Tue Mar 4 19:43:22 UTC 2025 I: starting to build bowtie/trixie/arm64 on jenkins on '2025-03-04 19:43'
Tue Mar 4 19:43:22 UTC 2025 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/arm64_9/62710/console.log
Tue Mar 4 19:43:22 UTC 2025 I: Downloading source for trixie/bowtie=1.3.1-3
--2025-03-04 19:43:22-- http://deb.debian.org/debian/pool/main/b/bowtie/bowtie_1.3.1-3.dsc
Connecting to 46.16.76.132:3128... connected.
Proxy request sent, awaiting response... 200 OK
Length: 2409 (2.4K) [text/prs.lines.tag]
Saving to: ‘bowtie_1.3.1-3.dsc’
0K .. 100% 305M=0s
2025-03-04 19:43:22 (305 MB/s) - ‘bowtie_1.3.1-3.dsc’ saved [2409/2409]
Tue Mar 4 19:43:22 UTC 2025 I: bowtie_1.3.1-3.dsc
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA512
Format: 3.0 (quilt)
Source: bowtie
Binary: bowtie, bowtie-examples
Architecture: any-amd64 alpha arm64 loong64 mips64el ppc64 ppc64el s390x sparc64 riscv64 all
Version: 1.3.1-3
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Uploaders: Steffen Moeller <moeller@debian.org>, Andreas Tille <tille@debian.org>, Ognyan Kulev <ogi@debian.org>, Stephan Struckmann <stephan.struckmann@gmail.com>, Alexandre Mestiashvili <mestia@debian.org>
Homepage: https://bowtie-bio.sourceforge.net/
Standards-Version: 4.6.2
Vcs-Browser: https://salsa.debian.org/med-team/bowtie
Vcs-Git: https://salsa.debian.org/med-team/bowtie.git
Testsuite: autopkgtest
Build-Depends: debhelper-compat (= 13), help2man, libtbb-dev, python3, zlib1g-dev, libclone-perl, libtest-deep-perl, libsys-info-perl
Package-List:
bowtie deb science optional arch=alpha,any-amd64,arm64,loong64,mips64el,ppc64,ppc64el,s390x,sparc64,riscv64
bowtie-examples deb science optional arch=all
Checksums-Sha1:
7dfa1ffdfce735fe0d131e96944e40e6bf35b1bc 7672741 bowtie_1.3.1.orig.tar.gz
47cb4ab0073069c73df428de915660f5db1d30d9 19052 bowtie_1.3.1-3.debian.tar.xz
Checksums-Sha256:
147d9fe9652f7c5f351bfc0eb012e06981986fb43bd6bdfe88a95c02eabc6573 7672741 bowtie_1.3.1.orig.tar.gz
c7620ad9c4e9b3fe3636002afc55ef13bdd4846d3b45a482de971d5e7e5e4144 19052 bowtie_1.3.1-3.debian.tar.xz
Files:
06b0377e967501ce73bca087e6c5fcb0 7672741 bowtie_1.3.1.orig.tar.gz
06dc0feed85e8553f8cbbe488358f498 19052 bowtie_1.3.1-3.debian.tar.xz
-----BEGIN PGP SIGNATURE-----
iQJCBAEBCgAsFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmWySBgOHHRpbGxlYUBy
a2kuZGUACgkQV4oElNHGRtF8Lg/+PKPNTgDY4fVW0LIKSAXKL5efYJFtAa2V0bwt
La75VpT5Y+6DqFD/GReROz2TqwA39own6kp4XCzY/VnO+ePxz675op62ZlxOWB/9
hxi4QArZ2oolXnir+ZWcge5KvmoFCXMbyVlGl+Ud+TxLZ6UJ0hvha1w1Ye6N5YZA
6CYKox3nI5i4R5syzysWRcVUUb1WC/11TJ9v7cl6gRujy/v1+zU2HJZg6BSjpu8z
Gw3HD9if0mcwJV2cMy0KRDngCp/y6IfLUBNi8mRt/Vu4VMjBCHWkVLltZlGFF7sV
wNiC2jLLw2Ezu8SYT4K0dpfN6on10dxroYIdeORTG0EFTtwt9yTcIJG5fSb9u863
A+VF0TycPqOFGHjM1b1fhyMF/EenTVMlaELNnVCrNyYIrHMVveI48hLo2Kd7mAKA
fxMo8JhOH3C6ULFsjagiT0q7uatY8XEzhgUiRkkCfDzmrycB9Pkjt7uDMgFOXHXJ
WTN61XKGH2YHiVt1NGrhVvtiMZ2tcgFvLfsi+8YYMAVjdqIfDNrKjEsO+6SxoLMD
sr84ZMHgN+fYF+uOHESFoP8QwZEbdjDhR8K3WDS9M9yufYaZqIAufFPNFuKWC8vx
273F/UYiNj0KMZqMOljccXnEG2xugkVMD6imDcogcNzdiyilroOFFl/mHIhG7o8R
RKg4HwA=
=eghx
-----END PGP SIGNATURE-----
Tue Mar 4 19:43:22 UTC 2025 I: Checking whether the package is not for us
Tue Mar 4 19:43:22 UTC 2025 I: Starting 1st build on remote node codethink04-arm64.debian.net.
