Mon May 22 02:50:43 UTC 2023 I: starting to build ataqv/bookworm/armhf on jenkins on '2023-05-22 02:50' Mon May 22 02:50:43 UTC 2023 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/armhf_19/488/console.log Mon May 22 02:50:43 UTC 2023 I: Downloading source for bookworm/ataqv=1.3.0+ds-2 --2023-05-22 02:50:43-- http://cdn-fastly.deb.debian.org/debian/pool/main/a/ataqv/ataqv_1.3.0%2bds-2.dsc Connecting to 78.137.99.97:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2256 (2.2K) [text/prs.lines.tag] Saving to: ‘ataqv_1.3.0+ds-2.dsc’ 0K .. 100% 24.9M=0s 2023-05-22 02:50:43 (24.9 MB/s) - ‘ataqv_1.3.0+ds-2.dsc’ saved [2256/2256] Mon May 22 02:50:44 UTC 2023 I: ataqv_1.3.0+ds-2.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: ataqv Binary: ataqv Architecture: any Version: 1.3.0+ds-2 Maintainer: Debian Med Packaging Team Uploaders: Michael R. Crusoe Homepage: https://github.com/ParkerLab/ataqv/ Standards-Version: 4.6.1 Vcs-Browser: https://salsa.debian.org/med-team/ataqv Vcs-Git: https://salsa.debian.org/med-team/ataqv.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper Package-List: ataqv deb science optional arch=any Checksums-Sha1: fc1bcceb4f034fb84eb89a9fdbd2d68870a0f676 4068000 ataqv_1.3.0+ds.orig.tar.xz dd3c0926a24b95504c3fa9332c2c3aea235f13f6 9216 ataqv_1.3.0+ds-2.debian.tar.xz Checksums-Sha256: 080d95e158275f4e23d49ed1bd2717790fdd764e6a4b3aa599ffad891eed7040 4068000 ataqv_1.3.0+ds.orig.tar.xz 15dda419acffae11446f4f276b50e8ba395448e83b108d7ae23f09761bb4672e 9216 ataqv_1.3.0+ds-2.debian.tar.xz Files: 3d49605d269fe61d2f600391c24d56b9 4068000 ataqv_1.3.0+ds.orig.tar.xz 791cfd07ba2e1f6f70f24088b92d97b1 9216 ataqv_1.3.0+ds-2.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmM2yKERHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtFwKQ/7BcdKxuuoSITw6d8J+rpTqL3mnsWW5/vr qgu4R602x67iQIx1IThpOqWnjmZUiGj7VTQ+qLDdk1CNGbbzLxjbUVS4QVA0066v zATRh3rsr3YMP+AySNA3OY9Jy2PeNc98WHejgo8HlHSs+8v1lqmoQ3pDq9uAGhWk QWT64JUc4BFYggLIr4lLdcMFiogwI5TnVwUPrhmglgm7mxMcJykhyxvTchlEYIO/ x3aON7qaYOmUWvH0WV7cMvnOX5VclpIJOYuTgs4J3dJjgg/RuO3clXkAWi3ihZx8 aF84xkRsMZnrWQm0Y1SOH7So8mkCxvK+RPS9yQGpcJRl1ltP29Ncr8Krf/SK4Ud3 q+hupAN9ZqFhCYgz3MNZV024bqnfSCoaWrL/E8g1Ua4ZN0eyvqd0B2fjKPmHgWLZ vjzF3r5hz++L/7TuljL/nboa6o26d9VWL1aLmKM3eEptTEkGtwhzvvmBB6ekQTdf miruBUeWKH/aCAWQWh+aKVD+JmgvXhg2S4Mex4wrqS/lvC1gYzLCw2AYF5uJ5gNN 2Qf14cwpixzqPicihumOsNRYJMXlfNJqNPwQbQMqfl1ax8hdryx8fP+IOWWvzxtN guPS53mqQp33ekLLxOLRsSEmnNOrWdNukEq6qRe6TCn713xxUpvtm92DQyPCi51F i+L/pKtu2us= =Gzra -----END PGP SIGNATURE----- Mon May 22 02:50:44 UTC 2023 I: Checking whether the package is not for us Mon May 22 02:50:44 UTC 2023 I: Starting 1st build on remote node virt64c-armhf-rb.debian.net. Mon May 22 02:50:44 UTC 2023 I: Preparing to do remote build '1' on virt64c-armhf-rb.debian.net. Mon May 22 02:58:46 UTC 2023 I: Deleting $TMPDIR on virt64c-armhf-rb.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Sun May 21 14:50:52 -12 2023 I: pbuilder-time-stamp: 1684723852 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/bookworm-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [ataqv_1.3.0+ds-2.dsc] I: copying [./ataqv_1.3.0+ds.orig.tar.xz] I: copying [./ataqv_1.3.0+ds-2.debian.tar.xz] I: Extracting source gpgv: Signature made Thu Sep 29 22:44:49 2022 -12 gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 gpgv: issuer "tille@debian.org" gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.0+ds-2.dsc: no acceptable signature found dpkg-source: info: extracting ataqv in ataqv-1.3.0+ds dpkg-source: info: unpacking ataqv_1.3.0+ds.orig.tar.xz dpkg-source: info: unpacking ataqv_1.3.0+ds-2.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying modernize dpkg-source: info: applying no_cov dpkg-source: info: applying python3 dpkg-source: info: applying packaged_js dpkg-source: info: applying spelling dpkg-source: info: applying clean_less dpkg-source: info: applying reproducible_build I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/32670/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='armhf' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=3 ' DISTRIBUTION='bookworm' HOME='/root' HOST_ARCH='armhf' IFS=' ' INVOCATION_ID='c92cef8da69c427fbddedf9a54e634ae' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='32670' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/pbuilderrc_Odvn --distribution bookworm --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/bookworm-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/b1 --logfile b1/build.log ataqv_1.3.0+ds-2.dsc' SUDO_GID='113' SUDO_UID='107' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://10.0.0.15:3142/' I: uname -a Linux virt64c 5.10.0-23-arm64 #1 SMP Debian 5.10.179-1 (2023-05-12) aarch64 GNU/Linux I: ls -l /bin total 5072 -rwxr-xr-x 1 root root 838488 Apr 23 09:24 bash -rwxr-xr-x 3 root root 67144 Sep 18 2022 bunzip2 -rwxr-xr-x 3 root root 67144 Sep 18 2022 bzcat lrwxrwxrwx 1 root root 6 Sep 18 2022 bzcmp -> bzdiff -rwxr-xr-x 1 root root 2225 Sep 18 2022 bzdiff lrwxrwxrwx 1 root root 6 Sep 18 2022 bzegrep -> bzgrep -rwxr-xr-x 1 root root 4893 Nov 27 2021 bzexe lrwxrwxrwx 1 root root 6 Sep 18 2022 bzfgrep -> bzgrep -rwxr-xr-x 1 root root 3775 Sep 18 2022 bzgrep -rwxr-xr-x 3 root root 67144 Sep 18 2022 bzip2 -rwxr-xr-x 1 root root 67112 Sep 18 2022 bzip2recover lrwxrwxrwx 1 root root 6 Sep 18 2022 bzless -> bzmore -rwxr-xr-x 1 root root 1297 Sep 18 2022 bzmore -rwxr-xr-x 1 root root 67632 Sep 20 2022 cat -rwxr-xr-x 1 root root 67676 Sep 20 2022 chgrp -rwxr-xr-x 1 root root 67644 Sep 20 2022 chmod -rwxr-xr-x 1 root root 67684 Sep 20 2022 chown -rwxr-xr-x 1 root root 133532 Sep 20 2022 cp -rwxr-xr-x 1 root root 132868 Jan 5 01:20 dash -rwxr-xr-x 1 root root 133220 Sep 20 2022 date -rwxr-xr-x 1 root root 67732 Sep 20 2022 dd -rwxr-xr-x 1 root root 68104 Sep 20 2022 df -rwxr-xr-x 1 root root 133632 Sep 20 2022 dir -rwxr-xr-x 1 root root 59128 Mar 22 21:02 dmesg lrwxrwxrwx 1 root root 8 Dec 19 01:33 dnsdomainname -> hostname lrwxrwxrwx 1 root root 8 Dec 19 01:33 domainname -> hostname -rwxr-xr-x 1 root root 67560 Sep 20 2022 echo -rwxr-xr-x 1 root root 41 Jan 24 02:43 egrep -rwxr-xr-x 1 root root 67548 Sep 20 2022 false -rwxr-xr-x 1 root root 41 Jan 24 02:43 fgrep -rwxr-xr-x 1 root root 55748 Mar 22 21:02 findmnt -rwsr-xr-x 1 root root 26208 Mar 22 20:15 fusermount -rwxr-xr-x 1 root root 128608 Jan 24 02:43 grep -rwxr-xr-x 2 root root 2346 Apr 9 2022 gunzip -rwxr-xr-x 1 root root 6447 Apr 9 2022 gzexe -rwxr-xr-x 1 root root 64220 Apr 9 2022 gzip -rwxr-xr-x 1 root root 67032 Dec 19 01:33 hostname -rwxr-xr-x 1 root root 67720 Sep 20 2022 ln -rwxr-xr-x 1 root root 35132 Mar 22 21:51 login -rwxr-xr-x 1 root root 133632 Sep 20 2022 ls -rwxr-xr-x 1 root root 136808 Mar 22 21:02 lsblk -rwxr-xr-x 1 root root 67800 Sep 20 2022 mkdir -rwxr-xr-x 1 root root 67764 Sep 20 2022 mknod -rwxr-xr-x 1 root root 67596 Sep 20 2022 mktemp -rwxr-xr-x 1 root root 38504 Mar 22 21:02 more -rwsr-xr-x 1 root root 38496 Mar 22 21:02 mount -rwxr-xr-x 1 root root 9824 Mar 22 21:02 mountpoint -rwxr-xr-x 1 root root 133532 Sep 20 2022 mv lrwxrwxrwx 1 root root 8 Dec 19 01:33 nisdomainname -> hostname lrwxrwxrwx 1 root root 14 Apr 2 18:25 pidof -> /sbin/killall5 -rwxr-xr-x 1 root root 67608 Sep 20 2022 pwd lrwxrwxrwx 1 root root 4 Apr 23 09:24 rbash -> bash -rwxr-xr-x 1 root root 67600 Sep 20 2022 readlink -rwxr-xr-x 1 root root 67672 Sep 20 2022 rm -rwxr-xr-x 1 root root 67600 Sep 20 2022 rmdir -rwxr-xr-x 1 root root 67400 Nov 2 2022 run-parts -rwxr-xr-x 1 root root 133372 Jan 5 07:55 sed lrwxrwxrwx 1 root root 4 Jan 5 01:20 sh -> dash -rwxr-xr-x 1 root root 67584 Sep 20 2022 sleep -rwxr-xr-x 1 root root 67644 Sep 20 2022 stty -rwsr-xr-x 1 root root 50800 Mar 22 21:02 su -rwxr-xr-x 1 root root 67584 Sep 20 2022 sync -rwxr-xr-x 1 root root 336764 Apr 6 02:25 tar -rwxr-xr-x 1 root root 67144 Nov 2 2022 tempfile -rwxr-xr-x 1 root root 133224 Sep 20 2022 touch -rwxr-xr-x 1 root root 67548 Sep 20 2022 true -rwxr-xr-x 1 root root 9768 Mar 22 20:15 ulockmgr_server -rwsr-xr-x 1 root root 22108 Mar 22 21:02 umount -rwxr-xr-x 1 root root 67572 Sep 20 2022 uname -rwxr-xr-x 2 root root 2346 Apr 9 2022 uncompress -rwxr-xr-x 1 root root 133632 Sep 20 2022 vdir -rwxr-xr-x 1 root root 42608 Mar 22 21:02 wdctl lrwxrwxrwx 1 root root 8 Dec 19 01:33 ypdomainname -> hostname -rwxr-xr-x 1 root root 1984 Apr 9 2022 zcat -rwxr-xr-x 1 root root 1678 Apr 9 2022 zcmp -rwxr-xr-x 1 root root 6460 Apr 9 2022 zdiff -rwxr-xr-x 1 root root 29 Apr 9 2022 zegrep -rwxr-xr-x 1 root root 29 Apr 9 2022 zfgrep -rwxr-xr-x 1 root root 2081 Apr 9 2022 zforce -rwxr-xr-x 1 root root 8103 Apr 9 2022 zgrep -rwxr-xr-x 1 root root 2206 Apr 9 2022 zless -rwxr-xr-x 1 root root 1842 Apr 9 2022 zmore -rwxr-xr-x 1 root root 4577 Apr 9 2022 znew I: user script /srv/workspace/pbuilder/32670/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: armhf Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses5-dev, libtinfo-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19329 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on libboost-filesystem-dev; however: Package libboost-filesystem-dev is not installed. pbuilder-satisfydepends-dummy depends on libboost-iostreams-dev; however: Package libboost-iostreams-dev is not installed. pbuilder-satisfydepends-dummy depends on libboost-system-dev; however: Package libboost-system-dev is not installed. pbuilder-satisfydepends-dummy depends on libboost-chrono-dev; however: Package libboost-chrono-dev is not installed. pbuilder-satisfydepends-dummy depends on libhts-dev; however: Package libhts-dev is not installed. pbuilder-satisfydepends-dummy depends on libncurses5-dev; however: Package libncurses5-dev is not installed. pbuilder-satisfydepends-dummy depends on libtinfo-dev; however: Package libtinfo-dev is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. pbuilder-satisfydepends-dummy depends on libjs-jquery; however: Package libjs-jquery is not installed. pbuilder-satisfydepends-dummy depends on libjs-jquery-datatables; however: Package libjs-jquery-datatables is not installed. pbuilder-satisfydepends-dummy depends on libjs-jquery-datatables-extensions; however: Package libjs-jquery-datatables-extensions is not installed. pbuilder-satisfydepends-dummy depends on fonts-font-awesome; however: Package fonts-font-awesome is not installed. pbuilder-satisfydepends-dummy depends on node-normalize.css; however: Package node-normalize.css is not installed. pbuilder-satisfydepends-dummy depends on help2man; however: Package help2man is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on node-d3; however: Package node-d3 is not installed. pbuilder-satisfydepends-dummy depends on debhelper; however: Package debhelper is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} fonts-font-awesome{a} gettext{a} gettext-base{a} groff-base{a} help2man{a} icu-devtools{a} intltool-debian{a} libarchive-zip-perl{a} libboost-chrono-dev{a} libboost-chrono1.74-dev{a} libboost-chrono1.74.0{a} libboost-filesystem-dev{a} libboost-filesystem1.74-dev{a} libboost-filesystem1.74.0{a} libboost-iostreams-dev{a} libboost-iostreams1.74-dev{a} libboost-regex1.74-dev{a} libboost-regex1.74.0{a} libboost-system-dev{a} libboost-system1.74-dev{a} libboost-system1.74.0{a} libboost1.74-dev{a} libbrotli1{a} libcurl3-gnutls{a} libcurl4-gnutls-dev{a} libdebhelper-perl{a} libdeflate-dev{a} libdeflate0{a} libelf1{a} libexpat1{a} libfile-stripnondeterminism-perl{a} libhts-dev{a} libhts3{a} libhtscodecs2{a} libicu-dev{a} libicu72{a} libjs-d3-format{a} libjs-jquery{a} libjs-jquery-datatables{a} libjs-jquery-datatables-extensions{a} libldap-2.5-0{a} liblocale-gettext-perl{a} liblzma-dev{a} libmagic-mgc{a} libmagic1{a} libncurses-dev{a} libncurses5-dev{a} libncurses6{a} libnghttp2-14{a} libpipeline1{a} libpsl5{a} libpython3-stdlib{a} libpython3.11-minimal{a} libpython3.11-stdlib{a} libreadline8{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libssh2-1{a} libsub-override-perl{a} libtool{a} libuchardet0{a} libxml2{a} m4{a} man-db{a} media-types{a} node-commander{a} node-d3{a} node-d3-array{a} node-d3-axis{a} node-d3-brush{a} node-d3-chord{a} node-d3-collection{a} node-d3-color{a} node-d3-contour{a} node-d3-dispatch{a} node-d3-drag{a} node-d3-dsv{a} node-d3-ease{a} node-d3-fetch{a} node-d3-force{a} node-d3-format{a} node-d3-geo{a} node-d3-hierarchy{a} node-d3-interpolate{a} node-d3-path{a} node-d3-polygon{a} node-d3-quadtree{a} node-d3-queue{a} node-d3-random{a} node-d3-scale{a} node-d3-scale-chromatic{a} node-d3-selection{a} node-d3-shape{a} node-d3-time{a} node-d3-time-format{a} node-d3-timer{a} node-d3-transition{a} node-d3-voronoi{a} node-d3-zoom{a} node-iconv-lite{a} node-normalize.css{a} node-rw{a} node-safe-buffer{a} po-debconf{a} python3{a} python3-minimal{a} python3.11{a} python3.11-minimal{a} readline-common{a} sensible-utils{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl javascript-common libarchive-cpio-perl libgpm2 libldap-common libltdl-dev libmail-sendmail-perl libsasl2-modules lynx publicsuffix wget 0 packages upgraded, 122 newly installed, 0 to remove and 0 not upgraded. Need to get 54.2 MB of archives. After unpacking 323 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian bookworm/main armhf liblocale-gettext-perl armhf 1.07-5 [14.9 kB] Get: 2 http://deb.debian.org/debian bookworm/main armhf libpython3.11-minimal armhf 3.11.2-6 [798 kB] Get: 3 http://deb.debian.org/debian bookworm/main armhf libexpat1 armhf 2.5.0-1 [79.9 kB] Get: 4 http://deb.debian.org/debian bookworm/main armhf python3.11-minimal armhf 3.11.2-6 [1714 kB] Get: 5 http://deb.debian.org/debian bookworm/main armhf python3-minimal armhf 3.11.2-1+b1 [26.3 kB] Get: 6 http://deb.debian.org/debian bookworm/main armhf media-types all 10.0.0 [26.1 kB] Get: 7 http://deb.debian.org/debian bookworm/main armhf readline-common all 8.2-1.3 [69.0 kB] Get: 8 http://deb.debian.org/debian bookworm/main armhf libreadline8 armhf 8.2-1.3 [144 kB] Get: 9 http://deb.debian.org/debian bookworm/main armhf libpython3.11-stdlib armhf 3.11.2-6 [1678 kB] Get: 10 http://deb.debian.org/debian bookworm/main armhf python3.11 armhf 3.11.2-6 [572 kB] Get: 11 http://deb.debian.org/debian bookworm/main armhf libpython3-stdlib armhf 3.11.2-1+b1 [9296 B] Get: 12 http://deb.debian.org/debian bookworm/main