0.2+b2_arm64.deb ... Unpacking libboost-iostreams-dev:arm64 (1.83.0.2+b2) ... Selecting previously unselected package libboost-system-dev:arm64. Preparing to unpack .../062-libboost-system-dev_1.83.0.2+b2_arm64.deb ... Unpacking libboost-system-dev:arm64 (1.83.0.2+b2) ... Selecting previously unselected package libbrotli1:arm64. Preparing to unpack .../063-libbrotli1_1.1.0-2+b6_arm64.deb ... Unpacking libbrotli1:arm64 (1.1.0-2+b6) ... Selecting previously unselected package libbrotli-dev:arm64. Preparing to unpack .../064-libbrotli-dev_1.1.0-2+b6_arm64.deb ... Unpacking libbrotli-dev:arm64 (1.1.0-2+b6) ... Selecting previously unselected package libbz2-dev:arm64. Preparing to unpack .../065-libbz2-dev_1.0.8-6_arm64.deb ... Unpacking libbz2-dev:arm64 (1.0.8-6) ... Selecting previously unselected package libidn2-0:arm64. Preparing to unpack .../066-libidn2-0_2.3.7-2+b1_arm64.deb ... Unpacking libidn2-0:arm64 (2.3.7-2+b1) ... Selecting previously unselected package libp11-kit0:arm64. Preparing to unpack .../067-libp11-kit0_0.25.5-3_arm64.deb ... Unpacking libp11-kit0:arm64 (0.25.5-3) ... Selecting previously unselected package libtasn1-6:arm64. Preparing to unpack .../068-libtasn1-6_4.19.0-3+b3_arm64.deb ... Unpacking libtasn1-6:arm64 (4.19.0-3+b3) ... Selecting previously unselected package libgnutls30t64:arm64. Preparing to unpack .../069-libgnutls30t64_3.8.8-2_arm64.deb ... Unpacking libgnutls30t64:arm64 (3.8.8-2) ... Selecting previously unselected package libsasl2-modules-db:arm64. Preparing to unpack .../070-libsasl2-modules-db_2.1.28+dfsg1-8+b1_arm64.deb ... Unpacking libsasl2-modules-db:arm64 (2.1.28+dfsg1-8+b1) ... Selecting previously unselected package libsasl2-2:arm64. Preparing to unpack .../071-libsasl2-2_2.1.28+dfsg1-8+b1_arm64.deb ... Unpacking libsasl2-2:arm64 (2.1.28+dfsg1-8+b1) ... Selecting previously unselected package libldap2:arm64. Preparing to unpack .../072-libldap2_2.6.9+dfsg-1_arm64.deb ... Unpacking libldap2:arm64 (2.6.9+dfsg-1) ... Selecting previously unselected package libnghttp2-14:arm64. Preparing to unpack .../073-libnghttp2-14_1.64.0-1_arm64.deb ... Unpacking libnghttp2-14:arm64 (1.64.0-1) ... Selecting previously unselected package libnghttp3-9:arm64. Preparing to unpack .../074-libnghttp3-9_1.6.0-2_arm64.deb ... Unpacking libnghttp3-9:arm64 (1.6.0-2) ... Selecting previously unselected package libngtcp2-16:arm64. Preparing to unpack .../075-libngtcp2-16_1.9.1-1_arm64.deb ... Unpacking libngtcp2-16:arm64 (1.9.1-1) ... Selecting previously unselected package libngtcp2-crypto-gnutls8:arm64. Preparing to unpack .../076-libngtcp2-crypto-gnutls8_1.9.1-1_arm64.deb ... Unpacking libngtcp2-crypto-gnutls8:arm64 (1.9.1-1) ... Selecting previously unselected package libpsl5t64:arm64. Preparing to unpack .../077-libpsl5t64_0.21.2-1.1+b1_arm64.deb ... Unpacking libpsl5t64:arm64 (0.21.2-1.1+b1) ... Selecting previously unselected package librtmp1:arm64. Preparing to unpack .../078-librtmp1_2.4+20151223.gitfa8646d.1-2+b5_arm64.deb ... Unpacking librtmp1:arm64 (2.4+20151223.gitfa8646d.1-2+b5) ... Selecting previously unselected package libssh2-1t64:arm64. Preparing to unpack .../079-libssh2-1t64_1.11.1-1_arm64.deb ... Unpacking libssh2-1t64:arm64 (1.11.1-1) ... Selecting previously unselected package libcurl3t64-gnutls:arm64. Preparing to unpack .../080-libcurl3t64-gnutls_8.11.1-1+b1_arm64.deb ... Unpacking libcurl3t64-gnutls:arm64 (8.11.1-1+b1) ... Selecting previously unselected package libevent-2.1-7t64:arm64. Preparing to unpack .../081-libevent-2.1-7t64_2.1.12-stable-10+b1_arm64.deb ... Unpacking libevent-2.1-7t64:arm64 (2.1.12-stable-10+b1) ... Selecting previously unselected package libunbound8:arm64. Preparing to unpack .../082-libunbound8_1.22.0-1+b1_arm64.deb ... Unpacking libunbound8:arm64 (1.22.0-1+b1) ... Selecting previously unselected package libgnutls-dane0t64:arm64. Preparing to unpack .../083-libgnutls-dane0t64_3.8.8-2_arm64.deb ... Unpacking libgnutls-dane0t64:arm64 (3.8.8-2) ... Selecting previously unselected package libgnutls-openssl27t64:arm64. Preparing to unpack .../084-libgnutls-openssl27t64_3.8.8-2_arm64.deb ... Unpacking libgnutls-openssl27t64:arm64 (3.8.8-2) ... Selecting previously unselected package libidn2-dev:arm64. Preparing to unpack .../085-libidn2-dev_2.3.7-2+b1_arm64.deb ... Unpacking libidn2-dev:arm64 (2.3.7-2+b1) ... Selecting previously unselected package