Tue Mar 4 19:43:22 UTC 2025 I: Preparing to do remote build '1' on codethink04-arm64.debian.net.
Tue Mar 4 19:51:22 UTC 2025 I: Deleting $TMPDIR on codethink04-arm64.debian.net.
I: pbuilder: network access will be disabled during build
I: Current time: Tue Mar 4 07:43:25 -12 2025
I: pbuilder-time-stamp: 1741117405
I: Building the build Environment
I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz]
I: copying local configuration
W: --override-config is not set; not updating apt.conf Read the manpage for details.
I: mounting /proc filesystem
I: mounting /sys filesystem
I: creating /{dev,run}/shm
I: mounting /dev/pts filesystem
I: redirecting /dev/ptmx to /dev/pts/ptmx
I: policy-rc.d already exists
I: Copying source file
I: copying [bowtie_1.3.1-3.dsc]
I: copying [./bowtie_1.3.1.orig.tar.gz]
I: copying [./bowtie_1.3.1-3.debian.tar.xz]
I: Extracting source
dpkg-source: warning: cannot verify inline signature for ./bowtie_1.3.1-3.dsc: unsupported subcommand
dpkg-source: info: extracting bowtie in bowtie-1.3.1
dpkg-source: info: unpacking bowtie_1.3.1.orig.tar.gz
dpkg-source: info: unpacking bowtie_1.3.1-3.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying strip_html5shiv.patch
dpkg-source: info: applying spelling.patch
dpkg-source: info: applying no_hash_style_both_for_mips.patch
dpkg-source: info: applying use-dpkg-buildflags.patch
dpkg-source: info: applying reproducible.patch
dpkg-source: info: applying build-as-Cpp03.patch
dpkg-source: info: applying simple-test
dpkg-source: info: applying popcnt_capability.patch
I: Not using root during the build.
I: Installing the build-deps
I: user script /srv/workspace/pbuilder/3700895/tmp/hooks/D02_print_environment starting
I: set
BUILDDIR='/build/reproducible-path'
BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other'
BUILDUSERNAME='pbuilder1'
BUILD_ARCH='arm64'
DEBIAN_FRONTEND='noninteractive'
DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=12 '
DISTRIBUTION='trixie'
HOME='/root'
HOST_ARCH='arm64'
IFS='
'
INVOCATION_ID='c0dc9d0be52e4242a9701d19037e7971'
LANG='C'
LANGUAGE='en_US:en'
LC_ALL='C'
MAIL='/var/mail/root'
OPTIND='1'
PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games'
PBCURRENTCOMMANDLINEOPERATION='build'
PBUILDER_OPERATION='build'
PBUILDER_PKGDATADIR='/usr/share/pbuilder'
PBUILDER_PKGLIBDIR='/usr/lib/pbuilder'
PBUILDER_SYSCONFDIR='/etc'
PPID='3700895'
PS1='# '
PS2='> '
PS4='+ '
PWD='/'
SHELL='/bin/bash'
SHLVL='2'
SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.g1961dWD/pbuilderrc_mZG8 --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.g1961dWD/b1 --logfile b1/build.log bowtie_1.3.1-3.dsc'
SUDO_GID='109'
SUDO_UID='104'
SUDO_USER='jenkins'
TERM='unknown'
TZ='/usr/share/zoneinfo/Etc/GMT+12'
USER='root'
_='/usr/bin/systemd-run'
http_proxy='http://192.168.101.4:3128'
I: uname -a
Linux codethink04-arm64 6.1.0-31-cloud-arm64 #1 SMP Debian 6.1.128-1 (2025-02-07) aarch64 GNU/Linux
I: ls -l /bin
lrwxrwxrwx 1 root root 7 Nov 22 14:40 /bin -> usr/bin
I: user script /srv/workspace/pbuilder/3700895/tmp/hooks/D02_print_environment finished
-> Attempting to satisfy build-dependencies
-> Creating pbuilder-satisfydepends-dummy package
Package: pbuilder-satisfydepends-dummy
Version: 0.invalid.0
Architecture: arm64
Maintainer: Debian Pbuilder Team <pbuilder-maint@lists.alioth.debian.org>
Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder
This package was created automatically by pbuilder to satisfy the
build-dependencies of the package being currently built.