armhf python3 armhf 3.11.2-1+b1 [26.3 kB] Get: 13 http://deb.debian.org/debian bookworm/main armhf sensible-utils all 0.0.17+nmu1 [19.0 kB] Get: 14 http://deb.debian.org/debian bookworm/main armhf libmagic-mgc armhf 1:5.44-3 [305 kB] Get: 15 http://deb.debian.org/debian bookworm/main armhf libmagic1 armhf 1:5.44-3 [96.5 kB] Get: 16 http://deb.debian.org/debian bookworm/main armhf file armhf 1:5.44-3 [41.6 kB] Get: 17 http://deb.debian.org/debian bookworm/main armhf gettext-base armhf 0.21-12 [157 kB] Get: 18 http://deb.debian.org/debian bookworm/main armhf libuchardet0 armhf 0.0.7-1 [65.0 kB] Get: 19 http://deb.debian.org/debian bookworm/main armhf groff-base armhf 1.22.4-10 [825 kB] Get: 20 http://deb.debian.org/debian bookworm/main armhf bsdextrautils armhf 2.38.1-5+b1 [78.6 kB] Get: 21 http://deb.debian.org/debian bookworm/main armhf libpipeline1 armhf 1.5.7-1 [33.6 kB] Get: 22 http://deb.debian.org/debian bookworm/main armhf man-db armhf 2.11.2-2 [1351 kB] Get: 23 http://deb.debian.org/debian bookworm/main armhf m4 armhf 1.4.19-3 [265 kB] Get: 24 http://deb.debian.org/debian bookworm/main armhf autoconf all 2.71-3 [332 kB] Get: 25 http://deb.debian.org/debian bookworm/main armhf autotools-dev all 20220109.1 [51.6 kB] Get: 26 http://deb.debian.org/debian bookworm/main armhf automake all 1:1.16.5-1.3 [823 kB] Get: 27 http://deb.debian.org/debian bookworm/main armhf autopoint all 0.21-12 [495 kB] Get: 28 http://deb.debian.org/debian bookworm/main armhf libdebhelper-perl all 13.11.4 [81.2 kB] Get: 29 http://deb.debian.org/debian bookworm/main armhf libtool all 2.4.7-5 [517 kB] Get: 30 http://deb.debian.org/debian bookworm/main armhf dh-autoreconf all 20 [17.1 kB] Get: 31 http://deb.debian.org/debian bookworm/main armhf libarchive-zip-perl all 1.68-1 [104 kB] Get: 32 http://deb.debian.org/debian bookworm/main armhf libsub-override-perl all 0.09-4 [9304 B] Get: 33 http://deb.debian.org/debian bookworm/main armhf libfile-stripnondeterminism-perl all 1.13.1-1 [19.4 kB] Get: 34 http://deb.debian.org/debian bookworm/main armhf dh-strip-nondeterminism all 1.13.1-1 [8620 B] Get: 35 http://deb.debian.org/debian bookworm/main armhf libelf1 armhf 0.188-2.1 [170 kB] Get: 36 http://deb.debian.org/debian bookworm/main armhf dwz armhf 0.15-1 [101 kB] Get: 37 http://deb.debian.org/debian bookworm/main armhf libicu72 armhf 72.1-3 [9048 kB] Get: 38 http://deb.debian.org/debian bookworm/main armhf libxml2 armhf 2.9.14+dfsg-1.2 [591 kB] Get: 39 http://deb.debian.org/debian bookworm/main armhf gettext armhf 0.21-12 [1229 kB] Get: 40 http://deb.debian.org/debian bookworm/main armhf intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 41 http://deb.debian.org/debian bookworm/main armhf po-debconf all 1.0.21+nmu1 [248 kB] Get: 42 http://deb.debian.org/debian bookworm/main armhf debhelper all 13.11.4 [942 kB] Get: 43 http://deb.debian.org/debian bookworm/main armhf fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [517 kB] Get: 44 http://deb.debian.org/debian bookworm/main armhf help2man armhf 1.49.3 [198 kB] Get: 45 http://deb.debian.org/debian bookworm/main armhf icu-devtools armhf 72.1-3 [183 kB] Get: 46 http://deb.debian.org/debian bookworm/main armhf libboost1.74-dev armhf 1.74.0+ds1-20 [9510 kB] Get: 47 http://deb.debian.org/debian bookworm/main armhf libboost-chrono1.74.0 armhf 1.74.0+ds1-20 [224 kB] Get: 48 http://deb.debian.org/debian bookworm/main armhf libboost-chrono1.74-dev armhf 1.74.0+ds1-20 [231 kB] Get: 49 http://deb.debian.org/debian bookworm/main armhf libboost-chrono-dev armhf 1.74.0.3 [4960 B] Get: 50 http://deb.debian.org/debian bookworm/main armhf libboost-filesystem1.74.0 armhf 1.74.0+ds1-20 [250 kB] Get: 51 http://deb.debian.org/debian bookworm/main armhf libboost-system1.74.0 armhf 1.74.0+ds1-20 [218 kB] Get: 52 http://deb.debian.org/debian bookworm/main armhf libboost-system1.74-dev armhf 1.74.0+ds1-20 [219 kB] Get: 53 http://deb.debian.org/debian bookworm/main armhf libboost-filesystem1.74-dev armhf 1.74.0+ds1-20 [264 kB] Get: 54 http://deb.debian.org/debian bookworm/main armhf libboost-filesystem-dev armhf 1.74.0.3 [4368 B] Get: 55 http://deb.debian.org/debian bookworm/main armhf libboost-regex1.74.0 armhf 1.74.0+ds1-20 [432 kB] Get: 56 http://deb.debian.org/debian bookworm/main armhf libicu-dev armhf 72.1-3 [10.1 MB] Get: 57 http://deb.debian.org/debian bookworm/main armhf libboost-regex1.74-dev armhf 1.74.0+ds1-20 [543 kB] Get: 58 http://deb.debian.org/debian bookworm/main armhf libboost-iostreams1.74-dev armhf 1.74.0+ds1-20 [247 kB] Get: 59 http://deb.debian.org/debian bookworm/main armhf libboost-iostreams-dev armhf 1.74.0.3 [4316 B] Get: 60 http://deb.debian.org/debian bookworm/main armhf libboost-system-dev armhf 1.74.0.3 [4468 B] Get: 61 http://deb.debian.org/debian bookworm/main armhf libbrotli1 armhf 1.0.9-2+b6 [271 kB] Get: 62 http://deb.debian.org/debian bookworm/main armhf libsasl2-modules-db armhf 2.1.28+dfsg-10 [19.0 kB] Get: 63 http://deb.debian.org/debian bookworm/main armhf libsasl2-2 armhf 2.1.28+dfsg-10 [52.3 kB] Get: 64 http://deb.debian.org/debian bookworm/main armhf libldap-2.5-0 armhf 2.5.13+dfsg-5 [158 kB] Get: 65 http://deb.debian.org/debian bookworm/main armhf libnghttp2-14 armhf 1.52.0-1 [60.8 kB] Get: 66 http://deb.debian.org/debian bookworm/main armhf libpsl5 armhf 0.21.2-1 [57.5 kB] Get: 67 http://deb.debian.org/debian bookworm/main armhf librtmp1 armhf 2.4+20151223.gitfa8646d.1-2+b2 [55.2 kB] Get: 68 http://deb.debian.org/debian bookworm/main armhf libssh2-1 armhf 1.10.0-3+b1 [163 kB] Get: 69 http://deb.debian.org/debian bookworm/main armhf libcurl3-gnutls armhf 7.88.1-9 [343 kB] Get: 70 http://deb.debian.org/debian bookworm/main armhf libcurl4-gnutls-dev armhf 7.88.1-9 [448 kB] Get: 71 http://deb.debian.org/debian bookworm/main armhf libdeflate0 armhf 1.14-1 [52.2 kB] Get: 72 http://deb.debian.org/debian bookworm/main armhf libdeflate-dev armhf 1.14-1 [48.7 kB] Get: 73 http://deb.debian.org/debian bookworm/main armhf libhtscodecs2 armhf 1.3.0-4 [60.4 kB] Get: 74 http://deb.debian.org/debian bookworm/main armhf libhts3 armhf 1.16+ds-3 [375 kB] Get: 75 http://deb.debian.org/debian bookworm/main armhf liblzma-dev armhf 5.4.1-0.2 [248 kB] Get: 76 http://deb.debian.org/debian bookworm/main armhf zlib1g-dev armhf 1:1.2.13.dfsg-1 [902 kB] Get: 77 http://deb.debian.org/debian bookworm/main armhf libhts-dev armhf 1.16+ds-3 [1517 kB] Get: 78 http://deb.debian.org/debian bookworm/main armhf libjs-d3-format all 1:1.4.1-7 [17.0 kB] Get: 79 http://deb.debian.org/debian bookworm/main armhf libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [326 kB] Get: 80 http://deb.debian.org/debian bookworm/main armhf libjs-jquery-datatables all 1.11.5+dfsg-2 [144 kB] Get: 81 http://deb.debian.org/debian bookworm/main armhf libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] Get: 82 http://deb.debian.org/debian bookworm/main armhf libncurses6 armhf 6.4-4 [81.1 kB] Get: 83 http://deb.debian.org/debian bookworm/main armhf libncurses-dev armhf 6.4-4 [311 kB] Get: 84 http://deb.debian.org/debian bookworm/main armhf libncurses5-dev armhf 6.4-4 [932 B] Get: 85 http://deb.debian.org/debian bookworm/main armhf node-commander all 9.4.1-1 [65.3 kB] Get: 86 http://deb.debian.org/debian bookworm/main armhf node-d3-array all 3.2.0+~cs5.0.6-2 [44.1 kB] Get: 87 http://deb.debian.org/debian bookworm/main armhf node-d3-axis all 1.0.12-5 [10.1 kB] Get: 88 http://deb.debian.org/debian bookworm/main armhf node-d3-dispatch all 1.0.6-4 [7892 B] Get: 89 http://deb.debian.org/debian bookworm/main armhf node-d3-selection all 1.4.0-8 [30.8 kB] Get: 90 http://deb.debian.org/debian bookworm/main armhf node-d3-drag all 1.2.5-4 [13.9 kB] Get: 91 http://deb.debian.org/debian bookworm/main armhf node-d3-color all 1.2.8-5 [15.0 kB] Get: 92 http://deb.debian.org/debian bookworm/main armhf node-d3-interpolate all 1.4.0-4 [18.5 kB] Get: 93 http://deb.debian.org/debian bookworm/main armhf node-d3-ease all 1.0.5-5 [9956 B] Get: 94 http://deb.debian.org/debian bookworm/main armhf node-d3-timer all 1.0.10-3 [8500 B] Get: 95 http://deb.debian.org/debian bookworm/main armhf node-d3-transition all 1.3.2-6 [22.3 kB] Get: 96 http://deb.debian.org/debian bookworm/main armhf node-d3-brush all 1.1.5-4 [181 kB] Get: 97 http://deb.debian.org/debian bookworm/main armhf node-d3-path all 1.0.9-4 [8224 B] Get: 98 http://deb.debian.org/debian bookworm/main armhf node-d3-chord all 1.0.6-7 [10.2 kB] Get: 99 http://deb.debian.org/debian bookworm/main armhf node-d3-collection all 1.0.7-5 [11.8 kB] Get: 100 http://deb.debian.org/debian bookworm/main armhf node-d3-contour all 1.3.2-8 [14.1 kB] Get: 101 http://deb.debian.org/debian bookworm/main armhf node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.5 kB] Get: 102 http://deb.debian.org/debian bookworm/main armhf node-iconv-lite all 0.6.3-3 [115 kB] Get: 103 http://deb.debian.org/debian bookworm/main armhf node-d3-queue all 3.0.7-13 [10.2 kB] Get: 104 http://deb.debian.org/debian bookworm/main armhf node-rw all 1.3.3-5 [7428 B] Get: 105 http://deb.debian.org/debian bookworm/main armhf node-d3-dsv all 1.1.1-9 [13.3 kB] Get: 106 http://deb.debian.org/debian bookworm/main armhf node-d3-fetch all 1.2.0-5 [7556 B] Get: 107 http://deb.debian.org/debian bookworm/main armhf node-d3-quadtree all 1.0.7-4 [13.1 kB] Get: 108 http://deb.debian.org/debian bookworm/main armhf node-d3-force all 1.2.1-5 [368 kB] Get: 109 http://deb.debian.org/debian bookworm/main armhf node-d3-format all 1:1.4.1-7 [9072 B] Get: 110 http://deb.debian.org/debian bookworm/main armhf node-d3-geo all 1.11.9-6 [53.7 kB] Get: 111 http://deb.debian.org/debian bookworm/main armhf node-d3-hierarchy all 1.1.8-6 [28.7 kB] Get: 112 http://deb.debian.org/debian bookworm/main armhf node-d3-polygon all 1.0.5-5 [7420 B] Get: 113 http://deb.debian.org/debian bookworm/main armhf node-d3-random all 1.1.2-5 [7180 B] Get: 114 http://deb.debian.org/debian bookworm/main armhf node-d3-time all 1.0.11-6 [14.5 kB] Get: 115 http://deb.debian.org/debian bookworm/main armhf node-d3-time-format all 2.1.3-7 [19.1 kB] Get: 116 http://deb.debian.org/debian bookworm/main armhf node-d3-scale all 2.2.2-6 [31.6 kB] Get: 117 http://deb.debian.org/debian bookworm/main armhf node-d3-scale-chromatic all 1.5.0-7 [18.8 kB] Get: 118 http://deb.debian.org/debian bookworm/main armhf node-d3-shape all 1.3.7-5 [40.5 kB] Get: 119 http://deb.debian.org/debian bookworm/main armhf node-d3-voronoi all 1.1.4-5 [17.2 kB] Get: 120 http://deb.debian.org/debian bookworm/main armhf node-d3-zoom all 1.8.3-4 [20.1 kB] Get: 121 http://deb.debian.org/debian bookworm/main armhf node-d3 all 5.16.0-10 [219 kB] Get: 122 http://deb.debian.org/debian bookworm/main armhf node-normalize.css all 8.0.1-5 [12.7 kB] Fetched 54.2 MB in 1s (40.5 MB/s) debconf: delaying package configuration, since apt-utils is not installed Selecting previously unselected package liblocale-gettext-perl. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19329 files and directories currently installed.) Preparing to unpack .../liblocale-gettext-perl_1.07-5_armhf.deb ... Unpacking liblocale-gettext-perl (1.07-5) ... Selecting previously unselected package libpython3.11-minimal:armhf. Preparing to unpack .../libpython3.11-minimal_3.11.2-6_armhf.deb ... Unpacking libpython3.11-minimal:armhf (3.11.2-6) ... Selecting previously unselected package libexpat1:armhf. Preparing to unpack .../libexpat1_2.5.0-1_armhf.deb ... Unpacking libexpat1:armhf (2.5.0-1) ... Selecting previously unselected package python3.11-minimal. Preparing to unpack .../python3.11-minimal_3.11.2-6_armhf.deb ... Unpacking python3.11-minimal (3.11.2-6) ... Setting up libpython3.11-minimal:armhf (3.11.2-6) ... Setting up libexpat1:armhf (2.5.0-1) ... Setting up python3.11-minimal (3.11.2-6) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19659 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.11.2-1+b1_armhf.deb ... Unpacking python3-minimal (3.11.2-1+b1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_10.0.0_all.deb ... Unpacking media-types (10.0.0) ... Selecting previously unselected package readline-common. Preparing to unpack .../2-readline-common_8.2-1.3_all.deb ... Unpacking readline-common (8.2-1.3) ... Selecting previously unselected package libreadline8:armhf. Preparing to unpack .../3-libreadline8_8.2-1.3_armhf.deb ... Unpacking libreadline8:armhf (8.2-1.3) ... Selecting previously unselected package libpython3.11-stdlib:armhf. Preparing to unpack .../4-libpython3.11-stdlib_3.11.2-6_armhf.deb ... Unpacking libpython3.11-stdlib:armhf (3.11.2-6) ... Selecting previously unselected package python3.11. Preparing to unpack .../5-python3.11_3.11.2-6_armhf.deb ... Unpacking python3.11 (3.11.2-6) ... Selecting previously unselected package libpython3-stdlib:armhf. Preparing to unpack .../6-libpython3-stdlib_3.11.2-1+b1_armhf.deb ... Unpacking libpython3-stdlib:armhf (3.11.2-1+b1) ... Setting up python3-minimal (3.11.2-1+b1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20093 files and directories currently installed.) Preparing to unpack .../000-python3_3.11.2-1+b1_armhf.deb ... Unpacking python3 (3.11.2-1+b1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../001-sensible-utils_0.0.17+nmu1_all.deb ... Unpacking sensible-utils (0.0.17+nmu1) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../002-libmagic-mgc_1%3a5.44-3_armhf.deb ... Unpacking libmagic-mgc (1:5.44-3) ... Selecting previously unselected package libmagic1:armhf. Preparing to unpack .../003-libmagic1_1%3a5.44-3_armhf.deb ... Unpacking libmagic1:armhf (1:5.44-3) ... Selecting previously unselected package file. Preparing to unpack .../004-file_1%3a5.44-3_armhf.deb ... Unpacking file (1:5.44-3) ... Selecting previously unselected package gettext-base. Preparing to unpack .../005-gettext-base_0.21-12_armhf.deb ... Unpacking gettext-base (0.21-12) ... Selecting previously unselected package libuchardet0:armhf. Preparing to unpack .../006-libuchardet0_0.0.7-1_armhf.deb ... Unpacking libuchardet0:armhf (0.0.7-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../007-groff-base_1.22.4-10_armhf.deb ... Unpacking groff-base (1.22.4-10) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../008-bsdextrautils_2.38.1-5+b1_armhf.deb ... Unpacking bsdextrautils (2.38.1-5+b1) ... Selecting previously unselected package libpipeline1:armhf. Preparing to unpack .../009-libpipeline1_1.5.7-1_armhf.deb ... Unpacking libpipeline1:armhf (1.5.7-1) ... Selecting previously unselected package man-db. Preparing to unpack .../010-man-db_2.11.2-2_armhf.deb ... Unpacking man-db (2.11.2-2) ... Selecting previously unselected package m4. Preparing to unpack .../011-m4_1.4.19-3_armhf.deb ... Unpacking m4 (1.4.19-3) ... Selecting previously unselected package autoconf. Preparing to unpack .../012-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../013-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../014-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../015-autopoint_0.21-12_all.deb ... Unpacking autopoint (0.21-12) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../016-libdebhelper-perl_13.11.4_all.deb ... Unpacking libdebhelper-perl (13.11.4) ... Selecting previously unselected package libtool. Preparing to unpack .../017-libtool_2.4.7-5_all.deb ... Unpacking libtool (2.4.7-5) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../018-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../019-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../020-libsub-override-perl_0.09-4_all.deb ... Unpacking libsub-override-perl (0.09-4) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../021-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../022-dh-strip-nondeterminism_1.13.