Wed Oct 29 12:28:27 UTC 2025 I: starting to build seqprep/forky/arm64 on jenkins on '2025-10-29 12:28' Wed Oct 29 12:28:27 UTC 2025 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/arm64_12/126816/console.log Wed Oct 29 12:28:27 UTC 2025 I: Downloading source for forky/seqprep=1.3.2-10 --2025-10-29 12:28:27-- http://deb.debian.org/debian/pool/main/s/seqprep/seqprep_1.3.2-10.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 1508 (1.5K) [text/prs.lines.tag] Saving to: ‘seqprep_1.3.2-10.dsc’ 0K . 100% 82.3M=0s 2025-10-29 12:28:27 (82.3 MB/s) - ‘seqprep_1.3.2-10.dsc’ saved [1508/1508] Wed Oct 29 12:28:27 UTC 2025 I: seqprep_1.3.2-10.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: seqprep Binary: seqprep, seqprep-data Architecture: any all Version: 1.3.2-10 Maintainer: Debian Med Packaging Team Uploaders: Tim Booth , Andreas Tille , Homepage: http://seqanswers.com/wiki/SeqPrep Standards-Version: 4.7.2 Vcs-Browser: https://salsa.debian.org/med-team/seqprep Vcs-Git: https://salsa.debian.org/med-team/seqprep.git Testsuite: autopkgtest Testsuite-Triggers: python3 Build-Depends: debhelper-compat (= 13), python3 , zlib1g-dev Package-List: seqprep deb science optional arch=any seqprep-data deb science optional arch=all Checksums-Sha1: 9f533e1fd14d310ba0ccd4ef38c3abc55b8fc5fd 37177540 seqprep_1.3.2.orig.tar.gz 40907b8cbd7ed9477276a61962e9d35df25b4666 12532 seqprep_1.3.2-10.debian.tar.xz Checksums-Sha256: 2b8a462a0e0a3e51f70be7730dc77b1f2bb69e74845dd0fbd2110a921c32265a 37177540 seqprep_1.3.2.orig.tar.gz 60ac7b51e44a9e4589fd520a038d4c76751131aa1f4d2c899eb5134b4a2efec6 12532 seqprep_1.3.2-10.debian.tar.xz Files: b6a4f5491dfdb0ce38bf791454151468 37177540 seqprep_1.3.2.orig.tar.gz ec53327db609b5b61b7f8e4d31d6d2a1 12532 seqprep_1.3.2-10.debian.tar.xz -----BEGIN PGP SIGNATURE----- iIgEARYKADAWIQSglbZu4JAkvuai8HIqJ5BL1yQ+2gUCaP5XmRIcbmlsZXNoQGRl Ymlhbi5vcmcACgkQKieQS9ckPtqNAAEAz9hUY4gUhR+t8RhHGe1bN9QeAezKFjXC EBF+1u67TMwA/1D1ilNrQGnHI2FQIXEdYDehWOXMt72SFk2QOcPfSDcJ =uPU+ -----END PGP SIGNATURE----- Wed Oct 29 12:28:27 UTC 2025 I: Checking whether the package is not for us Wed Oct 29 12:28:27 UTC 2025 I: Starting 1st build on remote node codethink04-arm64.debian.net. Wed Oct 29 12:28:27 UTC 2025 I: Preparing to do remote build '1' on codethink04-arm64.debian.net. Wed Oct 29 12:30:29 UTC 2025 I: Deleting $TMPDIR on codethink04-arm64.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Wed Oct 29 00:28:30 -12 2025 I: pbuilder-time-stamp: 1761740910 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/forky-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: Copying source file I: copying [seqprep_1.3.2-10.dsc] I: copying [./seqprep_1.3.2.orig.tar.gz] I: copying [./seqprep_1.3.2-10.debian.tar.xz] I: Extracting source dpkg-source: warning: cannot verify inline signature for ./seqprep_1.3.2-10.dsc: no acceptable signature found dpkg-source: info: extracting seqprep in seqprep-1.3.2 dpkg-source: info: unpacking seqprep_1.3.2.orig.tar.gz dpkg-source: info: unpacking seqprep_1.3.2-10.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying fix_unused_variable_errors.patch dpkg-source: info: applying hardening.patch dpkg-source: info: applying replace-float-with-double.patch dpkg-source: info: applying 2to3.patch dpkg-source: info: applying fix-declarations.patch I: using fakeroot in build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/1645189/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='arm64' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=12 ' DISTRIBUTION='forky' HOME='/root' HOST_ARCH='arm64' IFS=' ' INVOCATION_ID='5f41105f93e84073bc926076704c2d22' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='1645189' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.wtoorFHI/pbuilderrc_UA0R --distribution forky --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/forky-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.wtoorFHI/b1 --logfile b1/build.log seqprep_1.3.2-10.dsc' SUDO_GID='109' SUDO_HOME='/var/lib/jenkins' SUDO_UID='104' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://192.168.101.4:3128' I: uname -a Linux codethink04-arm64 6.12.48+deb13-cloud-arm64 #1 SMP Debian 6.12.48-1 (2025-09-20) aarch64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Aug 10 12:30 /bin -> usr/bin I: user script /srv/workspace/pbuilder/1645189/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: arm64 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), python3, zlib1g-dev dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 20004 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on python3; however: Package python3 is not installed. pbuilder-satisfydepends-dummy depends on zlib1g-dev; however: Package zlib1g-dev is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libarchive-zip-perl{a} libdebhelper-perl{a} libelf1t64{a} libexpat1{a} libffi8{a} libfile-stripnondeterminism-perl{a} libmagic-mgc{a} libmagic1t64{a} libpipeline1{a} libpython3-stdlib{a} libpython3.13-minimal{a} libpython3.13-stdlib{a} libreadline8t64{a} libtool{a} libuchardet0{a} libunistring5{a} libxml2-16{a} m4{a} man-db{a} media-types{a} netbase{a} po-debconf{a} python3{a} python3-minimal{a} python3.13{a} python3.13-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a} The following packages are RECOMMENDED but will NOT be installed: ca-certificates curl libarchive-cpio-perl libltdl-dev libmail-sendmail-perl lynx wget 0 packages upgraded, 44 newly installed, 0 to remove and 0 not upgraded. Need to get 18.2 MB of archives. After unpacking 73.3 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian forky/main arm64 libexpat1 arm64 2.7.3-1 [96.5 kB] Get: 2 http://deb.debian.org/debian forky/main arm64 libpython3.13-minimal arm64 3.13.9-1 [858 kB] Get: 3 http://deb.debian.org/debian forky/main arm64 python3.13-minimal arm64 3.13.9-1 [2061 kB] Get: 4 http://deb.debian.org/debian forky/main arm64 python3-minimal arm64 3.13.7-1 [27.2 kB] Get: 5 http://deb.debian.org/debian forky/main arm64 media-types all 14.0.0 [30.8 kB] Get: 6 http://deb.debian.org/debian forky/main arm64 netbase all 6.5 [12.4 kB] Get: 7 http://deb.debian.org/debian forky/main arm64 tzdata all 2025b-5 [260 kB] Get: 8 http://deb.debian.org/debian forky/main arm64 libffi8 arm64 3.5.2-2 [21.5 kB] Get: 9 http://deb.debian.org/debian forky/main arm64 readline-common all 8.3-3 [74.8 kB] Get: 10 http://deb.debian.org/debian forky/main arm64 libreadline8t64 arm64 8.3-3 [169 kB] Get: 11 http://deb.debian.org/debian forky/main arm64 libpython3.13-stdlib arm64 3.13.9-1 [1900 kB] Get: 12 http://deb.debian.org/debian forky/main arm64 python3.13 arm64 3.13.9-1 [764 kB] Get: 13 http://deb.debian.org/debian forky/main arm64 libpython3-stdlib arm64 3.13.7-1 [10.2 kB] Get: 14 http://deb.debian.org/debian forky/main arm64 python3 arm64 3.13.7-1 [28.3 kB] Get: 15 http://deb.debian.org/debian forky/main arm64 sensible-utils all 0.0.26 [27.0 kB] Get: 16 http://deb.debian.org/debian forky/main arm64 libmagic-mgc arm64 1:5.46-5 [338 kB] Get: 17 http://deb.debian.org/debian forky/main arm64 libmagic1t64 arm64 1:5.46-5 [103 kB] Get: 18 http://deb.debian.org/debian forky/main arm64 file arm64 1:5.46-5 [43.7 kB] Get: 19 http://deb.debian.org/debian forky/main arm64 gettext-base arm64 0.23.1-2+b1 [241 kB] Get: 20 http://deb.debian.org/debian forky/main arm64 libuchardet0 arm64 0.0.8-2 [69.0 kB] Get: 21 http://deb.debian.org/debian forky/main arm64 groff-base arm64 1.23.0-9 [1130 kB] Get: 22 http://deb.debian.org/debian forky/main arm64 bsdextrautils arm64 