Depends: debhelper-compat (= 13), help2man, libtbb-dev, python3, zlib1g-dev, libclone-perl, libtest-deep-perl, libsys-info-perl
dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'.
Selecting previously unselected package pbuilder-satisfydepends-dummy.
(Reading database ... 19916 files and directories currently installed.)
Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ...
Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ...
dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested:
pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however:
Package debhelper-compat is not installed.
pbuilder-satisfydepends-dummy depends on help2man; however:
Package help2man is not installed.
pbuilder-satisfydepends-dummy depends on libtbb-dev; however:
Package libtbb-dev is not installed.
pbuilder-satisfydepends-dummy depends on python3; however:
Package python3 is not installed.
pbuilder-satisfydepends-dummy depends on zlib1g-dev; however:
Package zlib1g-dev is not installed.
pbuilder-satisfydepends-dummy depends on libclone-perl; however:
Package libclone-perl is not installed.
pbuilder-satisfydepends-dummy depends on libtest-deep-perl; however:
Package libtest-deep-perl is not installed.
pbuilder-satisfydepends-dummy depends on libsys-info-perl; however:
Package libsys-info-perl is not installed.
Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ...
Reading package lists...
Building dependency tree...
Reading state information...
Initializing package states...
Writing extended state information...
Building tag database...
pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0)
pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0)
The following NEW packages will be installed:
autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} help2man{a} intltool-debian{a} libarchive-zip-perl{a} libclone-perl{a} libconfig-general-perl{a} libdebhelper-perl{a} libelf1t64{a} libexpat1{a} libffi8{a} libfile-stripnondeterminism-perl{a} libhwloc15{a} libicu72{a} liblocale-gettext-perl{a} libmagic-mgc{a} libmagic1t64{a} libpipeline1{a} libpython3-stdlib{a} libpython3.13-minimal{a} libpython3.13-stdlib{a} libreadline8t64{a} libsys-info-base-perl{a} libsys-info-driver-linux-perl{a} libsys-info-perl{a} libtbb-dev{a} libtbb12{a} libtbbbind-2-5{a} libtbbmalloc2{a} libtest-deep-perl{a} libtool{a} libuchardet0{a} libunistring5{a} libunix-processors-perl{a} libxml2{a} m4{a} man-db{a} media-types{a} netbase{a} po-debconf{a} python3{a} python3-minimal{a} python3.13{a} python3.13-minimal{a} readline-common{a} sensible-utils{a} tzdata{a} zlib1g-dev{a}
The following packages are RECOMMENDED but will NOT be installed:
ca-certificates curl libarchive-cpio-perl libhwloc-plugins libltdl-dev libmail-sendmail-perl lynx wget
0 packages upgraded, 59 newly installed, 0 to remove and 0 not upgraded.
Need to get 28.1 MB of archives. After unpacking 113 MB will be used.
Writing extended state information...