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.13.1-1) ... Selecting previously unselected package libelf1:armhf. Preparing to unpack .../023-libelf1_0.188-2.1_armhf.deb ... Unpacking libelf1:armhf (0.188-2.1) ... Selecting previously unselected package dwz. Preparing to unpack .../024-dwz_0.15-1_armhf.deb ... Unpacking dwz (0.15-1) ... Selecting previously unselected package libicu72:armhf. Preparing to unpack .../025-libicu72_72.1-3_armhf.deb ... Unpacking libicu72:armhf (72.1-3) ... Selecting previously unselected package libxml2:armhf. Preparing to unpack .../026-libxml2_2.9.14+dfsg-1.2_armhf.deb ... Unpacking libxml2:armhf (2.9.14+dfsg-1.2) ... Selecting previously unselected package gettext. Preparing to unpack .../027-gettext_0.21-12_armhf.deb ... Unpacking gettext (0.21-12) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../028-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../029-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../030-debhelper_13.11.4_all.deb ... Unpacking debhelper (13.11.4) ... Selecting previously unselected package fonts-font-awesome. Preparing to unpack .../031-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Selecting previously unselected package help2man. Preparing to unpack .../032-help2man_1.49.3_armhf.deb ... Unpacking help2man (1.49.3) ... Selecting previously unselected package icu-devtools. Preparing to unpack .../033-icu-devtools_72.1-3_armhf.deb ... Unpacking icu-devtools (72.1-3) ... Selecting previously unselected package libboost1.74-dev:armhf. Preparing to unpack .../034-libboost1.74-dev_1.74.0+ds1-20_armhf.deb ... Unpacking libboost1.74-dev:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-chrono1.74.0:armhf. Preparing to unpack .../035-libboost-chrono1.74.0_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-chrono1.74.0:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-chrono1.74-dev:armhf. Preparing to unpack .../036-libboost-chrono1.74-dev_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-chrono1.74-dev:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-chrono-dev:armhf. Preparing to unpack .../037-libboost-chrono-dev_1.74.0.3_armhf.deb ... Unpacking libboost-chrono-dev:armhf (1.74.0.3) ... Selecting previously unselected package libboost-filesystem1.74.0:armhf. Preparing to unpack .../038-libboost-filesystem1.74.0_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-filesystem1.74.0:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-system1.74.0:armhf. Preparing to unpack .../039-libboost-system1.74.0_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-system1.74.0:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-system1.74-dev:armhf. Preparing to unpack .../040-libboost-system1.74-dev_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-system1.74-dev:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-filesystem1.74-dev:armhf. Preparing to unpack .../041-libboost-filesystem1.74-dev_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-filesystem1.74-dev:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-filesystem-dev:armhf. Preparing to unpack .../042-libboost-filesystem-dev_1.74.0.3_armhf.deb ... Unpacking libboost-filesystem-dev:armhf (1.74.0.3) ... Selecting previously unselected package libboost-regex1.74.0:armhf. Preparing to unpack .../043-libboost-regex1.74.0_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-regex1.74.0:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libicu-dev:armhf. Preparing to unpack .../044-libicu-dev_72.1-3_armhf.deb ... Unpacking libicu-dev:armhf (72.1-3) ... Selecting previously unselected package libboost-regex1.74-dev:armhf. Preparing to unpack .../045-libboost-regex1.74-dev_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-regex1.74-dev:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-iostreams1.74-dev:armhf. Preparing to unpack .../046-libboost-iostreams1.74-dev_1.74.0+ds1-20_armhf.deb ... Unpacking libboost-iostreams1.74-dev:armhf (1.74.0+ds1-20) ... Selecting previously unselected package libboost-iostreams-dev:armhf. Preparing to unpack .../047-libboost-iostreams-dev_1.74.0.3_armhf.deb ... Unpacking libboost-iostreams-dev:armhf (1.74.0.3) ... Selecting previously unselected package libboost-system-dev:armhf. Preparing to unpack .../048-libboost-system-dev_1.74.0.3_armhf.deb ... Unpacking libboost-system-dev:armhf (1.74.0.3) ... Selecting previously unselected package libbrotli1:armhf. Preparing to unpack .../049-libbrotli1_1.0.9-2+b6_armhf.deb ... Unpacking libbrotli1:armhf (1.0.9-2+b6) ... Selecting previously unselected package libsasl2-modules-db:armhf. Preparing to unpack .../050-libsasl2-modules-db_2.1.28+dfsg-10_armhf.deb ... Unpacking libsasl2-modules-db:armhf (2.1.28+dfsg-10) ... Selecting previously unselected package libsasl2-2:armhf. Preparing to unpack .../051-libsasl2-2_2.1.28+dfsg-10_armhf.deb ... Unpacking libsasl2-2:armhf (2.1.28+dfsg-10) ... Selecting previously unselected package libldap-2.5-0:armhf. Preparing to unpack .../052-libldap-2.5-0_2.5.13+dfsg-5_armhf.deb ... Unpacking libldap-2.5-0:armhf (2.5.13+dfsg-5) ... Selecting previously unselected package libnghttp2-14:armhf. Preparing to unpack .../053-libnghttp2-14_1.52.0-1_armhf.deb ... Unpacking libnghttp2-14:armhf (1.52.0-1) ... Selecting previously unselected package libpsl5:armhf. Preparing to unpack .../054-libpsl5_0.21.2-1_armhf.deb ... Unpacking libpsl5:armhf (0.21.2-1) ... Selecting previously unselected package librtmp1:armhf. Preparing to unpack .../055-librtmp1_2.4+20151223.gitfa8646d.1-2+b2_armhf.deb ... Unpacking librtmp1:armhf (2.4+20151223.gitfa8646d.1-2+b2) ... Selecting previously unselected package libssh2-1:armhf. Preparing to unpack .../056-libssh2-1_1.10.0-3+b1_armhf.deb ... Unpacking libssh2-1:armhf (1.10.0-3+b1) ... Selecting previously unselected package libcurl3-gnutls:armhf. Preparing to unpack .../057-libcurl3-gnutls_7.88.1-9_armhf.deb ... Unpacking libcurl3-gnutls:armhf (7.88.1-9) ... Selecting previously unselected package libcurl4-gnutls-dev:armhf. Preparing to unpack .../058-libcurl4-gnutls-dev_7.88.1-9_armhf.deb ... Unpacking libcurl4-gnutls-dev:armhf (7.88.1-9) ... Selecting previously unselected package libdeflate0:armhf. Preparing to unpack .../059-libdeflate0_1.14-1_armhf.deb ... Unpacking libdeflate0:armhf (1.14-1) ... Selecting previously unselected package libdeflate-dev:armhf. Preparing to unpack .../060-libdeflate-dev_1.14-1_armhf.deb ... Unpacking libdeflate-dev:armhf (1.14-1) ... Selecting previously unselected package libhtscodecs2:armhf. Preparing to unpack .../061-libhtscodecs2_1.3.0-4_armhf.deb ... Unpacking libhtscodecs2:armhf (1.3.0-4) ... Selecting previously unselected package libhts3:armhf. Preparing to unpack .../062-libhts3_1.16+ds-3_armhf.deb ... Unpacking libhts3:armhf (1.16+ds-3) ... Selecting previously unselected package liblzma-dev:armhf. Preparing to unpack .../063-liblzma-dev_5.4.1-0.2_armhf.deb ... Unpacking liblzma-dev:armhf (5.4.1-0.2) ... Selecting previously unselected package zlib1g-dev:armhf. Preparing to unpack .../064-zlib1g-dev_1%3a1.2.13.dfsg-1_armhf.deb ... Unpacking zlib1g-dev:armhf (1:1.2.13.dfsg-1) ... Selecting previously unselected package libhts-dev:armhf. Preparing to unpack .../065-libhts-dev_1.16+ds-3_armhf.deb ... Unpacking libhts-dev:armhf (1.16+ds-3) ... Selecting previously unselected package libjs-d3-format. Preparing to unpack .../066-libjs-d3-format_1%3a1.4.1-7_all.deb ... Unpacking libjs-d3-format (1:1.4.1-7) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../067-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Selecting previously unselected package libjs-jquery-datatables. Preparing to unpack .../068-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... Selecting previously unselected package libjs-jquery-datatables-extensions. Preparing to unpack .../069-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Selecting previously unselected package libncurses6:armhf. Preparing to unpack .../070-libncurses6_6.4-4_armhf.deb ... Unpacking libncurses6:armhf (6.4-4) ... Selecting previously unselected package libncurses-dev:armhf. Preparing to unpack .../071-libncurses-dev_6.4-4_armhf.deb ... Unpacking libncurses-dev:armhf (6.4-4) ... Selecting previously unselected package libncurses5-dev:armhf. Preparing to unpack .../072-libncurses5-dev_6.4-4_armhf.deb ... Unpacking libncurses5-dev:armhf (6.4-4) ... Selecting previously unselected package node-commander. Preparing to unpack .../073-node-commander_9.4.1-1_all.deb ... Unpacking node-commander (9.4.1-1) ... Selecting previously unselected package node-d3-array. Preparing to unpack .../074-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... Selecting previously unselected package node-d3-axis. Preparing to unpack .../075-node-d3-axis_1.0.12-5_all.deb ... Unpacking node-d3-axis (1.0.12-5) ... Selecting previously unselected package node-d3-dispatch. Preparing to unpack .../076-node-d3-dispatch_1.0.6-4_all.deb ... Unpacking node-d3-dispatch (1.0.6-4) ... Selecting previously unselected package node-d3-selection. Preparing to unpack .../077-node-d3-selection_1.4.0-8_all.deb ... Unpacking node-d3-selection (1.4.0-8) ... Selecting previously unselected package node-d3-drag. Preparing to unpack .../078-node-d3-drag_1.2.5-4_all.deb ... Unpacking node-d3-drag (1.2.5-4) ... Selecting previously unselected package node-d3-color. Preparing to unpack .../079-node-d3-color_1.2.8-5_all.deb ... Unpacking node-d3-color (1.2.8-5) ... Selecting previously unselected package node-d3-interpolate. Preparing to unpack .../080-node-d3-interpolate_1.4.0-4_all.deb ... Unpacking node-d3-interpolate (1.4.0-4) ... Selecting previously unselected package node-d3-ease. Preparing to unpack .../081-node-d3-ease_1.0.5-5_all.deb ... Unpacking node-d3-ease (1.0.5-5) ... Selecting previously unselected package node-d3-timer. Preparing to unpack .../082-node-d3-timer_1.0.10-3_all.deb ... Unpacking node-d3-timer (1.0.10-3) ... Selecting previously unselected package node-d3-transition. Preparing to unpack .../083-node-d3-transition_1.3.2-6_all.deb ... Unpacking node-d3-transition (1.3.2-6) ... Selecting previously unselected package node-d3-brush. Preparing to unpack .../084-node-d3-brush_1.1.5-4_all.deb ... Unpacking node-d3-brush (1.1.5-4) ... Selecting previously unselected package node-d3-path. Preparing to unpack .../085-node-d3-path_1.0.9-4_all.deb ... Unpacking node-d3-path (1.0.9-4) ... Selecting previously unselected package node-d3-chord. Preparing to unpack .../086-node-d3-chord_1.0.6-7_all.deb ... Unpacking node-d3-chord (1.0.6-7) ... Selecting previously unselected package node-d3-collection. Preparing to unpack .../087-node-d3-collection_1.0.7-5_all.deb ... Unpacking node-d3-collection (1.0.7-5) ... Selecting previously unselected package node-d3-contour. Preparing to unpack .../088-node-d3-contour_1.3.2-8_all.deb ... Unpacking node-d3-contour (1.3.2-8) ... Selecting previously unselected package node-safe-buffer. Preparing to unpack .../089-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... Selecting previously unselected package node-iconv-lite. Preparing to unpack .../090-node-iconv-lite_0.6.3-3_all.deb ... Unpacking node-iconv-lite (0.6.3-3) ... Selecting previously unselected package node-d3-queue. Preparing to unpack .../091-node-d3-queue_3.0.7-13_all.deb ... Unpacking node-d3-queue (3.0.7-13) ... Selecting previously unselected package node-rw. Preparing to unpack .../092-node-rw_1.3.3-5_all.deb ... Unpacking node-rw (1.3.3-5) ... Selecting previously unselected package node-d3-dsv. Preparing to unpack .../093-node-d3-dsv_1.1.1-9_all.deb ... Unpacking node-d3-dsv (1.1.1-9) ... Selecting previously unselected package node-d3-fetch. Preparing to unpack .../094-node-d3-fetch_1.2.0-5_all.deb ... Unpacking node-d3-fetch (1.2.0-5) ... Selecting previously unselected package node-d3-quadtree. Preparing to unpack .../095-node-d3-quadtree_1.0.7-4_all.deb ... Unpacking node-d3-quadtree (1.0.7-4) ... Selecting previously unselected package node-d3-force. Preparing to unpack .../096-node-d3-force_1.2.1-5_all.deb ... Unpacking node-d3-force (1.2.1-5) ... Selecting previously unselected package node-d3-format. Preparing to unpack .../097-node-d3-format_1%3a1.4.1-7_all.deb ... Unpacking node-d3-format (1:1.4.1-7) ... Selecting previously unselected package node-d3-geo. Preparing to unpack .../098-node-d3-geo_1.11.9-6_all.deb ... Unpacking node-d3-geo (1.11.9-6) ... Selecting previously unselected package node-d3-hierarchy. Preparing to unpack .../099-node-d3-hierarchy_1.1.8-6_all.deb ... Unpacking node-d3-hierarchy (1.1.8-6) ... Selecting previously unselected package node-d3-polygon. Preparing to unpack .../100-node-d3-polygon_1.0.5-5_all.deb ... Unpacking node-d3-polygon (1.0.5-5) ... Selecting previously unselected package node-d3-random. Preparing