libp11-kit-dev:arm64. Preparing to unpack .../086-libp11-kit-dev_0.25.5-3_arm64.deb ... Unpacking libp11-kit-dev:arm64 (0.25.5-3) ... Selecting previously unselected package libtasn1-6-dev:arm64. Preparing to unpack .../087-libtasn1-6-dev_4.19.0-3+b3_arm64.deb ... Unpacking libtasn1-6-dev:arm64 (4.19.0-3+b3) ... Selecting previously unselected package libgmpxx4ldbl:arm64. Preparing to unpack .../088-libgmpxx4ldbl_2%3a6.3.0+dfsg-3_arm64.deb ... Unpacking libgmpxx4ldbl:arm64 (2:6.3.0+dfsg-3) ... Selecting previously unselected package libgmp-dev:arm64. Preparing to unpack .../089-libgmp-dev_2%3a6.3.0+dfsg-3_arm64.deb ... Unpacking libgmp-dev:arm64 (2:6.3.0+dfsg-3) ... Selecting previously unselected package nettle-dev:arm64. Preparing to unpack .../090-nettle-dev_3.10-1+b1_arm64.deb ... Unpacking nettle-dev:arm64 (3.10-1+b1) ... Selecting previously unselected package libgnutls28-dev:arm64. Preparing to unpack .../091-libgnutls28-dev_3.8.8-2_arm64.deb ... Unpacking libgnutls28-dev:arm64 (3.8.8-2) ... Selecting previously unselected package libkrb5-dev:arm64. Preparing to unpack .../092-libkrb5-dev_1.21.3-4_arm64.deb ... Unpacking libkrb5-dev:arm64 (1.21.3-4) ... Selecting previously unselected package libldap-dev:arm64. Preparing to unpack .../093-libldap-dev_2.6.9+dfsg-1_arm64.deb ... Unpacking libldap-dev:arm64 (2.6.9+dfsg-1) ... Selecting previously unselected package libpkgconf3:arm64. Preparing to unpack .../094-libpkgconf3_1.8.1-4_arm64.deb ... Unpacking libpkgconf3:arm64 (1.8.1-4) ... Selecting previously unselected package pkgconf-bin. Preparing to unpack .../095-pkgconf-bin_1.8.1-4_arm64.deb ... Unpacking pkgconf-bin (1.8.1-4) ... Selecting previously unselected package pkgconf:arm64. Preparing to unpack .../096-pkgconf_1.8.1-4_arm64.deb ... Unpacking pkgconf:arm64 (1.8.1-4) ... Selecting previously unselected package libnghttp2-dev:arm64. Preparing to unpack .../097-libnghttp2-dev_1.64.0-1_arm64.deb ... Unpacking libnghttp2-dev:arm64 (1.64.0-1) ... Selecting previously unselected package libnghttp3-dev:arm64. Preparing to unpack .../098-libnghttp3-dev_1.6.0-2_arm64.deb ... Unpacking libnghttp3-dev:arm64 (1.6.0-2) ... Selecting previously unselected package libngtcp2-crypto-gnutls-dev:arm64. Preparing to unpack .../099-libngtcp2-crypto-gnutls-dev_1.9.1-1_arm64.deb ... Unpacking libngtcp2-crypto-gnutls-dev:arm64 (1.9.1-1) ... Selecting previously unselected package libngtcp2-dev:arm64. Preparing to unpack .../100-libngtcp2-dev_1.9.1-1_arm64.deb ... Unpacking libngtcp2-dev:arm64 (1.9.1-1) ... Selecting previously unselected package libpsl-dev:arm64. Preparing to unpack .../101-libpsl-dev_0.21.2-1.1+b1_arm64.deb ... Unpacking libpsl-dev:arm64 (0.21.2-1.1+b1) ... Selecting previously unselected package zlib1g-dev:arm64. Preparing to unpack .../102-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_arm64.deb ... Unpacking zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ... Selecting previously unselected package librtmp-dev:arm64. Preparing to unpack .../103-librtmp-dev_2.4+20151223.gitfa8646d.1-2+b5_arm64.deb ... Unpacking librtmp-dev:arm64 (2.4+20151223.gitfa8646d.1-2+b5) ... Selecting previously unselected package libssl-dev:arm64. Preparing to unpack .../104-libssl-dev_3.4.0-2_arm64.deb ... Unpacking libssl-dev:arm64 (3.4.0-2) ... Selecting previously unselected package libssh2-1-dev:arm64. Preparing to unpack .../105-libssh2-1-dev_1.11.1-1_arm64.deb ... Unpacking libssh2-1-dev:arm64 (1.11.1-1) ... Selecting previously unselected package libzstd-dev:arm64. Preparing to unpack .../106-libzstd-dev_1.5.6+dfsg-2_arm64.deb ... Unpacking libzstd-dev:arm64 (1.5.6+dfsg-2) ... Selecting previously unselected package libcurl4-gnutls-dev:arm64. Preparing to unpack .../107-libcurl4-gnutls-dev_8.11.1-1+b1_arm64.deb ... Unpacking libcurl4-gnutls-dev:arm64 (8.11.1-1+b1) ... Selecting previously unselected package libdeflate0:arm64. Preparing to unpack .../108-libdeflate0_1.23-1+b1_arm64.deb ... Unpacking libdeflate0:arm64 (1.23-1+b1) ... Selecting previously unselected package libdeflate-dev:arm64. Preparing to unpack .../109-libdeflate-dev_1.23-1+b1_arm64.deb ... Unpacking libdeflate-dev:arm64 (1.23-1+b1) ... Selecting previously unselected package libhtscodecs2:arm64. Preparing to unpack .../110-libhtscodecs2_1.6.1-1_arm64.deb ... Unpacking libhtscodecs2:arm64 (1.6.1-1) ... Selecting previously unselected package libhts3t64:arm64. Preparing