2.41.2-1 [94.3 kB] Get: 23 http://deb.debian.org/debian forky/main arm64 libpipeline1 arm64 1.5.8-1 [40.2 kB] Get: 24 http://deb.debian.org/debian forky/main arm64 man-db arm64 2.13.1-1 [1453 kB] Get: 25 http://deb.debian.org/debian forky/main arm64 m4 arm64 1.4.20-2 [315 kB] Get: 26 http://deb.debian.org/debian forky/main arm64 autoconf all 2.72-3.1 [494 kB] Get: 27 http://deb.debian.org/debian forky/main arm64 autotools-dev all 20240727.1 [60.2 kB] Get: 28 http://deb.debian.org/debian forky/main arm64 automake all 1:1.18.1-2 [877 kB] Get: 29 http://deb.debian.org/debian forky/main arm64 autopoint all 0.23.1-2 [770 kB] Get: 30 http://deb.debian.org/debian forky/main arm64 libdebhelper-perl all 13.28 [92.4 kB] Get: 31 http://deb.debian.org/debian forky/main arm64 libtool all 2.5.4-7 [540 kB] Get: 32 http://deb.debian.org/debian forky/main arm64 dh-autoreconf all 21 [12.2 kB] Get: 33 http://deb.debian.org/debian forky/main arm64 libarchive-zip-perl all 1.68-1 [104 kB] Get: 34 http://deb.debian.org/debian forky/main arm64 libfile-stripnondeterminism-perl all 1.15.0-1 [19.9 kB] Get: 35 http://deb.debian.org/debian forky/main arm64 dh-strip-nondeterminism all 1.15.0-1 [8812 B] Get: 36 http://deb.debian.org/debian forky/main arm64 libelf1t64 arm64 0.193-3 [189 kB] Get: 37 http://deb.debian.org/debian forky/main arm64 dwz arm64 0.16-2 [100 kB] Get: 38 http://deb.debian.org/debian forky/main arm64 libunistring5 arm64 1.3-2 [453 kB] Get: 39 http://deb.debian.org/debian forky/main arm64 libxml2-16 arm64 2.14.6+dfsg-0.1 [601 kB] Get: 40 http://deb.debian.org/debian forky/main arm64 gettext arm64 0.23.1-2+b1 [1612 kB] Get: 41 http://deb.debian.org/debian forky/main arm64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 42 http://deb.debian.org/debian forky/main arm64 po-debconf all 1.0.21+nmu1 [248 kB] Get: 43 http://deb.debian.org/debian forky/main arm64 debhelper all 13.28 [941 kB] Get: 44 http://deb.debian.org/debian forky/main arm64 zlib1g-dev arm64 1:1.3.dfsg+really1.3.1-1+b1 [917 kB] Fetched 18.2 MB in 0s (123 MB/s) Preconfiguring packages ... Selecting previously unselected package libexpat1:arm64. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20004 files and directories currently installed.) Preparing to unpack .../libexpat1_2.7.3-1_arm64.deb ... Unpacking libexpat1:arm64 (2.7.3-1) ... Selecting previously unselected package libpython3.13-minimal:arm64. Preparing to unpack .../libpython3.13-minimal_3.13.9-1_arm64.deb ... Unpacking libpython3.13-minimal:arm64 (3.13.9-1) ... Selecting previously unselected package python3.13-minimal. Preparing to unpack .../python3.13-minimal_3.13.9-1_arm64.deb ... Unpacking python3.13-minimal (3.13.9-1) ... Setting up libpython3.13-minimal:arm64 (3.13.9-1) ... Setting up libexpat1:arm64 (2.7.3-1) ... Setting up python3.13-minimal (3.13.9-1) ... Selecting previously unselected package python3-minimal. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 20338 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.13.7-1_arm64.deb ... Unpacking python3-minimal (3.13.7-1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_14.0.0_all.deb ... Unpacking media-types (14.0.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.5_all.deb ... Unpacking netbase (6.5) ... Selecting previously unselected package tzdata. Preparing to unpack .../3-tzdata_2025b-5_all.deb ... Unpacking tzdata (2025b-5) ... Selecting previously unselected package libffi8:arm64. Preparing to unpack .../4-libffi8_3.5.2-2_arm64.deb ... Unpacking libffi8:arm64 (3.5.2-2) ... Selecting previously unselected package readline-common. Preparing to unpack .../5-readline-common_8.3-3_all.deb ... Unpacking readline-common (8.3-3) ... Selecting previously unselected package libreadline8t64:arm64. Preparing