to unpack .../101-node-d3-random_1.1.2-5_all.deb ... Unpacking node-d3-random (1.1.2-5) ... Selecting previously unselected package node-d3-time. Preparing to unpack .../102-node-d3-time_1.0.11-6_all.deb ... Unpacking node-d3-time (1.0.11-6) ... Selecting previously unselected package node-d3-time-format. Preparing to unpack .../103-node-d3-time-format_2.1.3-7_all.deb ... Unpacking node-d3-time-format (2.1.3-7) ... Selecting previously unselected package node-d3-scale. Preparing to unpack .../104-node-d3-scale_2.2.2-6_all.deb ... Unpacking node-d3-scale (2.2.2-6) ... Selecting previously unselected package node-d3-scale-chromatic. Preparing to unpack .../105-node-d3-scale-chromatic_1.5.0-7_all.deb ... Unpacking node-d3-scale-chromatic (1.5.0-7) ... Selecting previously unselected package node-d3-shape. Preparing to unpack .../106-node-d3-shape_1.3.7-5_all.deb ... Unpacking node-d3-shape (1.3.7-5) ... Selecting previously unselected package node-d3-voronoi. Preparing to unpack .../107-node-d3-voronoi_1.1.4-5_all.deb ... Unpacking node-d3-voronoi (1.1.4-5) ... Selecting previously unselected package node-d3-zoom. Preparing to unpack .../108-node-d3-zoom_1.8.3-4_all.deb ... Unpacking node-d3-zoom (1.8.3-4) ... Selecting previously unselected package node-d3. Preparing to unpack .../109-node-d3_5.16.0-10_all.deb ... Unpacking node-d3 (5.16.0-10) ... Selecting previously unselected package node-normalize.css. Preparing to unpack .../110-node-normalize.css_8.0.1-5_all.deb ... Unpacking node-normalize.css (8.0.1-5) ... Setting up libhtscodecs2:armhf (1.3.0-4) ... Setting up libboost-chrono1.74.0:armhf (1.74.0+ds1-20) ... Setting up media-types (10.0.0) ... Setting up libpipeline1:armhf (1.5.7-1) ... Setting up libboost-system1.74.0:armhf (1.74.0+ds1-20) ... Setting up node-d3-timer (1.0.10-3) ... Setting up node-d3-color (1.2.8-5) ... Setting up node-d3-interpolate (1.4.0-4) ... Setting up node-d3-queue (3.0.7-13) ... Setting up libpsl5:armhf (0.21.2-1) ... Setting up libboost1.74-dev:armhf (1.74.0+ds1-20) ... Setting up libicu72:armhf (72.1-3) ... Setting up bsdextrautils (2.38.1-5+b1) ... Setting up node-d3-hierarchy (1.1.8-6) ... Setting up node-d3-ease (1.0.5-5) ... Setting up libmagic-mgc (1:5.44-3) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up node-d3-scale-chromatic (1.5.0-7) ... Setting up libdebhelper-perl (13.11.4) ... Setting up libbrotli1:armhf (1.0.9-2+b6) ... Setting up libboost-chrono1.74-dev:armhf (1.74.0+ds1-20) ... Setting up libnghttp2-14:armhf (1.52.0-1) ... Setting up libmagic1:armhf (1:5.44-3) ... Setting up libdeflate0:armhf (1.14-1) ... Setting up gettext-base (0.21-12) ... Setting up m4 (1.4.19-3) ... Setting up libboost-filesystem1.74.0:armhf (1.74.0+ds1-20) ... Setting up node-d3-selection (1.4.0-8) ... Setting up node-d3-axis (1.0.12-5) ... Setting up file (1:5.44-3) ... Setting up node-d3-path (1.0.9-4) ... Setting up libsasl2-modules-db:armhf (2.1.28+dfsg-10) ... Setting up autotools-dev (20220109.1) ... Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... Setting up node-rw (1.3.3-5) ... Setting up node-d3-polygon (1.0.5-5) ... Setting up node-d3-quadtree (1.0.7-4) ... Setting up librtmp1:armhf (2.4+20151223.gitfa8646d.1-2+b2) ... Setting up libboost-system1.74-dev:armhf (1.74.0+ds1-20) ... Setting up libncurses6:armhf (6.4-4) ... Setting up libboost-regex1.74.0:armhf (1.74.0+ds1-20) ... Setting up node-d3-collection (1.0.7-5) ... Setting up autopoint (0.21-12) ... Setting up icu-devtools (72.1-3) ... Setting up libsasl2-2:armhf (2.1.28+dfsg-10) ... Setting up autoconf (2.71-3) ... Setting up node-d3-voronoi (1.1.4-5) ... Setting up node-d3-dispatch (1.0.6-4) ... Setting up node-d3-time (1.0.11-6) ... Setting up liblzma-dev:armhf (5.4.1-0.2) ... Setting up zlib1g-dev:armhf (1:1.2.13.dfsg-1) ... Setting up node-commander (9.4.1-1) ... Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... Setting up libjs-d3-format (1:1.4.1-7) ... Setting up sensible-utils (0.0.17+nmu1) ... Setting up libuchardet0:armhf (0.0.7-1) ... Setting up libsub-override-perl (0.09-4) ... Setting up libssh2-1:armhf (1.10.0-3+b1) ... Setting up libboost-filesystem1.74-dev:armhf (1.74.0+ds1-20) ... Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Setting up node-d3-geo (1.11.9-6) ... Setting up libdeflate-dev:armhf (1.14-1) ... Setting up node-normalize.css (8.0.1-5) ... Setting up node-d3-transition (1.3.2-6) ... Setting up libelf1:armhf (0.188-2.1) ... Setting up readline-common (8.2-1.3) ... Setting up libicu-dev:armhf (72.1-3) ... Setting up libxml2:armhf (2.9.14+dfsg-1.2) ... Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Setting up libboost-filesystem-dev:armhf (1.74.0.3) ... Setting up liblocale-gettext-perl (1.07-5) ... Setting up node-d3-random (1.1.2-5) ... Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.13.1-1) ... Setting up libncurses-dev:armhf (6.4-4) ... Setting up gettext (0.21-12) ... Setting up node-d3-format (1:1.4.1-7) ... Setting up libtool (2.4.7-5) ... Setting up libboost-chrono-dev:armhf (1.74.0.3) ... Setting up node-d3-time-format (2.1.3-7) ... Setting up libreadline8:armhf (8.2-1.3) ... Setting up libboost-system-dev:armhf (1.74.0.3) ... Setting up node-d3-chord (1.0.6-7) ... Setting up node-d3-shape (1.3.7-5) ... Setting up libldap-2.5-0:armhf (2.5.13+dfsg-5) ... Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up help2man (1.49.3) ... Setting up dh-autoreconf (20) ... Setting up node-d3-drag (1.2.5-4) ... Setting up node-iconv-lite (0.6.3-3) ... Setting up node-d3-scale (2.2.2-6) ... Setting up node-d3-force (1.2.1-5) ... Setting up node-d3-contour (1.3.2-8) ... Setting up dh-strip-nondeterminism (1.13.1-1) ... Setting up dwz (0.15-1) ... Setting up libboost-regex1.74-dev:armhf (1.74.0+ds1-20) ... Setting up node-d3-brush (1.1.5-4) ... Setting up groff-base (1.22.4-10) ... Setting up libncurses5-dev:armhf (6.4-4) ... Setting up node-d3-dsv (1.1.1-9) ... Setting up node-d3-zoom (1.8.3-4) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libpython3.11-stdlib:armhf (3.11.2-6) ... Setting up node-d3-fetch (1.2.0-5) ... Setting up libcurl3-gnutls:armhf (7.88.1-9) ... Setting up node-d3 (5.16.0-10) ... Setting up libcurl4-gnutls-dev:armhf (7.88.1-9) ... Setting up man-db (2.11.2-2) ... Not building database; man-db/auto-update is not 'true'. Setting up libboost-iostreams1.74-dev:armhf (1.74.0+ds1-20) ... Setting up libpython3-stdlib:armhf (3.11.2-1+b1) ... Setting up python3.11 (3.11.2-6) ... Setting up libhts3:armhf (1.16+ds-3) ... Setting up libhts-dev:armhf (1.16+ds-3) ... Setting up debhelper (13.11.4) ... Setting up python3 (3.11.2-1+b1) ... Setting up libboost-iostreams-dev:armhf (1.74.0.3) ... Processing triggers for libc-bin (2.36-9) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/ataqv-1.3.0+ds/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../ataqv_1.3.0+ds-2_source.changes dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.3.0+ds-2 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture armhf debian/rules clean dh clean dh_auto_clean make -j3 clean make[1]: Entering directory '/build/ataqv-1.3.0+ds' make[1]: Leaving directory '/build/ataqv-1.3.0+ds' dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/build/ataqv-1.3.0+ds' cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/ cp -s /usr/share/javascript/jquery/jquery.min.js \ /usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \ /usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js make[1]: Leaving directory '/build/ataqv-1.3.0+ds' debian/rules override_dh_auto_build make[1]: Entering directory '/build/ataqv-1.3.0+ds' dh_auto_build -- all testing/run_ataqv_tests make -j3 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests make[2]: Entering directory '/build/ataqv-1.3.0+ds' g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/ataqv.o -c /build/ataqv-1.3.0+ds/src/cpp/ataqv.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Features.o -c /build/ataqv-1.3.0+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/HTS.o -c /build/ataqv-1.3.0+ds/src/cpp/HTS.cpp In file included from /usr/include/c++/12/map:60, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:10, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, from /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:11: /usr/include/c++/12/bits/stl_tree.h: In function ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::iterator std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_hint_unique(const_iterator, _Args&& ...) [with _Args = {const std::piecewise_construct_t&, std::tuple, std::allocator >&>, std::tuple<>}; _Key = std::__cxx11::basic_string; _Val = std::pair, ReferenceFeatureCollection>; _KeyOfValue = std::_Select1st, ReferenceFeatureCollection> >; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferenceFeatureCollection> >]’: /usr/include/c++/12/bits/stl_tree.h:2457:7: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferenceFeatureCollection>, std::_Select1st, ReferenceFeatureCollection> >, numeric_string_comparator, std::allocator, ReferenceFeatureCollection> > >::const_iterator’ changed in GCC 7.1 2457 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/map:61: In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferenceFeatureCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferenceFeatureCollection> >]’, inlined from ‘ReferenceFeatureCollection* FeatureTree::get_reference_feature_collection(const std::string&)’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:127:32: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferenceFeatureCollection>, std::_Select1st, ReferenceFeatureCollection> >, numeric_string_comparator, std::allocator, ReferenceFeatureCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {std::pair, std::allocator > >}; _Tp = std::pair >; _Alloc = std::allocator > >]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector > >::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {std::pair, std::allocator > >}; _Tp = std::pair >; _Alloc = std::allocator > >]’, inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = std::pair >; _Alloc = std::allocator > >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, inlined from ‘std::vector > FeatureTree::get_references_by_feature_count()’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:142:46: /usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >*, std::vector > > >’ changed in GCC 7.1 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Feature&}; _Tp = Feature; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Feature; _Alloc = std::allocator]’, inlined from ‘void ReferenceFeatureCollection::add(const Feature&)’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:101:23: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferenceFeatureCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferenceFeatureCollection> >]’, inlined from ‘void FeatureTree::add(Feature&)’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:122:27: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferenceFeatureCollection>, std::_Select1st, ReferenceFeatureCollection> >, numeric_string_comparator, std::allocator, ReferenceFeatureCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/IO.o -c /build/ataqv-1.3.0+ds/src/cpp/IO.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Metrics.o -c /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Peaks.o -c /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp In file included from /usr/include/c++/12/bits/stl_algo.h:60, from /usr/include/c++/12/algorithm:61, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:7: /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Peak; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, | ^~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__unguarded_linear_insert(_RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Val_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1782:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1782 | __unguarded_linear_insert(_RandomAccessIterator __last, | ^~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1802 | __insertion_sort(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:13, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:13: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Peak&}; _Tp = Peak; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/map:60, from /usr/include/boost/system/detail/std_interoperability.hpp:11, from /usr/include/boost/system/error_code.hpp:963, from /usr/include/boost/chrono/detail/system.hpp:11, from /usr/include/boost/chrono/system_clocks.hpp:64, from /usr/include/boost/chrono/chrono.hpp:13, from /usr/include/boost/chrono/include.hpp:15, from /usr/include/boost/chrono.hpp:17, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:11: /usr/include/c++/12/bits/stl_tree.h: In function ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::iterator std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_hint_unique(const_iterator, _Args&& ...) [with _Args = {const std::piecewise_construct_t&, std::tuple, std::allocator >&>, std::tuple<>}; _Key = std::__cxx11::basic_string; _Val = std::pair, ReferencePeakCollection>; _KeyOfValue = std::_Select1st, ReferencePeakCollection> >; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferencePeakCollection> >]’: /usr/include/c++/12/bits/stl_tree.h:2457:7: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferencePeakCollection>, std::_Select1st, ReferencePeakCollection> >, numeric_string_comparator, std::allocator, ReferencePeakCollection> > >::const_iterator’ changed in GCC 7.1 2457 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/map:61: In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferencePeakCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferencePeakCollection> >]’, inlined from ‘ReferencePeakCollection* PeakTree::get_reference_peaks(const std::string&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:121:32: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferencePeakCollection>, std::_Select1st, ReferencePeakCollection> >, numeric_string_comparator, std::allocator, ReferencePeakCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/Utils.o -c /build/ataqv-1.3.0+ds/src/cpp/Utils.cpp /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__unguarded_linear_insert(_RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Val_comp_iter]’: /usr/include/c++/12/bits/stl_algo.h:1782:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1782 | __unguarded_linear_insert(_RandomAccessIterator __last, | ^~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1802 | __insertion_sort(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1908 | __introsort_loop(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h:1922:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1922 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:197:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘std::vector PeakTree::list_peaks()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:200:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘std::vector PeakTree::list_peaks()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:200:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘void ReferencePeakCollection::sort()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:105:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘void ReferencePeakCollection::sort()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:105:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘void ReferencePeakCollection::add(const Peak&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:67:20: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferencePeakCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferencePeakCollection> >]’, inlined from ‘void PeakTree::add(Peak&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:110:24: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferencePeakCollection>, std::_Select1st, ReferencePeakCollection> >, numeric_string_comparator, std::allocator, ReferencePeakCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Peak; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, | ^~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__make_heap(_RandomAccessIterator, _RandomAccessIterator, _Compare&) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_heap.h:340:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 340 | __make_heap(_RandomAccessIterator __first, _RandomAccessIterator __last, | ^~~~~~~~~~~ /usr/include/c++/12/bits/stl_heap.h:340:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1908 | __introsort_loop(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h:1922:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1922 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In function ‘void std::__heap_select(_RandomAccessIterator, _RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::__partial_sort(_RandomAccessIterator, _RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1900:25, inlined from ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1916:27: /usr/include/c++/12/bits/stl_algo.h:1629:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1629 | std::__make_heap(__first, __middle, __comp); | ~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks_by_size_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:221:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_size_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:224:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_size_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:224:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/run_ataqv_tests.o -c /build/ataqv-1.3.0+ds/src/cpp/run_ataqv_tests.cpp In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks_by_overlapping_hqaa_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:209:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_overlapping_hqaa_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:212:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_overlapping_hqaa_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:212:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_features.o -c /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp In file included from /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:1: /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:18: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Feature&}; _Tp = Feature; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Feature; _Alloc = std::allocator]’, inlined from ‘void MetricsCollector::load_excluded_regions()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:700:39: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const long long unsigned int&}; _Tp = long long unsigned int; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const long double&}; _Tp = long double; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 In file included from /usr/include/c++/12/map:60, from /usr/include/boost/system/detail/std_interoperability.hpp:11, from /usr/include/boost/system/error_code.hpp:963, from /usr/include/boost/chrono/detail/system.hpp:11, from /usr/include/boost/chrono/system_clocks.hpp:64, from /usr/include/boost/chrono/chrono.hpp:13, from /usr/include/boost/chrono/include.hpp:15, from /usr/include/boost/chrono.hpp:17, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:16: /usr/include/c++/12/bits/stl_tree.h: In member function ‘std::pair std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_get_insert_hint_unique_pos(const_iterator, const key_type&) [with _Key = int; _Val = std::pair; _KeyOfValue = std::_Select1st >; _Compare = std::less; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/stl_tree.h:2209:5: note: parameter passing for argument of type ‘std::_Rb_tree, std::_Select1st >, std::less, std::allocator > >::const_iterator’ changed in GCC 7.1 2209 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/stl_algo.h:60, from /usr/include/c++/12/algorithm:61, from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:76: /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Feature; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, | ^~~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>&}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector, std::allocator > >::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘void nlohmann::basic_json::push_back(const nlohmann::basic_json&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5311:33: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1802 | __insertion_sort(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = long long unsigned int; _Alloc = std::allocator]’, inlined from ‘void Metrics::add_alignment(const bam_hdr_t*, const bam1_t*)’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:893:59: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1908 | __introsort_loop(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h:1922:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1922 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘void ____C_A_T_C_H____T_E_S_T____61()’ at /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:67:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘void ____C_A_T_C_H____T_E_S_T____61()’ at /build/ataqv-1.3.0+ds/src/cpp/test_features.cpp:67:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /build/ataqv-1.3.0+ds/src/cpp/Metrics.hpp:16, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:21: /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In function ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 2082 | basic_json(std::initializer_list init, | ^~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In function ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp: In member function ‘nlohmann::json Library::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1378 | } | ^ /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1376:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1376 | }; | ^ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector, std::allocator > >::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, inlined from ‘void nlohmann::basic_json::push_back(nlohmann::basic_json&&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5275:33: /usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/stl_pair.h:61, from /usr/include/c++/12/tuple:38, from /usr/include/c++/12/mutex:38, from /usr/include/c++/12/future:38, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:10: In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In static member function ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_hts.o -c /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1392:22: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = double&; = double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = double&; U = double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1491:23: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘void std::_Construct(_Tp*, _Args&& ...) [with _Tp = nlohmann::basic_json<>; _Args = {const long double&}]’ at /usr/include/c++/12/bits/stl_construct.h:119:7, inlined from ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:120:21, inlined from ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; bool _TrivialValueTypes = false]’ at /usr/include/c++/12/bits/stl_uninitialized.h:137:32, inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; _Tp = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, inlined from ‘void std::vector<_Tp, _Alloc>::_M_range_initialize(_ForwardIterator, _ForwardIterator, std::forward_iterator_tag) [with _ForwardIterator = __gnu_cxx::__normal_iterator >; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1690:33, inlined from ‘std::vector<_Tp, _Alloc>::vector(_InputIterator, _InputIterator, const allocator_type&) [with _InputIterator = __gnu_cxx::__normal_iterator >; = void; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:706:23, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::vector, std::allocator > >; _Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; _Tp = std::vector, std::allocator > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::vector, std::allocator > >; Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:332:77, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(is_compatible_array_type::value || std::is_same::value), int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:581:52, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const std::vector&; = std::vector; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const std::vector&; U = std::vector; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘constexpr std::pair<_T1, _T2>::pair(const std::pair<_U1, _U2>&) [with _U1 = const std::__cxx11::basic_string; _U2 = std::vector; typename std::enable_if<(std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ConstructiblePair<_U1, _U2>() && std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ImplicitlyConvertiblePair<_U1, _U2>()), bool>::type = true; _T1 = const std::__cxx11::basic_string; _T2 = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_pair.h:439:29, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static void std::allocator_traits >::construct(allocator_type&, _Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/alloc_traits.h:516:17, inlined from ‘void std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_construct_node(_Link_type, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:595:32, inlined from ‘std::_Rb_tree_node<_Val>* std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_create_node(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:612:21, inlined from ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_Auto_node::_Auto_node(std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>&, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1636:32, inlined from ‘std::pair, bool> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_unique(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:2433:13, inlined from ‘std::__enable_if_t<(! std::is_same<_Val, typename std::iterator_traits<_InputIterator>::value_type>::value)> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_insert_range_unique(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1110:23, inlined from ‘std::map<_Key, _Tp, _Compare, _Alloc>::map(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Tp = nlohmann::basic_json<>; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_map.h:285:31, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; _Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; _Tp = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:358:79, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:590:53, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = std::map, std::vector >&; = std::map, std::vector >; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = std::map, std::vector >&; U = std::map, std::vector >; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1460:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = long double; _Alloc = std::allocator]’, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1470:70: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = long double; _Alloc = std::allocator]’, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1481:75: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1568 | } | ^ /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1566:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1566 | }; | ^ In file included from /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp:3: /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /build/ataqv-1.3.0+ds/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); | ^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_io.o -c /build/ataqv-1.3.0+ds/src/cpp/test_io.cpp In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, inlined from ‘void nlohmann::basic_json::push_back(nlohmann::basic_json&&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5275:33, inlined from ‘nlohmann::json MetricsCollector::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1586:25: /usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:569, from /build/ataqv-1.3.0+ds/src/cpp/run_ataqv_tests.cpp:2: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Catch::SectionEndInfo&}; _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_metrics.o -c /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’, inlined from ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:6057:43: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Catch::SectionEndInfo; _Alloc = std::allocator]’, inlined