to unpack .../111-libhts3t64_1.20+ds-2_arm64.deb ... Unpacking libhts3t64:arm64 (1.20+ds-2) ... Selecting previously unselected package liblzma-dev:arm64. Preparing to unpack .../112-liblzma-dev_5.6.3-1+b1_arm64.deb ... Unpacking liblzma-dev:arm64 (5.6.3-1+b1) ... Selecting previously unselected package libhts-dev:arm64. Preparing to unpack .../113-libhts-dev_1.20+ds-2_arm64.deb ... Unpacking libhts-dev:arm64 (1.20+ds-2) ... Selecting previously unselected package libjs-d3-format. Preparing to unpack .../114-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../115-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Selecting previously unselected package libjs-jquery-datatables. Preparing to unpack .../116-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... Selecting previously unselected package libjs-jquery-datatables-extensions. Preparing to unpack .../117-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Selecting previously unselected package libncurses6:arm64. Preparing to unpack .../118-libncurses6_6.5-2+b1_arm64.deb ... Unpacking libncurses6:arm64 (6.5-2+b1) ... Selecting previously unselected package libncurses-dev:arm64. Preparing to unpack .../119-libncurses-dev_6.5-2+b1_arm64.deb ... Unpacking libncurses-dev:arm64 (6.5-2+b1) ... Selecting previously unselected package node-commander. Preparing to unpack .../120-node-commander_9.4.1-1_all.deb ... Unpacking node-commander (9.4.1-1) ... Selecting previously unselected package node-d3-array. Preparing to unpack .../121-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... Selecting previously unselected package node-d3-axis. Preparing to unpack .../122-node-d3-axis_1.0.12+~1.0.16-1_all.deb ... Unpacking node-d3-axis (1.0.12+~1.0.16-1) ... Selecting previously unselected package node-d3-dispatch. Preparing to unpack .../123-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ... Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ... Selecting previously unselected package node-d3-selection. Preparing to unpack .../124-node-d3-selection_1.4.1+~1.4.3-1_all.deb ... Unpacking node-d3-selection (1.4.1+~1.4.3-1) ... Selecting previously unselected package node-d3-drag. Preparing to unpack .../125-node-d3-drag_1.2.5+~1.2.5-1_all.deb ... Unpacking node-d3-drag (1.2.5+~1.2.5-1) ... Selecting previously unselected package node-d3-color. Preparing to unpack .../126-node-d3-color_1.4.1+~1.4.2-1_all.deb ... Unpacking node-d3-color (1.4.1+~1.4.2-1) ... Selecting previously unselected package node-d3-interpolate. Preparing to unpack .../127-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ... Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ... Selecting previously unselected package node-d3-ease. Preparing to unpack .../128-node-d3-ease_1.0.7+~1.0.11-1_all.deb ... Unpacking node-d3-ease (1.0.7+~1.0.11-1) ... Selecting previously unselected package node-d3-timer. Preparing to unpack .../129-node-d3-timer_1.0.10+~1.0.10-1_all.deb ... Unpacking node-d3-timer (1.0.10+~1.0.10-1) ... Selecting previously unselected package node-d3-transition. Preparing to unpack .../130-node-d3-transition_1.3.2+~1.3.2-1_all.deb ... Unpacking node-d3-transition (1.3.2+~1.3.2-1) ... Selecting previously unselected package node-d3-brush. Preparing to unpack .../131-node-d3-brush_1.1.6+~1.1.5-1_all.deb ... Unpacking node-d3-brush (1.1.6+~1.1.5-1) ... Selecting previously unselected package node-d3-path. Preparing to unpack .../132-node-d3-path_1.0.9+~1.0.9-1_all.deb ... Unpacking node-d3-path (1.0.9+~1.0.9-1) ... Selecting previously unselected package node-d3-chord. Preparing to unpack .../133-node-d3-chord_1.0.6+~1.0.11-1_all.deb ... Unpacking node-d3-chord (1.0.6+~1.0.11-1) ... Selecting previously unselected package node-d3-collection. Preparing to unpack .../134-node-d3-collection_1.0.7+~1.0.10-1_all.deb ... Unpacking node-d3-collection (1.0.7+~1.0.10-1) ... Selecting previously unselected package node-d3-contour. Preparing to unpack .../135-node-d3-contour_1.3.2+~1.3.3-1_all.deb ... Unpacking node-d3-contour (1.3.2+~1.3.3-1) ... Selecting previously unselected package node-safe-buffer. Preparing to unpack .../136-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... Selecting previously unselected package node-iconv-lite. Preparing to unpack .../137-node-iconv-lite_0.6.3-3_all.deb ... Unpacking node-iconv-lite (0.6.3-3) ... Selecting previously unselected package node-d3-queue. Preparing to unpack .../138-node-d3-queue_3.0.7-13_all.deb ... Unpacking node-d3-queue (3.0.7-13) ... Selecting previously unselected package node-rw. Preparing to unpack .../139-node-rw_1.3.3-5_all.deb ... Unpacking node-rw (1.3.3-5) ... Selecting previously unselected package node-d3-dsv. Preparing to unpack .../140-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ... Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ... Selecting previously unselected package node-d3-fetch. Preparing to unpack .../141-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ... Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ... Selecting previously unselected package node-d3-quadtree. Preparing to unpack .../142-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ... Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ... Selecting previously unselected package node-d3-force. Preparing to unpack .../143-node-d3-force_2.1.1+~2.1.4-1_all.deb ... Unpacking node-d3-force (2.1.1+~2.1.4-1) ... Selecting previously unselected package node-d3-format. Preparing to unpack .../144-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ... Selecting previously unselected package node-d3-geo. Preparing to unpack .../145-node-d3-geo_1.12.1+~1.12.4-1_all.deb ... Unpacking node-d3-geo (1.12.1+~1.12.4-1) ... Selecting previously unselected package node-d3-hierarchy. Preparing to unpack .../146-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ... Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ... Selecting previously unselected package node-d3-polygon. Preparing to unpack .../147-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ... Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ... Selecting previously unselected package node-d3-random. Preparing to unpack .../148-node-d3-random_1.1.2+~1.1.3-1_all.deb ... Unpacking node-d3-random (1.1.2+~1.1.3-1) ... Selecting previously unselected package node-d3-time. Preparing to unpack .../149-node-d3-time_1.1.0+~1.1.1-1_all.deb ... Unpacking node-d3-time (1.1.0+~1.1.1-1) ... Selecting previously unselected package node-d3-time-format. Preparing to unpack .../150-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ... Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ... Selecting previously unselected package node-d3-scale. Preparing to unpack .../151-node-d3-scale_2.2.2+~2.2.6-1_all.deb ... Unpacking node-d3-scale (2.2.2+~2.2.6-1) ... Selecting previously unselected package node-d3-scale-chromatic. Preparing to unpack .../152-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ... Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... Selecting previously unselected package node-d3-shape. Preparing to unpack .../153-node-d3-shape_1.3.7+~1.3.8-1_all.deb ... Unpacking node-d3-shape (1.3.7+~1.3.8-1) ... Selecting previously unselected package node-d3-voronoi. Preparing to unpack .../154-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ... Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ... Selecting previously unselected package node-d3-zoom. Preparing to unpack .../155-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ... Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ... Selecting previously unselected package node-d3. Preparing to unpack .../156-node-d3_5.16.0+~cs5.28.10-2_all.deb ... Unpacking node-d3 (5.16.0+~cs5.28.10-2) ... Selecting previously unselected package node-normalize.css. Preparing to unpack .../157-node-normalize.css_8.0.1-5_all.deb ... Unpacking node-normalize.css (8.0.1-5) ... Setting up libhtscodecs2:arm64 (1.6.1-1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:arm64 (1.5.8-1) ... Setting up node-d3-timer (1.0.10+~1.0.10-1) ... Setting up node-d3-color (1.4.1+~1.4.2-1) ... Setting up libkeyutils1:arm64 (1.6.3-4) ... Setting up libboost1.83-dev:arm64 (1.83.0-4) ... Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ... Setting up node-d3-queue (3.0.7-13) ... Setting up libicu72:arm64 (72.1-6) ... Setting up libzstd-dev:arm64 (1.5.6+dfsg-2) ... Setting up bsdextrautils (2.40.4-2) ... Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ... Setting up node-d3-ease (1.0.7+~1.0.11-1) ... Setting up libmagic-mgc (1:5.45-3+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... Setting up libboost-regex1.83.0:arm64 (1.83.0-4) ... Setting up libdebhelper-perl (13.24.1) ... Setting up libbrotli1:arm64 (1.1.0-2+b6) ... Setting up libboost-system1.83.0:arm64 (1.83.0-4) ... Setting up libmagic1t64:arm64 (1:5.45-3+b1) ... Setting up libnghttp2-14:arm64 (1.64.0-1) ... Setting up libdeflate0:arm64 (1.23-1+b1) ... Setting up gettext-base (0.23.1-1) ... Setting up m4 (1.4.19-5) ... Setting up libevent-2.1-7t64:arm64 (2.1.12-stable-10+b1) ... Setting up node-d3-selection (1.4.1+~1.4.3-1) ... Setting up libcom-err2:arm64 (1.47.2-1) ... Setting up node-d3-axis (1.0.12+~1.0.16-1) ... Setting up file (1:5.45-3+b1) ... Setting up libboost-filesystem1.83.0:arm64 (1.83.0-4) ... Setting up node-d3-path (1.0.9+~1.0.9-1) ... Setting up libelf1t64:arm64 (0.192-4) ... Setting up libkrb5support0:arm64 (1.21.3-4) ... Setting up libsasl2-modules-db:arm64 (2.1.28+dfsg1-8+b1) ... Setting up tzdata (2025a-1) ... Current default time zone: 'Etc/UTC' Local time is now: Thu Mar 5 01:56:19 UTC 2026. Universal Time is now: Thu Mar 5 01:56:19 UTC 2026. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up libboost-atomic1.83.0:arm64 (1.83.0-4) ... Setting up autotools-dev (20220109.1) ... Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... Setting up node-rw (1.3.3-5) ... Setting up libunbound8:arm64 (1.22.0-1+b1) ... Setting up libpkgconf3:arm64 (1.8.1-4) ... Setting up node-d3-polygon (1.0.6+~1.0.8-1) ... Setting up libgmpxx4ldbl:arm64 (2:6.3.0+dfsg-3) ... Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ... Setting up libboost-chrono1.83.0t64:arm64 (1.83.0-4) ... Setting up libncurses6:arm64 (6.5-2+b1) ... Setting up comerr-dev:arm64 (2.1-1.47.2-1) ... Setting up libunistring5:arm64 (1.3-1) ... Setting up libssl-dev:arm64 (3.4.0-2) ... Setting up node-d3-collection (1.0.7+~1.0.10-1) ... Setting up autopoint (0.23.1-1) ... Setting up icu-devtools (72.1-6) ... Setting up pkgconf-bin (1.8.1-4) ... Setting up libk5crypto3:arm64 (1.21.3-4) ... Setting up libsasl2-2:arm64 (2.1.28+dfsg1-8+b1) ... Setting up libboost-atomic1.83-dev:arm64 (1.83.0-4) ... Setting up autoconf (2.72-3) ... Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ... Setting up libnghttp3-9:arm64 (1.6.0-2) ... Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ... Setting up node-d3-time (1.1.0+~1.1.1-1) ... Setting up libnghttp3-dev:arm64 (1.6.0-2) ... Setting up liblzma-dev:arm64 (5.6.3-1+b1) ... Setting up zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up node-commander (9.4.1-1) ... Setting up libffi8:arm64 (3.4.6-1) ... Setting up dwz (0.15-1+b1) ... Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ... Setting up sensible-utils (0.0.24) ... Setting up libuchardet0:arm64 (0.0.8-1+b2) ... Setting up libtasn1-6:arm64 (4.19.0-3+b3) ... Setting up netbase (6.4) ... Setting up libngtcp2-16:arm64 (1.9.1-1) ... Setting up libkrb5-3:arm64 (1.21.3-4) ... Setting up libboost-system1.83-dev:arm64 (1.83.0-4) ... Setting up libssh2-1t64:arm64 (1.11.1-1) ... Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Setting up node-d3-geo (1.12.1+~1.12.4-1) ... Setting up libtasn1-6-dev:arm64 (4.19.0-3+b3) ... Setting up libdeflate-dev:arm64 (1.23-1+b1) ... Setting up node-normalize.css (8.0.1-5) ... Setting up node-d3-transition (1.3.2+~1.3.2-1) ... Setting up readline-common (8.2-6) ... Setting up libicu-dev:arm64 (72.1-6) ... Setting up libxml2:arm64 (2.12.7+dfsg+really2.9.14-0.2+b1) ... Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Setting up libldap2:arm64 (2.6.9+dfsg-1) ... Setting up liblocale-gettext-perl (1.07-7+b1) ... Setting up libbrotli-dev:arm64 (1.1.0-2+b6) ... Setting up node-d3-random (1.1.2+~1.1.3-1) ... Setting up libbz2-dev:arm64 (1.0.8-6) ... Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Setting up automake (1:1.17-2) ... update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.1-1) ... Setting up libncurses-dev:arm64 (6.5-2+b1) ... Setting up gettext (0.23.1-1) ... Setting up node-d3-format (1:1.4.5+~1.4.2-2) ... Setting up libgmp-dev:arm64 (2:6.3.0+dfsg-3) ... Setting up libboost-chrono1.83-dev:arm64 (1.83.0-4) ... Setting up nettle-dev:arm64 (3.10-1+b1) ... Setting up libtool (2.5.4-2.1) ... Setting up libboost-chrono-dev:arm64 (1.83.0.2+b2) ... Setting up node-d3-time-format (2.3.0+~2.3.1-1) ... Setting up libboost-system-dev:arm64 (1.83.0.2+b2) ... Setting up node-d3-chord (1.0.6+~1.0.11-1) ... Setting up libidn2-0:arm64 (2.3.7-2+b1) ... Setting up libboost-filesystem1.83-dev:arm64 (1.83.0-4) ... Setting up libngtcp2-dev:arm64 (1.9.1-1) ... Setting up node-d3-shape (1.3.7+~1.3.8-1) ... Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... Setting up pkgconf:arm64 (1.8.1-4) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up help2man (1.49.3+b1) ... Setting up dh-autoreconf (20) ... Setting up node-d3-drag (1.2.5+~1.2.5-1) ... Setting up node-iconv-lite (0.6.3-3) ... Setting up libldap-dev:arm64 (2.6.9+dfsg-1) ... Setting up node-d3-scale (2.2.2+~2.2.6-1) ... Setting up libp11-kit0:arm64 (0.25.5-3) ... Setting up libgssapi-krb5-2:arm64 (1.21.3-4) ... Setting up libboost-regex1.83-dev:arm64 (1.83.0-4) ... Setting up libssh2-1-dev:arm64 (1.11.1-1) ... Setting up libidn2-dev:arm64 (2.3.7-2+b1) ... Setting up node-d3-force (2.1.1+~2.1.4-1) ... Setting up node-d3-contour (1.3.2+~1.3.3-1) ... Setting up libreadline8t64:arm64 (8.2-6) ... Setting up dh-strip-nondeterminism (1.14.1-1) ... Setting up node-d3-brush (1.1.6+~1.1.5-1) ... Setting up groff-base (1.23.0-7) ... Setting up node-d3-dsv (1.2.0+~1.2.3-1) ... Setting up libpython3.13-stdlib:arm64 (3.13.1-3) ... Setting up libboost-filesystem-dev:arm64 (1.83.0.2+b2) ... Setting up libp11-kit-dev:arm64 (0.25.5-3) ... Setting up libpython3-stdlib:arm64 (3.13.1-2) ... Setting up libgnutls30t64:arm64 (3.8.8-2) ... Setting up libgnutls-openssl27t64:arm64 (3.8.8-2) ... Setting up libnghttp2-dev:arm64 (1.64.0-1) ... Setting up python3.13 (3.13.1-3) ... Setting up libboost-iostreams1.83-dev:arm64 (1.83.0-4) ... Setting up node-d3-zoom (1.8.3+~1.8.4-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libpsl5t64:arm64 (0.21.2-1.1+b1) ... Setting up node-d3-fetch (1.2.0+~1.2.2-1) ... Setting up python3 (3.13.1-2) ... Setting up libboost-iostreams-dev:arm64 (1.83.0.2+b2) ... Setting up node-d3 (5.16.0+~cs5.28.10-2) ... Setting up man-db (2.13.0-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libpsl-dev:arm64 (0.21.2-1.1+b1) ... Setting up libgnutls-dane0t64:arm64 (3.8.8-2) ... Setting up librtmp1:arm64 (2.4+20151223.gitfa8646d.1-2+b5) ... Setting up libgssrpc4t64:arm64 (1.21.3-4) ... Setting up libngtcp2-crypto-gnutls8:arm64 (1.9.1-1) ... Setting up libkadm5clnt-mit12:arm64 (1.21.3-4) ... Setting up libgnutls28-dev:arm64 (3.8.8-2) ... Setting up libkdb5-10t64:arm64 (1.21.3-4) ... Setting up libcurl3t64-gnutls:arm64 (8.11.1-1+b1) ... Setting up debhelper (13.24.1) ... Setting up libngtcp2-crypto-gnutls-dev:arm64 (1.9.1-1) ... Setting up librtmp-dev:arm64 (2.4+20151223.gitfa8646d.1-2+b5) ... Setting up libkadm5srv-mit12:arm64 (1.21.3-4) ... Setting up libhts3t64:arm64 (1.20+ds-2) ... Setting up krb5-multidev:arm64 (1.21.3-4) ... Setting up libkrb5-dev:arm64 (1.21.3-4) ... Setting up libcurl4-gnutls-dev:arm64 (8.11.1-1+b1) ... Setting up libhts-dev:arm64 (1.20+ds-2) ... Processing triggers for libc-bin (2.40-6) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: user script /srv/workspace/pbuilder/226865/tmp/hooks/A99_set_merged_usr starting Not re-configuring usrmerge for unstable I: user script /srv/workspace/pbuilder/226865/tmp/hooks/A99_set_merged_usr finished hostname: Name or service not known I: Running cd /build/reproducible-path/ataqv-1.3.1+ds/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games:/i/capture/the/path" HOME="/nonexistent/second-build" dpkg-genchanges -S > ../ataqv_1.3.1+ds-2_source.changes dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.3.1+ds-2 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Lance Lin dpkg-source --before-build . dpkg-buildpackage: info: host architecture arm64 debian/rules clean dh clean dh_auto_clean make -j12 clean make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/ cp -s /usr/share/javascript/jquery/jquery.min.js \ /usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \ /usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' dh_auto_build -- all testing/run_ataqv_tests make -j12 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests make[2]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/ataqv.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/ataqv.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Features.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/HTS.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/IO.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Metrics.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Peaks.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Peaks.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/Utils.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/run_ataqv_tests.