to unpack .../6-libreadline8t64_8.3-3_arm64.deb ... Adding 'diversion of /lib/aarch64-linux-gnu/libhistory.so.8 to /lib/aarch64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/aarch64-linux-gnu/libhistory.so.8.2 to /lib/aarch64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/aarch64-linux-gnu/libreadline.so.8 to /lib/aarch64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' Adding 'diversion of /lib/aarch64-linux-gnu/libreadline.so.8.2 to /lib/aarch64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' Unpacking libreadline8t64:arm64 (8.3-3) ... Selecting previously unselected package libpython3.13-stdlib:arm64. Preparing to unpack .../7-libpython3.13-stdlib_3.13.9-1_arm64.deb ... Unpacking libpython3.13-stdlib:arm64 (3.13.9-1) ... Selecting previously unselected package python3.13. Preparing to unpack .../8-python3.13_3.13.9-1_arm64.deb ... Unpacking python3.13 (3.13.9-1) ... Selecting previously unselected package libpython3-stdlib:arm64. Preparing to unpack .../9-libpython3-stdlib_3.13.7-1_arm64.deb ... Unpacking libpython3-stdlib:arm64 (3.13.7-1) ... Setting up python3-minimal (3.13.7-1) ... Selecting previously unselected package python3. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 21353 files and directories currently installed.) Preparing to unpack .../00-python3_3.13.7-1_arm64.deb ... Unpacking python3 (3.13.7-1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../01-sensible-utils_0.0.26_all.deb ... Unpacking sensible-utils (0.0.26) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../02-libmagic-mgc_1%3a5.46-5_arm64.deb ... Unpacking libmagic-mgc (1:5.46-5) ... Selecting previously unselected package libmagic1t64:arm64. Preparing to unpack .../03-libmagic1t64_1%3a5.46-5_arm64.deb ... Unpacking libmagic1t64:arm64 (1:5.46-5) ... Selecting previously unselected package file. Preparing to unpack .../04-file_1%3a5.46-5_arm64.deb ... Unpacking file (1:5.46-5) ... Selecting previously unselected package gettext-base. Preparing to unpack .../05-gettext-base_0.23.1-2+b1_arm64.deb ... Unpacking gettext-base (0.23.1-2+b1) ... Selecting previously unselected package libuchardet0:arm64. Preparing to unpack .../06-libuchardet0_0.0.8-2_arm64.deb ... Unpacking libuchardet0:arm64 (0.0.8-2) ... Selecting previously unselected package groff-base. Preparing to unpack .../07-groff-base_1.23.0-9_arm64.deb ... Unpacking groff-base (1.23.0-9) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../08-bsdextrautils_2.41.2-1_arm64.deb ... Unpacking bsdextrautils (2.41.2-1) ... Selecting previously unselected package libpipeline1:arm64. Preparing to unpack .../09-libpipeline1_1.5.8-1_arm64.deb ... Unpacking libpipeline1:arm64 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../10-man-db_2.13.1-1_arm64.deb ... Unpacking man-db (2.13.1-1) ... Selecting previously unselected package m4. Preparing to unpack .../11-m4_1.4.20-2_arm64.deb ... Unpacking m4 (1.4.20-2) ... Selecting previously unselected package autoconf. Preparing to unpack .../12-autoconf_2.72-3.1_all.deb ... Unpacking autoconf (2.72-3.1) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../13-autotools-dev_20240727.1_all.deb ... Unpacking autotools-dev (20240727.1) ... Selecting previously unselected package automake. Preparing to unpack .../14-automake_1%3a1.18.1-2_all.deb ... Unpacking automake (1:1.18.1-2) ... Selecting previously unselected package autopoint. Preparing to unpack .../15-autopoint_0.23.1-2_all.deb ... Unpacking autopoint (0.23.1-2) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../16-libdebhelper-perl_13.28_all.deb ... Unpacking libdebhelper-perl (13.28) ... Selecting previously unselected package libtool. Preparing to unpack .../17-libtool_2.5.4-7_all.deb ... Unpacking libtool (2.5.4-7) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../18-dh-autoreconf_21_all.deb ... Unpacking dh-autoreconf (21) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.15.