Get: 1 http://deb.debian.org/debian trixie/main arm64 liblocale-gettext-perl arm64 1.07-7+b1 [15.2 kB]
Get: 2 http://deb.debian.org/debian trixie/main arm64 libpython3.13-minimal arm64 3.13.2-1 [853 kB]
Get: 3 http://deb.debian.org/debian trixie/main arm64 libexpat1 arm64 2.6.4-1 [90.7 kB]
Get: 4 http://deb.debian.org/debian trixie/main arm64 python3.13-minimal arm64 3.13.2-1 [1997 kB]
Get: 5 http://deb.debian.org/debian trixie/main arm64 python3-minimal arm64 3.13.2-1 [27.1 kB]
Get: 6 http://deb.debian.org/debian trixie/main arm64 media-types all 12.0.0 [28.9 kB]
Get: 7 http://deb.debian.org/debian trixie/main arm64 netbase all 6.4 [12.8 kB]
Get: 8 http://deb.debian.org/debian trixie/main arm64 tzdata all 2025a-2 [259 kB]
Get: 9 http://deb.debian.org/debian trixie/main arm64 libffi8 arm64 3.4.7-1 [21.2 kB]
Get: 10 http://deb.debian.org/debian trixie/main arm64 readline-common all 8.2-6 [69.4 kB]
Get: 11 http://deb.debian.org/debian trixie/main arm64 libreadline8t64 arm64 8.2-6 [159 kB]
Get: 12 http://deb.debian.org/debian trixie/main arm64 libpython3.13-stdlib arm64 3.13.2-1 [1914 kB]
Get: 13 http://deb.debian.org/debian trixie/main arm64 python3.13 arm64 3.13.2-1 [745 kB]
Get: 14 http://deb.debian.org/debian trixie/main arm64 libpython3-stdlib arm64 3.13.2-1 [10.0 kB]
Get: 15 http://deb.debian.org/debian trixie/main arm64 python3 arm64 3.13.2-1 [28.1 kB]
Get: 16 http://deb.debian.org/debian trixie/main arm64 sensible-utils all 0.0.24 [24.8 kB]
Get: 17 http://deb.debian.org/debian trixie/main arm64 libmagic-mgc arm64 1:5.45-3+b1 [314 kB]
Get: 18 http://deb.debian.org/debian trixie/main arm64 libmagic1t64 arm64 1:5.45-3+b1 [102 kB]
Get: 19 http://deb.debian.org/debian trixie/main arm64 file arm64 1:5.45-3+b1 [43.4 kB]
Get: 20 http://deb.debian.org/debian trixie/main arm64 gettext-base arm64 0.23.1-1 [241 kB]
Get: 21 http://deb.debian.org/debian trixie/main arm64 libuchardet0 arm64 0.0.8-1+b2 [69.2 kB]
Get: 22 http://deb.debian.org/debian trixie/main arm64 groff-base arm64 1.23.0-7 [1129 kB]
Get: 23 http://deb.debian.org/debian trixie/main arm64 bsdextrautils arm64 2.40.4-5 [92.0 kB]
Get: 24 http://deb.debian.org/debian trixie/main arm64 libpipeline1 arm64 1.5.8-1 [40.2 kB]
Get: 25 http://deb.debian.org/debian trixie/main arm64 man-db arm64 2.13.0-1 [1404 kB]
Get: 26 http://deb.debian.org/debian trixie/main arm64 m4 arm64 1.4.19-5 [284 kB]
Get: 27 http://deb.debian.org/debian trixie/main arm64 autoconf all 2.72-3 [493 kB]
Get: 28 http://deb.debian.org/debian trixie/main arm64 autotools-dev all 20220109.1 [51.6 kB]
Get: 29 http://deb.debian.org/debian trixie/main arm64 automake all 1:1.17-3 [862 kB]
Get: 30 http://deb.debian.org/debian trixie/main arm64 autopoint all 0.23.1-1 [770 kB]
Get: 31 http://deb.debian.org/debian trixie/main arm64 libdebhelper-perl all 13.24.1 [90.9 kB]
Get: 32 http://deb.debian.org/debian trixie/main arm64 libtool all 2.5.4-3 [539 kB]
Get: 33 http://deb.debian.org/debian trixie/main arm64 dh-autoreconf all 20 [17.1 kB]
Get: 34 http://deb.debian.org/debian trixie/main arm64 libarchive-zip-perl all 1.68-1 [104 kB]
Get: 35 http://deb.debian.org/debian trixie/main arm64 libfile-stripnondeterminism-perl all 1.14.1-2 [19.7 kB]
Get: 36 http://deb.debian.org/debian trixie/main arm64 dh-strip-nondeterminism all 1.14.1-2 [8620 B]