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/test_features.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/test_hts.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/test_io.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_io.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp:3: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); | ^~~~~~~~~~~~ In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp:1: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:3: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 173 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 178 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 249 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 259 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/test_utils.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_utils.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/Features.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Features.cpp In file included from /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp:1: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/HTS.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/IO.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/Metrics.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/Peaks.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Peaks.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/Utils.o -c /build/reproducible-path/ataqv-1.3.1+ds/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread g++ -g -O2 -ffile-prefix-map=/build/reproducible-path/ataqv-1.3.1+ds=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/reproducible-path/ataqv-1.3.1+ds/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread make[2]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' dh_auto_test make -j12 test make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 flag 83 Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'hg19.tss.refseq.bed.gz'. Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] chr1 feature count: 2687 chr2 feature count: 1715 chr3 feature count: 1490 chr4 feature count: 1004 chr5 feature count: 1132 chr6 feature count: 1368 chr7 feature count: 1169 chr8 feature count: 913 chr9 feature count: 1025 chr10 feature count: 1039 chr11 feature count: 1642 chr12 feature count: 1350 chr13 feature count: 433 chr14 feature count: 785 chr15 feature count: 812 chr16 feature count: 1106 chr17 feature count: 1528 chr18 feature count: 398 chr19 feature count: 1785 chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 Loaded 24989 TSS in 1.22601 seconds. (20382.4 TSS/second). Collecting metrics from test.bam. Logging problematic reads to SRR891275.problems. Loading peaks for read group SRR891275 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 9.77676 seconds. (3812.71 peaks/second). Logging problematic reads to SRR891278.problems. Loading peaks for read group SRR891278 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 9.77316 seconds. (3814.12 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 439 (84.423%) 10: 439 (84.423%) 15: 438 (84.231%) 20: 436 (83.846%) 25: 435 (83.654%) 30: 420 (80.769%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) Read Group ========== ID: SRR891278 Library: SRR891278 Sample: GSM1155967 Description: a library of brutal tests? Sequencing center: Sequencing date: Sequencing platform: ILLUMINA Platform model: Platform unit: Flow order: Key sequence: Predicted median insert size: Programs: Metrics ------- Read Mapping Metrics -------------------- Total reads: 520 Total problems: 90 (17.308%) Properly paired and mapped reads: 430 (82.692%) Secondary reads: 10 (1.923%) Supplementary reads: 0 (0.000%) Duplicate reads: 158 (30.385% of all reads) Quality Indicators ------------------ Short to mononucleosomal ratio: 2.357 High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 as a percentage of autosomal reads: 91.743% as a percentage of all reads: 38.462% TSS enrichment: 3.687 Paired Read Metrics ------------------- Paired reads: 520 (100.000%) Paired and mapped reads: 440 (84.615%) FR reads: 430 (82.692308%) First of pair: 259 (49.808%) Second of pair: 261 (50.192%) Forward reads: 261 (50.192%) Reverse reads: 259 (49.808%) Forward mate reads: 260 (50.000%) Reverse mate reads: 260 (50.000%) Unmapped Read Metrics --------------------- Unmapped reads: 8 (1.538%) Unmapped