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.15.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../21-dh-strip-nondeterminism_1.15.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.15.0-1) ... Selecting previously unselected package libelf1t64:arm64. Preparing to unpack .../22-libelf1t64_0.193-3_arm64.deb ... Unpacking libelf1t64:arm64 (0.193-3) ... Selecting previously unselected package dwz. Preparing to unpack .../23-dwz_0.16-2_arm64.deb ... Unpacking dwz (0.16-2) ... Selecting previously unselected package libunistring5:arm64. Preparing to unpack .../24-libunistring5_1.3-2_arm64.deb ... Unpacking libunistring5:arm64 (1.3-2) ... Selecting previously unselected package libxml2-16:arm64. Preparing to unpack .../25-libxml2-16_2.14.6+dfsg-0.1_arm64.deb ... Unpacking libxml2-16:arm64 (2.14.6+dfsg-0.1) ... Selecting previously unselected package gettext. Preparing to unpack .../26-gettext_0.23.1-2+b1_arm64.deb ... Unpacking gettext (0.23.1-2+b1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../27-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../28-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../29-debhelper_13.28_all.deb ... Unpacking debhelper (13.28) ... Selecting previously unselected package zlib1g-dev:arm64. Preparing to unpack .../30-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_arm64.deb ... Unpacking zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up media-types (14.0.0) ... Setting up libpipeline1:arm64 (1.5.8-1) ... Setting up bsdextrautils (2.41.2-1) ... Setting up libmagic-mgc (1:5.46-5) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libxml2-16:arm64 (2.14.6+dfsg-0.1) ... Setting up libdebhelper-perl (13.28) ... Setting up libmagic1t64:arm64 (1:5.46-5) ... Setting up gettext-base (0.23.1-2+b1) ... Setting up m4 (1.4.20-2) ... Setting up file (1:5.46-5) ... Setting up libelf1t64:arm64 (0.193-3) ... Setting up tzdata (2025b-5) ... Current default time zone: 'Etc/UTC' Local time is now: Wed Oct 29 12:29:01 UTC 2025. Universal Time is now: Wed Oct 29 12:29:01 UTC 2025. Run 'dpkg-reconfigure tzdata' if you wish to change it. Setting up autotools-dev (20240727.1) ... Setting up libunistring5:arm64 (1.3-2) ... Setting up autopoint (0.23.1-2) ... Setting up autoconf (2.72-3.1) ... Setting up zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ... Setting up libffi8:arm64 (3.5.2-2) ... Setting up dwz (0.16-2) ... Setting up sensible-utils (0.0.26) ... Setting up libuchardet0:arm64 (0.0.8-2) ... Setting up netbase (6.5) ... Setting up readline-common (8.3-3) ... Setting up automake (1:1.18.1-2) ... update-alternatives: using /usr/bin/automake-1.18 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.15.0-1) ... Setting up gettext (0.23.1-2+b1) ... Setting up libtool (2.5.4-7) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (21) ... Setting up libreadline8t64:arm64 (8.3-3) ... Setting up dh-strip-nondeterminism (1.15.0-1) ... Setting up groff-base (1.23.0-9) ... Setting up libpython3.13-stdlib:arm64 (3.13.9-1) ... Setting up libpython3-stdlib:arm64 (3.13.7-1) ... Setting up python3.13 (3.13.9-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up python3 (3.13.7-1) ... Setting up man-db (2.13.1-1) ... Not building database; man-db/auto-update is not 'true'. Setting up debhelper (13.28) ... Processing triggers for libc-bin (2.41-12) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps Reading package lists... Building dependency tree... Reading state information... fakeroot is already the newest version (1.37.1.2-1). Solving dependencies... 