Get: 37 http://deb.debian.org/debian trixie/main arm64 libelf1t64 arm64 0.192-4 [189 kB]
Get: 38 http://deb.debian.org/debian trixie/main arm64 dwz arm64 0.15-1+b1 [102 kB]
Get: 39 http://deb.debian.org/debian trixie/main arm64 libunistring5 arm64 1.3-1 [449 kB]
Get: 40 http://deb.debian.org/debian trixie/main arm64 libicu72 arm64 72.1-6 [9239 kB]
Get: 41 http://deb.debian.org/debian trixie/main arm64 libxml2 arm64 2.12.7+dfsg+really2.9.14-0.2+b2 [630 kB]
Get: 42 http://deb.debian.org/debian trixie/main arm64 gettext arm64 0.23.1-1 [1610 kB]
Get: 43 http://deb.debian.org/debian trixie/main arm64 intltool-debian all 0.35.0+20060710.6 [22.9 kB]
Get: 44 http://deb.debian.org/debian trixie/main arm64 po-debconf all 1.0.21+nmu1 [248 kB]
Get: 45 http://deb.debian.org/debian trixie/main arm64 debhelper all 13.24.1 [920 kB]
Get: 46 http://deb.debian.org/debian trixie/main arm64 help2man arm64 1.49.3+b1 [198 kB]
Get: 47 http://deb.debian.org/debian trixie/main arm64 libclone-perl arm64 0.47-1+b1 [13.7 kB]
Get: 48 http://deb.debian.org/debian trixie/main arm64 libconfig-general-perl all 2.67-1 [71.3 kB]
Get: 49 http://deb.debian.org/debian trixie/main arm64 libhwloc15 arm64 2.12.0-1 [142 kB]
Get: 50 http://deb.debian.org/debian trixie/main arm64 libsys-info-base-perl all 0.7807-4 [28.0 kB]
Get: 51 http://deb.debian.org/debian trixie/main arm64 libunix-processors-perl arm64 2.046-3+b4 [16.3 kB]
Get: 52 http://deb.debian.org/debian trixie/main arm64 libsys-info-driver-linux-perl all 0.7905-6 [24.9 kB]
Get: 53 http://deb.debian.org/debian trixie/main arm64 libsys-info-perl all 0.7811-3 [8672 B]
Get: 54 http://deb.debian.org/debian trixie/main arm64 libtbbbind-2-5 arm64 2022.0.0-2 [14.4 kB]
Get: 55 http://deb.debian.org/debian trixie/main arm64 libtbbmalloc2 arm64 2022.0.0-2 [35.7 kB]
Get: 56 http://deb.debian.org/debian trixie/main arm64 libtbb12 arm64 2022.0.0-2 [66.6 kB]
Get: 57 http://deb.debian.org/debian trixie/main arm64 libtbb-dev arm64 2022.0.0-2 [199 kB]
Get: 58 http://deb.debian.org/debian trixie/main arm64 libtest-deep-perl all 1.204-1 [52.9 kB]
Get: 59 http://deb.debian.org/debian trixie/main arm64 zlib1g-dev arm64 1:1.3.dfsg+really1.3.1-1+b1 [917 kB]
Fetched 28.1 MB in 0s (76.0 MB/s)
Preconfiguring packages ...
Selecting previously unselected package liblocale-gettext-perl.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 19916 files and directories currently installed.)
Preparing to unpack .../liblocale-gettext-perl_1.07-7+b1_arm64.deb ...
Unpacking liblocale-gettext-perl (1.07-7+b1) ...
Selecting previously unselected package libpython3.13-minimal:arm64.
Preparing to unpack .../libpython3.13-minimal_3.13.2-1_arm64.deb ...
Unpacking libpython3.13-minimal:arm64 (3.13.2-1) ...
Selecting previously unselected package libexpat1:arm64.
Preparing to unpack .../libexpat1_2.6.4-1_arm64.deb ...
Unpacking libexpat1:arm64 (2.6.4-1) ...
Selecting previously unselected package python3.13-minimal.
Preparing to unpack .../python3.13-minimal_3.13.2-1_arm64.deb ...
Unpacking python3.13-minimal (3.13.2-1) ...
Setting up libpython3.13-minimal:arm64 (3.13.2-1) ...
Setting up libexpat1:arm64 (2.6.4-1) ...
Setting up python3.13-minimal (3.13.2-1) ...
Selecting previously unselected package python3-minimal.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 20265 files and directories currently installed.)