from ‘virtual void Catch::RunContext::sectionEndedEarly(const Catch::SectionEndInfo&)’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:6057:43, inlined from ‘Catch::Section::~Section()’ at /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:7923:53: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_peaks.o -c /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp In file included from /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:1: /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); | ^~~~~~~~~~~~ In file included from /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:3: /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’: /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 173 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 178 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’: /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 249 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’: /build/ataqv-1.3.0+ds/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 259 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ In file included from /usr/include/c++/12/memory:66, from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:568: /usr/include/c++/12/bits/stl_uninitialized.h: In function ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’: /usr/include/c++/12/bits/stl_uninitialized.h:113:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 113 | __do_uninit_copy(_InputIterator __first, _InputIterator __last, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_uninitialized.h:113:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, inlined from ‘void ____C_A_T_C_H____T_E_S_T____155()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:166:68: /usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 137 | { return std::__do_uninit_copy(__first, __last, __result); } | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, inlined from ‘void ____C_A_T_C_H____T_E_S_T____100()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:125:68: /usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 137 | { return std::__do_uninit_copy(__first, __last, __result); } | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ In static member function ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; bool _TrivialValueTypes = false]’, inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = Peak*; _Tp = Peak]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, inlined from ‘std::vector<_Tp, _Alloc>::vector(const std::vector<_Tp, _Alloc>&) [with _Tp = Peak; _Alloc = std::allocator]’ at /usr/include/c++/12/bits/stl_vector.h:601:31, inlined from ‘ReferencePeakCollection::ReferencePeakCollection(const ReferencePeakCollection&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:29:7, inlined from ‘void ____C_A_T_C_H____T_E_S_T____100()’ at /build/ataqv-1.3.0+ds/src/cpp/test_peaks.cpp:131:70: /usr/include/c++/12/bits/stl_uninitialized.h:137:39: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 137 | { return std::__do_uninit_copy(__first, __last, __result); } | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/catch.hpp:569: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_fill_insert(iterator, size_type, const value_type&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/vector.tcc:523:5: note: parameter passing for argument of type ‘std::vector, std::allocator > >::iterator’ changed in GCC 7.1 523 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function ‘std::vector<_Tp, _Alloc>::iterator std::vector<_Tp, _Alloc>::insert(const_iterator, size_type, const value_type&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator[](size_type) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:3730:38: /usr/include/c++/12/bits/stl_vector.h:1435:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 1435 | _M_fill_insert(begin() + __offset, __n, __x); | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/test_utils.o -c /build/ataqv-1.3.0+ds/src/cpp/test_utils.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Features.o -c /build/ataqv-1.3.0+ds/src/cpp/Features.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/HTS.o -c /build/ataqv-1.3.0+ds/src/cpp/HTS.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/IO.o -c /build/ataqv-1.3.0+ds/src/cpp/IO.cpp In file included from /usr/include/c++/12/map:60, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:10, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, from /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:11: /usr/include/c++/12/bits/stl_tree.h: In function ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::iterator std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_hint_unique(const_iterator, _Args&& ...) [with _Args = {const std::piecewise_construct_t&, std::tuple, std::allocator >&>, std::tuple<>}; _Key = std::__cxx11::basic_string; _Val = std::pair, ReferenceFeatureCollection>; _KeyOfValue = std::_Select1st, ReferenceFeatureCollection> >; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferenceFeatureCollection> >]’: /usr/include/c++/12/bits/stl_tree.h:2457:7: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferenceFeatureCollection>, std::_Select1st, ReferenceFeatureCollection> >, numeric_string_comparator, std::allocator, ReferenceFeatureCollection> > >::const_iterator’ changed in GCC 7.1 2457 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/map:61: In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferenceFeatureCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferenceFeatureCollection> >]’, inlined from ‘ReferenceFeatureCollection* FeatureTree::get_reference_feature_collection(const std::string&)’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:127:32: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferenceFeatureCollection>, std::_Select1st, ReferenceFeatureCollection> >, numeric_string_comparator, std::allocator, ReferenceFeatureCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {std::pair, std::allocator > >}; _Tp = std::pair >; _Alloc = std::allocator > >]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector > >::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {std::pair, std::allocator > >}; _Tp = std::pair >; _Alloc = std::allocator > >]’, inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = std::pair >; _Alloc = std::allocator > >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, inlined from ‘std::vector > FeatureTree::get_references_by_feature_count()’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:142:46: /usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >*, std::vector > > >’ changed in GCC 7.1 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Feature&}; _Tp = Feature; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Feature; _Alloc = std::allocator]’, inlined from ‘void ReferenceFeatureCollection::add(const Feature&)’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:101:23: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferenceFeatureCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferenceFeatureCollection> >]’, inlined from ‘void FeatureTree::add(Feature&)’ at /build/ataqv-1.3.0+ds/src/cpp/Features.cpp:122:27: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferenceFeatureCollection>, std::_Select1st, ReferenceFeatureCollection> >, numeric_string_comparator, std::allocator, ReferenceFeatureCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Metrics.o -c /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Peaks.o -c /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp In file included from /usr/include/c++/12/bits/stl_algo.h:60, from /usr/include/c++/12/algorithm:61, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:7: /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Peak; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, | ^~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__unguarded_linear_insert(_RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Val_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1782:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1782 | __unguarded_linear_insert(_RandomAccessIterator __last, | ^~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1802 | __insertion_sort(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.hpp:13, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:13: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Peak&}; _Tp = Peak; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/map:60, from /usr/include/boost/system/detail/std_interoperability.hpp:11, from /usr/include/boost/system/error_code.hpp:963, from /usr/include/boost/chrono/detail/system.hpp:11, from /usr/include/boost/chrono/system_clocks.hpp:64, from /usr/include/boost/chrono/chrono.hpp:13, from /usr/include/boost/chrono/include.hpp:15, from /usr/include/boost/chrono.hpp:17, from /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:11: /usr/include/c++/12/bits/stl_tree.h: In function ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::iterator std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_hint_unique(const_iterator, _Args&& ...) [with _Args = {const std::piecewise_construct_t&, std::tuple, std::allocator >&>, std::tuple<>}; _Key = std::__cxx11::basic_string; _Val = std::pair, ReferencePeakCollection>; _KeyOfValue = std::_Select1st, ReferencePeakCollection> >; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferencePeakCollection> >]’: /usr/include/c++/12/bits/stl_tree.h:2457:7: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferencePeakCollection>, std::_Select1st, ReferencePeakCollection> >, numeric_string_comparator, std::allocator, ReferencePeakCollection> > >::const_iterator’ changed in GCC 7.1 2457 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/map:61: In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferencePeakCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferencePeakCollection> >]’, inlined from ‘ReferencePeakCollection* PeakTree::get_reference_peaks(const std::string&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:121:32: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferencePeakCollection>, std::_Select1st, ReferencePeakCollection> >, numeric_string_comparator, std::allocator, ReferencePeakCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__unguarded_linear_insert(_RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Val_comp_iter]’: /usr/include/c++/12/bits/stl_algo.h:1782:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1782 | __unguarded_linear_insert(_RandomAccessIterator __last, | ^~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1802 | __insertion_sort(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1802:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’: /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1908 | __introsort_loop(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h:1922:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1922 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:197:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘std::vector PeakTree::list_peaks()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:200:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘std::vector PeakTree::list_peaks()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:200:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘void ReferencePeakCollection::sort()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:105:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_less_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter) [with _RAIter = __gnu_cxx::__normal_iterator >]’ at /usr/include/c++/12/bits/stl_algo.h:4820:18, inlined from ‘void ReferencePeakCollection::sort()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:105:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘void ReferencePeakCollection::add(const Peak&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:67:20: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘std::map<_Key, _Tp, _Compare, _Alloc>::mapped_type& std::map<_Key, _Tp, _Compare, _Alloc>::operator[](const key_type&) [with _Key = std::__cxx11::basic_string; _Tp = ReferencePeakCollection; _Compare = numeric_string_comparator; _Alloc = std::allocator, ReferencePeakCollection> >]’, inlined from ‘void PeakTree::add(Peak&)’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:110:24: /usr/include/c++/12/bits/stl_map.h:511:44: note: parameter passing for argument of type ‘std::_Rb_tree, std::pair, ReferencePeakCollection>, std::_Select1st, ReferencePeakCollection> >, numeric_string_comparator, std::allocator, ReferencePeakCollection> > >::const_iterator’ changed in GCC 7.1 511 | __i = _M_t._M_emplace_hint_unique(__i, std::piecewise_construct, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 512 | std::tuple(__k), | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 513 | std::tuple<>()); | ~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__adjust_heap(_RandomAccessIterator, _Distance, _Distance, _Tp, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Distance = int; _Tp = Peak; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_heap.h:224:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 224 | __adjust_heap(_RandomAccessIterator __first, _Distance __holeIndex, | ^~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_heap.h: In function ‘void std::__make_heap(_RandomAccessIterator, _RandomAccessIterator, _Compare&) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_heap.h:340:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 340 | __make_heap(_RandomAccessIterator __first, _RandomAccessIterator __last, | ^~~~~~~~~~~ /usr/include/c++/12/bits/stl_heap.h:340:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h: In function ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’: /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1908 | __introsort_loop(_RandomAccessIterator __first, | ^~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1908:5: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 /usr/include/c++/12/bits/stl_algo.h:1922:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1922 | std::__introsort_loop(__cut, __last, __depth_limit, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In function ‘void