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. I: Building the package I: Running cd /build/reproducible-path/seqprep-1.3.2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../seqprep_1.3.2-10_source.changes dpkg-buildpackage: info: source package seqprep dpkg-buildpackage: info: source version 1.3.2-10 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Nilesh Patra dpkg-source --before-build . dpkg-buildpackage: info: host architecture arm64 debian/rules clean dh clean dh_auto_clean make -j12 clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' rm -f SeqPrep.o utils.o stdaln.o SeqPrep make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_clean make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_clean rm -f seqprep rm -f README.html make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure debian/rules override_dh_auto_build make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_auto_build make -j12 INSTALL="install --strip-program=true" make[2]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=gnu90 -c -Wall -O0 -g -std=c99 SeqPrep.c -o SeqPrep.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=gnu90 -c -Wall -O0 -g -std=c99 utils.c -o utils.o cc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/seqprep-1.3.2=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=gnu90 -c -Wall -O0 -g -std=c99 stdaln.c -o stdaln.o cc SeqPrep.o utils.o stdaln.o -Wl,-z,relro -Wl,-z,now -lz -lm -o SeqPrep make[2]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep seqprep cp /build/reproducible-path/seqprep-1.3.2/debian/README.html /build/reproducible-path/seqprep-1.3.2 make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz fastq record not beginning with @ fastq record not beginning with @ Pairs Processed: 0 Pairs Merged: 14314 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.230141 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz fastq record not beginning with @ fastq record not beginning with @ Pairs Processed: 0 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.214914 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python3 seqlens.py ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python3 seqlens.py ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python3 seqlens.py ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] # remove output dirs right after testing to make sure the files # will not be included in the data package rm -rf Test/info Test/out make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install make -j12 install DESTDIR=/build/reproducible-path/seqprep-1.3.2/debian/tmp AM_UPDATE_INFO_DIR=no INSTALL="install --strip-program=true" make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' cp SeqPrep /build/reproducible-path/seqprep-1.3.2/debian/.debhelper/generated/_source/home/bin make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' debian/rules override_dh_install-indep make[1]: Entering directory '/build/reproducible-path/seqprep-1.3.2' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /build/reproducible-path/seqprep-1.3.2/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh make[1]: Leaving directory '/build/reproducible-path/seqprep-1.3.2' dh_install -Nseqprep-data dh_installdocs dh_installchangelogs dh_installman dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a dh_makeshlibs -a dh_shlibdeps -a dpkg-shlibdeps: warning: diversions involved - output may be incorrect diversion by libc6 from: /lib/ld-linux-aarch64.so.1 dpkg-shlibdeps: warning: diversions involved - output may be incorrect diversion by libc6 to: /lib/ld-linux-aarch64.so.1.usr-is-merged dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'seqprep' in '../seqprep_1.3.2-10_arm64.deb'. dpkg-deb: building package 'seqprep-dbgsym' in '../seqprep-dbgsym_1.3.2-10_arm64.deb'. dpkg-deb: building package 'seqprep-data' in '../seqprep-data_1.3.2-10_all.deb'. dpkg-genbuildinfo --build=binary -O../seqprep_1.3.2-10_arm64.buildinfo dpkg-genchanges --build=binary -O../seqprep_1.3.2-10_arm64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/1645189 and its subdirectories I: Current time: Wed Oct 29 00:30:19 -12 2025 I: pbuilder-time-stamp: 1761741019 Wed Oct 29 12:30:29 UTC 2025 I: 1st build successful. Starting 2nd build on remote node codethink03-arm64.debian.net. Wed Oct 29 12:30:29 UTC 2025 I: Preparing to do remote build '2' on codethink03-arm64.debian.net. Wed Oct 29 12:32:02 UTC 2025 I: Deleting $TMPDIR on codethink03-arm64.debian.net. Wed Oct 29 12:32:02 UTC 2025 I: seqprep_1.3.2-10_arm64.changes: Format: 1.8 Date: Sun, 26 Oct 2025 22:42:09 +0530 Source: seqprep Binary: seqprep seqprep-data seqprep-dbgsym Architecture: all arm64 Version: 1.3.2-10 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Nilesh Patra Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 1049489 Changes: seqprep (1.3.2-10) unstable; urgency=medium . * Team Upload. * cp README.html instead of mv (Closes: #1049489) * Bump Standards-Version to 4.7.2 (no changes needed) * Drop Redundant "Rules-Requires-Root: no" * Drop myself from uploaders Checksums-Sha1: a46574ba37f2b60486bb819aa6c9536990b0523d 35859856 seqprep-data_1.3.2-10_all.deb 9bcc9ef4cf0d053e6e65dfff161e127478ce4569 18500 seqprep-dbgsym_1.3.2-10_arm64.deb 7a6274b71de6140e30a1c0127cac601407428fd3 5533 seqprep_1.3.2-10_arm64.buildinfo 9f1eaac31ff9a5936f4eaf9d2c6b5604bafeef2c 27448 seqprep_1.3.2-10_arm64.deb Checksums-Sha256: daa4e8fffa5936863666677a5e37d35645fc30158bcaf1c8028c9ba1d1e102d6 35859856 seqprep-data_1.3.2-10_all.deb 23af267e8271d2fd3e6a28937cb743500ddfaea66c30ff91aa68124d868eaaa0 18500 seqprep-dbgsym_1.3.2-10_arm64.deb 9d84dc5ebd2bc5f3a754bb50dd68b57400aeb929d45a010140b79c60ba2b7ecd 5533 seqprep_1.3.2-10_arm64.buildinfo ef9898f91e84ae781a5653e45aee6c73549362a9be17f0f1341dccfd3deb2a49 27448 seqprep_1.3.2-10_arm64.deb Files: 3e8b81926cc3eb6a51210dd667007275 35859856 science optional seqprep-data_1.3.2-10_all.deb 2a9d3896261de59c829573455ce89264 18500 debug optional seqprep-dbgsym_1.3.2-10_arm64.deb 3831f14e7bd2fd5e6b9d61a8cb421b51 5533 science optional seqprep_1.3.2-10_arm64.buildinfo a6ffbc3238e5090f48361fe769af5993 27448 science optional seqprep_1.3.2-10_arm64.deb Wed Oct 29 12:32:03 UTC 2025 I: diffoscope 306 will be used to compare the two builds: Running as unit: rb-diffoscope-arm64_12-126816.service; invocation ID: de95341cdb5f47b0a87f8bb41b007441 # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.wtoorFHI/seqprep_1.3.2-10.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.wtoorFHI/seqprep_1.3.2-10.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.wtoorFHI/seqprep_1.3.2-10.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.wtoorFHI/b1/seqprep_1.3.2-10_arm64.changes /srv/reproducible-results/rbuild-debian/r-b-build.wtoorFHI/b2/seqprep_1.3.2-10_arm64.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call diffoscope.comparators.binary.FilesystemFile ## main (total time: 0.003s) 0.003s 2 calls outputs 0.000s 1 call cleanup Finished with result: success Main processes terminated with: code=exited, status=0/SUCCESS Service runtime: 207ms CPU time consumed: 171ms Memory peak: 17.9M (swap: 0B) Wed Oct 29 12:32:03 UTC 2025 I: diffoscope 306 found no differences in the changes files, and a .buildinfo file also exists. Wed Oct 29 12:32:03 UTC 2025 I: seqprep from forky built successfully and reproducibly on arm64. Wed Oct 29 12:32:04 UTC 2025 I: Removing signed seqprep_1.3.2-10_arm64.buildinfo.asc files: removed './b1/seqprep_1.3.2-10_arm64.buildinfo.asc' removed './b2/seqprep_1.3.2-10_arm64.buildinfo.asc'