mate reads: 4 (0.769%) Reads not passing quality controls: 0 (0.000%) Unpaired reads: 0 (0.000%) Reads with zero mapping quality: 49 (9.423%) Aberrant Mapping Metrics ------------------------ RF reads: 6 (1.153846%) FF reads: 4 (0.769231%) RR reads: 9 (1.730769%) Reads that paired and mapped but... on different chromosomes: 8 (1.538%) probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) just not properly: 0 (0.000%) Autosomal/Mitochondrial Metrics ------------------------------- Total autosomal reads: 218 (41.923% of all reads) Total mitochondrial reads: 192 (36.923% of all reads) Duplicate autosomal reads: 17 (7.798% of all autosomal reads) Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) Mapping Quality --------------- Mean MAPQ: 48.044 Median MAPQ: 60.000 Reads with MAPQ >=... 5: 449 (86.346%) 10: 445 (85.577%) 15: 443 (85.192%) 20: 442 (85.000%) 25: 442 (85.000%) 30: 417 (80.192%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 9.772 seconds. (3814.494 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 888 (85.385%) 10: 884 (85.000%) 15: 881 (84.712%) 20: 878 (84.423%) 25: 877 (84.327%) 30: 837 (80.481%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (0.500% of all high quality autosomal alignments) Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from notthere.peaks.gz. Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'notthere.bed.gz'. =============================================================================== All tests passed (241 assertions in 54 test cases) make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' create-stamp debian/debhelper-build-stamp dh_prep debian/rules override_dh_auto_install make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' dh_auto_install -- prefix=/usr make -j12 install DESTDIR=/build/reproducible-path/ataqv-1.3.1\+ds/debian/ataqv AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" prefix=/usr make[2]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' install -d -m 0755 /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin Installing to /usr install -d -m 0755 /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin install -d -m 0755 /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web for f in src/scripts/make_ataqv_pipeline src/scripts/mkarv src/scripts/run_ataqv_example src/scripts/srvarv; do sed -e 's/{{VERSION}}/1.3.1/g' $f > build/$(basename $f); install -m 0755 build/$(basename $f) /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin; done install -m 0755 build/ataqv /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/bin cp -a src/web/* /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web find /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web -type d -exec chmod 755 {} \; find /build/reproducible-path/ataqv-1.3.1+ds/debian/ataqv/usr/share/ataqv/web -type f -exec chmod 644 {} \; make[2]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' dh_install dh_installdocs dh_installchangelogs dh_installexamples debian/rules override_dh_installman make[1]: Entering directory '/build/reproducible-path/ataqv-1.3.1+ds' help2man --no-info --name="QC metrics for ATAC-seq data" build/ataqv > debian/ataqv.1 help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1 help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.3.1+ds src/scripts/srvarv > debian/srvarv.1 dh_installman make[1]: Leaving directory '/build/reproducible-path/ataqv-1.3.1+ds' dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dpkg-shlibdeps: warning: diversions involved - output may be incorrect diversion by libc6 from: /lib/ld-linux-aarch64.so.1 dpkg-shlibdeps: warning: diversions involved - output may be incorrect diversion by libc6 to: /lib/ld-linux-aarch64.so.1.usr-is-merged dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'ataqv' in '../ataqv_1.3.1+ds-2_arm64.deb'. dpkg-deb: building package 'ataqv-dbgsym' in '../ataqv-dbgsym_1.3.1+ds-2_arm64.deb'. dpkg-genbuildinfo --build=binary -O../ataqv_1.3.1+ds-2_arm64.buildinfo dpkg-genchanges --build=binary -O../ataqv_1.3.1+ds-2_arm64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: user script /srv/workspace/pbuilder/226865/tmp/hooks/B01_cleanup starting I: user script /srv/workspace/pbuilder/226865/tmp/hooks/B01_cleanup finished I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/226865 and its subdirectories I: Current time: Thu Mar 5 15:57:51 +14 2026 I: pbuilder-time-stamp: 1772675871