std::__heap_select(_RandomAccessIterator, _RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::__partial_sort(_RandomAccessIterator, _RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1900:25, inlined from ‘void std::__introsort_loop(_RandomAccessIterator, _RandomAccessIterator, _Size, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Size = int; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1916:27: /usr/include/c++/12/bits/stl_algo.h:1629:23: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1629 | std::__make_heap(__first, __middle, __comp); | ~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks_by_size_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:221:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_size_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:224:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_size_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:224:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Peak; _Alloc = std::allocator]’, inlined from ‘std::vector PeakTree::list_peaks_by_overlapping_hqaa_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:209:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In function ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_overlapping_hqaa_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:212:14: /usr/include/c++/12/bits/stl_algo.h:1937:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1937 | std::__introsort_loop(__first, __last, | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~ 1938 | std::__lg(__last - __first) * 2, | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 1939 | __comp); | ~~~~~~~ In function ‘void std::__final_insertion_sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’, inlined from ‘void std::__sort(_RandomAccessIterator, _RandomAccessIterator, _Compare) [with _RandomAccessIterator = __gnu_cxx::__normal_iterator >; _Compare = __gnu_cxx::__ops::_Iter_comp_iter]’ at /usr/include/c++/12/bits/stl_algo.h:1940:31, inlined from ‘void std::sort(_RAIter, _RAIter, _Compare) [with _RAIter = __gnu_cxx::__normal_iterator >; _Compare = bool (*)(const Peak&, const Peak&)]’ at /usr/include/c++/12/bits/stl_algo.h:4853:18, inlined from ‘std::vector PeakTree::list_peaks_by_overlapping_hqaa_descending()’ at /build/ataqv-1.3.0+ds/src/cpp/Peaks.cpp:212:14: /usr/include/c++/12/bits/stl_algo.h:1849:32: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1849 | std::__insertion_sort(__first, __first + int(_S_threshold), __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/stl_algo.h:1854:30: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1854 | std::__insertion_sort(__first, __last, __comp); | ~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/Utils.o -c /build/ataqv-1.3.0+ds/src/cpp/Utils.cpp g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread In file included from /usr/include/c++/12/vector:70, from /build/ataqv-1.3.0+ds/src/cpp/Utils.hpp:6, from /build/ataqv-1.3.0+ds/src/cpp/HTS.hpp:19, from /build/ataqv-1.3.0+ds/src/cpp/Features.hpp:12, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:18: /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const Feature&}; _Tp = Feature; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/vector:64: In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = Feature; _Alloc = std::allocator]’, inlined from ‘void MetricsCollector::load_excluded_regions()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:700:39: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const long long unsigned int&}; _Tp = long long unsigned int; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const long double&}; _Tp = long double; _Alloc = std::allocator]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector::iterator’ changed in GCC 7.1 In file included from /usr/include/c++/12/map:60, from /usr/include/boost/system/detail/std_interoperability.hpp:11, from /usr/include/boost/system/error_code.hpp:963, from /usr/include/boost/chrono/detail/system.hpp:11, from /usr/include/boost/chrono/system_clocks.hpp:64, from /usr/include/boost/chrono/chrono.hpp:13, from /usr/include/boost/chrono/include.hpp:15, from /usr/include/boost/chrono.hpp:17, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:16: /usr/include/c++/12/bits/stl_tree.h: In member function ‘std::pair std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_get_insert_hint_unique_pos(const_iterator, const key_type&) [with _Key = int; _Val = std::pair; _KeyOfValue = std::_Select1st >; _Compare = std::less; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/stl_tree.h:2209:5: note: parameter passing for argument of type ‘std::_Rb_tree, std::_Select1st >, std::less, std::allocator > >::const_iterator’ changed in GCC 7.1 2209 | _Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {const nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>&}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector, std::allocator > >::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘void nlohmann::basic_json::push_back(const nlohmann::basic_json&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5311:33: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = long long unsigned int; _Alloc = std::allocator]’, inlined from ‘void Metrics::add_alignment(const bam_hdr_t*, const bam1_t*)’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:893:59: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In file included from /build/ataqv-1.3.0+ds/src/cpp/Metrics.hpp:16, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:21: /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In function ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 2082 | basic_json(std::initializer_list init, | ^~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In function ‘nlohmann::basic_json::basic_json(std::initializer_list >, bool, value_t) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2082:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp: In member function ‘nlohmann::json Library::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1378 | } | ^ /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1378:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1376:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1376 | }; | ^ /usr/include/c++/12/bits/vector.tcc: In member function ‘void std::vector<_Tp, _Alloc>::_M_realloc_insert(iterator, _Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’: /usr/include/c++/12/bits/vector.tcc:439:7: note: parameter passing for argument of type ‘std::vector, std::allocator > >::iterator’ changed in GCC 7.1 439 | vector<_Tp, _Alloc>:: | ^~~~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, inlined from ‘void nlohmann::basic_json::push_back(nlohmann::basic_json&&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5275:33: /usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In file included from /usr/include/c++/12/bits/stl_pair.h:61, from /usr/include/c++/12/tuple:38, from /usr/include/c++/12/mutex:38, from /usr/include/c++/12/future:38, from /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:10: In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In static member function ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1392:22: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = double&; = double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = double&; U = double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1491:23: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘void std::_Construct(_Tp*, _Args&& ...) [with _Tp = nlohmann::basic_json<>; _Args = {const long double&}]’ at /usr/include/c++/12/bits/stl_construct.h:119:7, inlined from ‘_ForwardIterator std::__do_uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:120:21, inlined from ‘static _ForwardIterator std::__uninitialized_copy<_TrivialValueTypes>::__uninit_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; bool _TrivialValueTypes = false]’ at /usr/include/c++/12/bits/stl_uninitialized.h:137:32, inlined from ‘_ForwardIterator std::uninitialized_copy(_InputIterator, _InputIterator, _ForwardIterator) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*]’ at /usr/include/c++/12/bits/stl_uninitialized.h:185:15, inlined from ‘_ForwardIterator std::__uninitialized_copy_a(_InputIterator, _InputIterator, _ForwardIterator, allocator<_Tp>&) [with _InputIterator = __gnu_cxx::__normal_iterator >; _ForwardIterator = nlohmann::basic_json<>*; _Tp = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_uninitialized.h:372:37, inlined from ‘void std::vector<_Tp, _Alloc>::_M_range_initialize(_ForwardIterator, _ForwardIterator, std::forward_iterator_tag) [with _ForwardIterator = __gnu_cxx::__normal_iterator >; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1690:33, inlined from ‘std::vector<_Tp, _Alloc>::vector(_InputIterator, _InputIterator, const allocator_type&) [with _InputIterator = __gnu_cxx::__normal_iterator >; = void; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:706:23, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::vector, std::allocator > >; _Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; _Tp = std::vector, std::allocator > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::vector, std::allocator > >; Args = {__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:332:77, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleArrayType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleArrayType = std::vector; typename std::enable_if<(is_compatible_array_type::value || std::is_same::value), int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:581:52, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = const std::vector&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = const std::vector&; = std::vector; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = const std::vector&; U = std::vector; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘constexpr std::pair<_T1, _T2>::pair(const std::pair<_U1, _U2>&) [with _U1 = const std::__cxx11::basic_string; _U2 = std::vector; typename std::enable_if<(std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ConstructiblePair<_U1, _U2>() && std::_PCC<((! std::is_same<_T1, _U1>::value) || (! std::is_same<_T2, _U2>::value)), _T1, _T2>::_ImplicitlyConvertiblePair<_U1, _U2>()), bool>::type = true; _T1 = const std::__cxx11::basic_string; _T2 = nlohmann::basic_json<>]’ at /usr/include/c++/12/bits/stl_pair.h:439:29, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static void std::allocator_traits >::construct(allocator_type&, _Up*, _Args&& ...) [with _Up = std::pair, nlohmann::basic_json<> >; _Args = {const std::pair, std::allocator >, std::vector > >&}; _Tp = std::_Rb_tree_node, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/alloc_traits.h:516:17, inlined from ‘void std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_construct_node(_Link_type, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:595:32, inlined from ‘std::_Rb_tree_node<_Val>* std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_create_node(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:612:21, inlined from ‘std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_Auto_node::_Auto_node(std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>&, _Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1636:32, inlined from ‘std::pair, bool> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_emplace_unique(_Args&& ...) [with _Args = {const std::pair, std::allocator >, std::vector > >&}; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:2433:13, inlined from ‘std::__enable_if_t<(! std::is_same<_Val, typename std::iterator_traits<_InputIterator>::value_type>::value)> std::_Rb_tree<_Key, _Val, _KeyOfValue, _Compare, _Alloc>::_M_insert_range_unique(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Val = std::pair, nlohmann::basic_json<> >; _KeyOfValue = std::_Select1st, nlohmann::basic_json<> > >; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_tree.h:1110:23, inlined from ‘std::map<_Key, _Tp, _Compare, _Alloc>::map(_InputIterator, _InputIterator) [with _InputIterator = std::_Rb_tree_const_iterator, std::vector > >; _Key = std::__cxx11::basic_string; _Tp = nlohmann::basic_json<>; _Compare = std::less >; _Alloc = std::allocator, nlohmann::basic_json<> > >]’ at /usr/include/c++/12/bits/stl_map.h:285:31, inlined from ‘void std::__new_allocator<_Tp>::construct(_Up*, _Args&& ...) [with _Up = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; _Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; _Tp = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >]’ at /usr/include/c++/12/bits/new_allocator.h:175:4, inlined from ‘static T* nlohmann::basic_json::create(Args&& ...) [with T = std::map, nlohmann::basic_json<>, std::less >, std::allocator, nlohmann::basic_json<> > > >; Args = {std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator >, std::vector > > >}; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:1634:24, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if<(! std::is_same::value), int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:358:79, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, const CompatibleObjectType&) [with BasicJsonType = nlohmann::basic_json<>; CompatibleObjectType = std::map, std::vector >; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:590:53, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = std::map, std::vector >&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = std::map, std::vector >&; = std::map, std::vector >; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = std::map, std::vector >&; U = std::map, std::vector >; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::_Require >, std::is_move_constructible<_Tp>, std::is_move_assignable<_Tp> > std::swap(_Tp&, _Tp&) [with _Tp = nlohmann::basic_json<>::json_value]’, inlined from ‘nlohmann::basic_json::value_type& nlohmann::basic_json::operator=(nlohmann::basic_json) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2554:13, inlined from ‘static void nlohmann::detail::external_constructor::construct(BasicJsonType&, typename BasicJsonType::number_float_t) [with BasicJsonType = nlohmann::basic_json<>]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15, inlined from ‘void nlohmann::detail::to_json(BasicJsonType&, FloatType) [with