Preparing to unpack .../0-python3-minimal_3.13.2-1_arm64.deb ...
Unpacking python3-minimal (3.13.2-1) ...
Selecting previously unselected package media-types.
Preparing to unpack .../1-media-types_12.0.0_all.deb ...
Unpacking media-types (12.0.0) ...
Selecting previously unselected package netbase.
Preparing to unpack .../2-netbase_6.4_all.deb ...
Unpacking netbase (6.4) ...
Selecting previously unselected package tzdata.
Preparing to unpack .../3-tzdata_2025a-2_all.deb ...
Unpacking tzdata (2025a-2) ...
Selecting previously unselected package libffi8:arm64.
Preparing to unpack .../4-libffi8_3.4.7-1_arm64.deb ...
Unpacking libffi8:arm64 (3.4.7-1) ...
Selecting previously unselected package readline-common.
Preparing to unpack .../5-readline-common_8.2-6_all.deb ...
Unpacking readline-common (8.2-6) ...
Selecting previously unselected package libreadline8t64:arm64.
Preparing to unpack .../6-libreadline8t64_8.2-6_arm64.deb ...
Adding 'diversion of /lib/aarch64-linux-gnu/libhistory.so.8 to /lib/aarch64-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/aarch64-linux-gnu/libhistory.so.8.2 to /lib/aarch64-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/aarch64-linux-gnu/libreadline.so.8 to /lib/aarch64-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64'
Adding 'diversion of /lib/aarch64-linux-gnu/libreadline.so.8.2 to /lib/aarch64-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64'
Unpacking libreadline8t64:arm64 (8.2-6) ...
Selecting previously unselected package libpython3.13-stdlib:arm64.
Preparing to unpack .../7-libpython3.13-stdlib_3.13.2-1_arm64.deb ...
Unpacking libpython3.13-stdlib:arm64 (3.13.2-1) ...
Selecting previously unselected package python3.13.
Preparing to unpack .../8-python3.13_3.13.2-1_arm64.deb ...
Unpacking python3.13 (3.13.2-1) ...
Selecting previously unselected package libpython3-stdlib:arm64.
Preparing to unpack .../9-libpython3-stdlib_3.13.2-1_arm64.deb ...
Unpacking libpython3-stdlib:arm64 (3.13.2-1) ...
Setting up python3-minimal (3.13.2-1) ...
Selecting previously unselected package python3.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 21275 files and directories currently installed.)
Preparing to unpack .../00-python3_3.13.2-1_arm64.deb ...
Unpacking python3 (3.13.2-1) ...
Selecting previously unselected package sensible-utils.
Preparing to unpack .../01-sensible-utils_0.0.24_all.deb ...
Unpacking sensible-utils (0.0.24) ...
Selecting previously unselected package libmagic-mgc.
Preparing to unpack .../02-libmagic-mgc_1%3a5.45-3+b1_arm64.deb ...
Unpacking libmagic-mgc (1:5.45-3+b1) ...
Selecting previously unselected package libmagic1t64:arm64.
Preparing to unpack .../03-libmagic1t64_1%3a5.45-3+b1_arm64.deb ...
Unpacking libmagic1t64:arm64 (1:5.45-3+b1) ...
Selecting previously unselected package file.
Preparing to unpack .../04-file_1%3a5.45-3+b1_arm64.deb ...
Unpacking file (1:5.45-3+b1) ...
Selecting previously unselected package gettext-base.
Preparing to unpack .../05-gettext-base_0.23.1-1_arm64.deb ...
Unpacking gettext-base (0.23.1-1) ...
Selecting previously unselected package libuchardet0:arm64.
Preparing to unpack .../06-libuchardet0_0.0.8-1+b2_arm64.deb ...
Unpacking libuchardet0:arm64 (0.0.8-1+b2) ...
Selecting previously unselected package groff-base.
Preparing to unpack .../07-groff-base_1.23.0-7_arm64.deb ...
Unpacking groff-base (1.23.0-7) ...
Selecting previously unselected package bsdextrautils.
Preparing to unpack .../08-bsdextrautils_2.40.4-5_arm64.deb ...
Unpacking bsdextrautils (2.40.4-5) ...
Selecting previously unselected package libpipeline1:arm64.