BasicJsonType = nlohmann::basic_json<>; FloatType = long double; typename std::enable_if::value, int>::type = 0]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:545:59, inlined from ‘decltype ((nlohmann::detail::to_json(j, forward(val)), void())) nlohmann::detail::to_json_fn::call(BasicJsonType&, T&&, nlohmann::detail::priority_tag<1>) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:837:23, inlined from ‘void nlohmann::detail::to_json_fn::operator()(BasicJsonType&, T&&) const [with BasicJsonType = nlohmann::basic_json<>; T = long double&]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:852:20, inlined from ‘static void nlohmann::adl_serializer< , >::to_json(BasicJsonType&, ValueType&&) [with BasicJsonType = nlohmann::basic_json<>; ValueType = long double&; = long double; = void]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json::basic_json(CompatibleType&&) [with CompatibleType = long double&; U = long double; typename std::enable_if<((((! std::is_base_of, U>::value) && (! std::is_same >::value)) && (! nlohmann::detail::is_basic_json_nested_type, U>::value)) && nlohmann::detail::has_to_json, U>::value), int>::type = 0; ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:2009:35, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: /usr/include/c++/12/bits/move.h:205:7: warning: ‘.nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>::m_value’ may be used uninitialized [-Wmaybe-uninitialized] 205 | __a = _GLIBCXX_MOVE(__b); | ^~~ /build/ataqv-1.3.0+ds/src/cpp/json.hpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1460:28: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = long double; _Alloc = std::allocator]’, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1470:70: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ In member function ‘void std::vector<_Tp, _Alloc>::push_back(const value_type&) [with _Tp = long double; _Alloc = std::allocator]’, inlined from ‘nlohmann::json Metrics::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1481:75: /usr/include/c++/12/bits/stl_vector.h:1287:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator >’ changed in GCC 7.1 1287 | _M_realloc_insert(end(), __x); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~ /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp: In member function ‘nlohmann::json Metrics::to_json()’: /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1568 | } | ^ /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1568:1: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1566:5: note: parameter passing for argument of type ‘std::initializer_list >’ changed in GCC 7.1 1566 | }; | ^ In member function ‘void std::vector<_Tp, _Alloc>::emplace_back(_Args&& ...) [with _Args = {nlohmann::basic_json, std::allocator >, bool, long long int, long long unsigned int, double, std::allocator, nlohmann::adl_serializer>}; _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’, inlined from ‘void std::vector<_Tp, _Alloc>::push_back(value_type&&) [with _Tp = nlohmann::basic_json<>; _Alloc = std::allocator >]’ at /usr/include/c++/12/bits/stl_vector.h:1294:21, inlined from ‘void nlohmann::basic_json::push_back(nlohmann::basic_json&&) [with ObjectType = std::map; ArrayType = std::vector; StringType = std::__cxx11::basic_string; BooleanType = bool; NumberIntegerType = long long int; NumberUnsignedType = long long unsigned int; NumberFloatType = double; AllocatorType = std::allocator; JSONSerializer = nlohmann::adl_serializer]’ at /build/ataqv-1.3.0+ds/src/cpp/json.hpp:5275:33, inlined from ‘nlohmann::json MetricsCollector::to_json()’ at /build/ataqv-1.3.0+ds/src/cpp/Metrics.cpp:1586:25: /usr/include/c++/12/bits/vector.tcc:123:28: note: parameter passing for argument of type ‘__gnu_cxx::__normal_iterator*, std::vector, std::allocator > > >’ changed in GCC 7.1 123 | _M_realloc_insert(end(), std::forward<_Args>(__args)...); | ~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -g -O2 -ffile-prefix-map=/build/ataqv-1.3.0+ds=. -fstack-protector-strong -Wformat -Werror=format-security -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=2 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/build/ataqv-1.3.0+ds/src/cpp -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread make[2]: Leaving directory '/build/ataqv-1.3.0+ds' make[1]: Leaving directory '/build/ataqv-1.3.0+ds' dh_auto_test make -j3 test make[1]: Entering directory '/build/ataqv-1.3.0+ds' [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'hg19.tss.refseq.bed.gz'. Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] chr1 feature count: 2687 chr2 feature count: 1715 chr3 feature count: 1490 chr4 feature count: 1004 chr5 feature count: 1132 chr6 feature count: 1368 chr7 feature count: 1169 chr8 feature count: 913 chr9 feature count: 1025 chr10 feature count: 1039 chr11 feature count: 1642 chr12 feature count: 1350 chr13 feature count: 433 chr14 feature count: 785 chr15 feature count: 812 chr16 feature count: 1106 chr17 feature count: 1528 chr18 feature count: 398 chr19 feature count: 1785 chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 Loaded 24989 TSS in 4.47616 seconds. (5582.69 TSS/second). Collecting metrics from test.bam. Logging problematic reads to SRR891275.problems. Loading peaks for read group SRR891275 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 39.8159 seconds. (936.21 peaks/second). Logging problematic reads to SRR891278.problems. Loading peaks for read group SRR891278 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 39.0519 seconds. (954.525 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 439 (84.423%) 10: 439 (84.423%) 15: 438 (84.231%) 20: 436 (83.846%) 25: 435 (83.654%) 30: 420 (80.769%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) Read Group ========== ID: SRR891278 Library: SRR891278 Sample: GSM1155967 Description: a library of brutal tests? Sequencing center: Sequencing date: Sequencing platform: ILLUMINA Platform model: Platform unit: Flow order: Key sequence: Predicted median insert size: Programs: Metrics ------- Read Mapping Metrics -------------------- Total reads: 520 Total problems: 90 (17.308%) Properly paired and mapped reads: 430 (82.692%) Secondary reads: 10 (1.923%) Supplementary reads: 0 (0.000%) Duplicate reads: 158 (30.385% of all reads) Quality Indicators ------------------ Short to mononucleosomal ratio: 2.357 High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 as a percentage of autosomal reads: 91.743% as a percentage of all reads: 38.462% TSS enrichment: 3.687 Paired Read Metrics ------------------- Paired reads: 520 (100.000%) Paired and mapped reads: 440 (84.615%) FR reads: 430 (82.692308%) First of pair: 259 (49.808%) Second of pair: 261 (50.192%) Forward reads: 261 (50.192%) Reverse reads: 259 (49.808%) Forward mate reads: 260 (50.000%) Reverse mate reads: 260 (50.000%) Unmapped Read Metrics --------------------- Unmapped reads: 8 (1.538%) Unmapped mate reads: 4 (0.769%) Reads not passing quality controls: 0 (0.000%) Unpaired reads: 0 (0.000%) Reads with zero mapping quality: 49 (9.423%) Aberrant Mapping Metrics ------------------------ RF reads: 6 (1.153846%) FF reads: 4 (0.769231%) RR reads: 9 (1.730769%) Reads that paired and mapped but... on different chromosomes: 8 (1.538%) probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) just not properly: 0 (0.000%) Autosomal/Mitochondrial Metrics ------------------------------- Total autosomal reads: 218 (41.923% of all reads) Total mitochondrial reads: 192 (36.923% of all reads) Duplicate autosomal reads: 17 (7.798% of all autosomal reads) Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) Mapping Quality --------------- Mean MAPQ: 48.044 Median MAPQ: 60.000 Reads with MAPQ >=... 5: 449 (86.346%) 10: 445 (85.577%) 15: 443 (85.192%) 20: 442 (85.000%) 25: 442 (85.000%) 30: 417 (80.192%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 37.349 seconds. (998.041 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 888 (85.385%) 10: 884 (85.000%) 15: 881 (84.712%) 20: 878 (84.423%) 25: 877 (84.327%) 30: 837 (80.481%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (0.500% of all high quality autosomal alignments) Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from notthere.peaks.gz. Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'notthere.bed.gz'. =============================================================================== All tests passed (241 assertions in 54 test cases) make[1]: Leaving directory '/build/ataqv-1.3.0+ds' create-stamp debian/debhelper-build-stamp dh_prep debian/rules override_dh_auto_install make[1]: Entering directory '/build/ataqv-1.3.0+ds' dh_auto_install -- prefix=/usr make -j3 install DESTDIR=/build/ataqv-1.3.0\+ds/debian/ataqv AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" prefix=/usr make[2]: Entering directory '/build/ataqv-1.3.0+ds' Installing to /usr install -d -m 0755 /build/ataqv-1.3.0+ds/debian/ataqv/usr/bin install -d -m 0755 /build/ataqv-1.3.0+ds/debian/ataqv/usr/bin install -d -m 0755 /build/ataqv-1.3.0+ds/debian/ataqv/usr/share/ataqv/web install -m 0755 build/ataqv /build/ataqv-1.3.0+ds/debian/ataqv/usr/bin for f in src/scripts/make_ataqv_pipeline src/scripts/mkarv src/scripts/run_ataqv_example src/scripts/srvarv; do sed -e 's/{{VERSION}}/1.3.0/g' $f > build/$(basename $f); install -m 0755 build/$(basename $f) /build/ataqv-1.3.0+ds/debian/ataqv/usr/bin; done cp -a src/web/* /build/ataqv-1.3.0+ds/debian/ataqv/usr/share/ataqv/web find /build/ataqv-1.3.0+ds/debian/ataqv/usr/share/ataqv/web -type d -exec chmod 755 {} \; find /build/ataqv-1.3.0+ds/debian/ataqv/usr/share/ataqv/web -type f -exec chmod 644 {} \; make[2]: Leaving directory '/build/ataqv-1.3.0+ds' make[1]: Leaving directory '/build/ataqv-1.3.0+ds' dh_install dh_installdocs dh_installchangelogs dh_installexamples debian/rules override_dh_installman make[1]: Entering directory '/build/ataqv-1.3.0+ds' help2man --no-info --name="QC metrics for ATAC-seq data" build/ataqv > debian/ataqv.1 help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1 help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.3.0+ds src/scripts/srvarv > debian/srvarv.1 dh_installman make[1]: Leaving directory '/build/ataqv-1.3.0+ds' dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dpkg-shlibdeps: warning: debian/ataqv/usr/lib/ataqv/run_ataqv_tests contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin dpkg-shlibdeps: warning: debian/ataqv/usr/bin/ataqv contains an unresolvable reference to symbol __aeabi_atexit@CXXABI_ARM_1.3.3: it's probably a plugin dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'ataqv-dbgsym' in '../ataqv-dbgsym_1.3.0+ds-2_armhf.deb'. dpkg-deb: building package 'ataqv' in '../ataqv_1.3.0+ds-2_armhf.deb'. dpkg-genbuildinfo --build=binary -O../ataqv_1.3.0+ds-2_armhf.buildinfo dpkg-genchanges --build=binary -O../ataqv_1.3.0+ds-2_armhf.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/32670 and its subdirectories I: Current time: Sun May 21 14:58:06 -12 2023 I: pbuilder-time-stamp: 1684724286 Mon May 22 02:58:49 UTC 2023 I: 1st build successful. Starting 2nd build on remote node cbxi4a-armhf-rb.debian.net. Mon May 22 02:58:49 UTC 2023 I: Preparing to do remote build '2' on cbxi4a-armhf-rb.debian.net. Mon May 22 03:39:04 UTC 2023 I: Deleting $TMPDIR on cbxi4a-armhf-rb.debian.net. Mon May 22 03:39:06 UTC 2023 I: ataqv_1.3.0+ds-2_armhf.changes: Format: 1.8 Date: Fri, 30 Sep 2022 12:41:15 +0200 Source: ataqv Binary: ataqv ataqv-dbgsym Architecture: armhf Version: 1.3.0+ds-2 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: ataqv - ATAC-seq QC and visualization Changes: ataqv (1.3.0+ds-2) unstable; urgency=medium . * Team upload. * Fix watch file * Standards-Version: 4.6.1 (routine-update) * lintian-overrides due to lintian bug #1017966 Checksums-Sha1: 6d23ed2a34224ee2dd7b64b5dc0c49e7caf64557 7850876 ataqv-dbgsym_1.3.0+ds-2_armhf.deb 22b81f76bfa872466fbeb13b003da240417c2573 8246 ataqv_1.3.0+ds-2_armhf.buildinfo 50a8880b0a9e041f5e53967075d7cb61070bee62 3330464 ataqv_1.3.0+ds-2_armhf.deb Checksums-Sha256: 7af53abfa9ffb658ba6036293a8d99353fd8b225dd411474b432e478da49c4f5 7850876 ataqv-dbgsym_1.3.0+ds-2_armhf.deb 03091be15a004cd79de365778019aa4749e7d241029c530df39c4ae9806b6e38 8246 ataqv_1.3.0+ds-2_armhf.buildinfo cdcf0edc5da695c8a27a07600fa418123a1d9381cab9189f46ea4ccca8108123 3330464 ataqv_1.3.0+ds-2_armhf.deb Files: c76b3f4d35152e1778b80dfcb68e3f99 7850876 debug optional ataqv-dbgsym_1.3.0+ds-2_armhf.deb 7d9e06592c2832ab59f96ac8cb72024d 8246 science optional ataqv_1.3.0+ds-2_armhf.buildinfo 5acc4cda8735cb067dfce2e3dd09bca8 3330464 science optional ataqv_1.3.0+ds-2_armhf.deb Mon May 22 03:39:07 UTC 2023 I: diffoscope 242 will be used to compare the two builds: # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/ataqv_1.3.0+ds-2.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/ataqv_1.3.0+ds-2.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/ataqv_1.3.0+ds-2.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/b1/ataqv_1.3.0+ds-2_armhf.changes /srv/reproducible-results/rbuild-debian/r-b-build.GQG6sBWv/b2/ataqv_1.3.0+ds-2_armhf.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call abc.DotChangesFile ## main (total time: 0.413s) 0.413s 2 calls outputs 0.000s 1 call cleanup ## recognizes (total time: 0.129s) 0.129s 12 calls diffoscope.comparators.binary.FilesystemFile 0.000s 10 calls abc.DotChangesFile ## specialize (total time: 0.000s) 0.000s 1 call specialize Mon May 22 03:39:08 UTC 2023 I: diffoscope 242 found no differences in the changes files, and a .buildinfo file also exists. Mon May 22 03:39:08 UTC 2023 I: ataqv from bookworm built successfully and reproducibly on armhf. Mon May 22 03:39:09 UTC 2023 I: Submitting .buildinfo files to external archives: Mon May 22 03:39:09 UTC 2023 I: Submitting 12K b1/ataqv_1.3.0+ds-2_armhf.buildinfo.asc Mon May 22 03:39:10 UTC 2023 I: Submitting 12K b2/ataqv_1.3.0+ds-2_armhf.buildinfo.asc Mon May 22 03:39:11 UTC 2023 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Mon May 22 03:39:11 UTC 2023 I: Done submitting .buildinfo files. Mon May 22 03:39:11 UTC 2023 I: Removing signed ataqv_1.3.0+ds-2_armhf.buildinfo.asc files: removed './b1/ataqv_1.3.0+ds-2_armhf.buildinfo.asc' removed './b2/ataqv_1.3.0+ds-2_armhf.buildinfo.asc'