Preparing to unpack .../09-libpipeline1_1.5.8-1_arm64.deb ...
Unpacking libpipeline1:arm64 (1.5.8-1) ...
Selecting previously unselected package man-db.
Preparing to unpack .../10-man-db_2.13.0-1_arm64.deb ...
Unpacking man-db (2.13.0-1) ...
Selecting previously unselected package m4.
Preparing to unpack .../11-m4_1.4.19-5_arm64.deb ...
Unpacking m4 (1.4.19-5) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../12-autoconf_2.72-3_all.deb ...
Unpacking autoconf (2.72-3) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../13-autotools-dev_20220109.1_all.deb ...
Unpacking autotools-dev (20220109.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../14-automake_1%3a1.17-3_all.deb ...
Unpacking automake (1:1.17-3) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../15-autopoint_0.23.1-1_all.deb ...
Unpacking autopoint (0.23.1-1) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../16-libdebhelper-perl_13.24.1_all.deb ...
Unpacking libdebhelper-perl (13.24.1) ...
Selecting previously unselected package libtool.
Preparing to unpack .../17-libtool_2.5.4-3_all.deb ...
Unpacking libtool (2.5.4-3) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../18-dh-autoreconf_20_all.deb ...
Unpacking dh-autoreconf (20) ...
Selecting previously unselected package libarchive-zip-perl.
Preparing to unpack .../19-libarchive-zip-perl_1.68-1_all.deb ...
Unpacking libarchive-zip-perl (1.68-1) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../20-libfile-stripnondeterminism-perl_1.14.1-2_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.14.1-2) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../21-dh-strip-nondeterminism_1.14.1-2_all.deb ...
Unpacking dh-strip-nondeterminism (1.14.1-2) ...
Selecting previously unselected package libelf1t64:arm64.
Preparing to unpack .../22-libelf1t64_0.192-4_arm64.deb ...
Unpacking libelf1t64:arm64 (0.192-4) ...
Selecting previously unselected package dwz.
Preparing to unpack .../23-dwz_0.15-1+b1_arm64.deb ...
Unpacking dwz (0.15-1+b1) ...
Selecting previously unselected package libunistring5:arm64.
Preparing to unpack .../24-libunistring5_1.3-1_arm64.deb ...
Unpacking libunistring5:arm64 (1.3-1) ...
Selecting previously unselected package libicu72:arm64.
Preparing to unpack .../25-libicu72_72.1-6_arm64.deb ...
Unpacking libicu72:arm64 (72.1-6) ...
Selecting previously unselected package libxml2:arm64.
Preparing to unpack .../26-libxml2_2.12.7+dfsg+really2.9.14-0.2+b2_arm64.deb ...
Unpacking libxml2:arm64 (2.12.7+dfsg+really2.9.14-0.2+b2) ...
Selecting previously unselected package gettext.
Preparing to unpack .../27-gettext_0.23.1-1_arm64.deb ...
Unpacking gettext (0.23.1-1) ...
Selecting previously unselected package intltool-debian.
Preparing to unpack .../28-intltool-debian_0.35.0+20060710.6_all.deb ...
Unpacking intltool-debian (0.35.0+20060710.6) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../29-po-debconf_1.0.21+nmu1_all.deb ...
Unpacking po-debconf (1.0.21+nmu1) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../30-debhelper_13.24.1_all.deb ...
Unpacking debhelper (13.24.1) ...
Selecting previously unselected package help2man.
Preparing to unpack .../31-help2man_1.49.3+b1_arm64.deb ...
Unpacking help2man (1.49.3+b1) ...
Selecting previously unselected package libclone-perl:arm64.
Preparing to unpack .../32-libclone-perl_0.47-1+b1_arm64.deb ...
Unpacking libclone-perl:arm64 (0.47-1+b1) ...
Selecting previously unselected package libconfig-general-perl.
Preparing to unpack .../33-libconfig-general-perl_2.67-1_all.deb ...
Unpacking libconfig-general-perl (2.67-1) ...
Selecting previously unselected package libhwloc15:arm64.
Preparing to unpack .../34-libhwloc15_2.12.0-1_arm64.deb ...
Unpacking libhwloc15:arm64 (2.12.0-1) ...
Selecting previously unselected package libsys-info-base-perl.
Preparing to unpack .../35-libsys-info-base-perl_0.7807-4_all.deb ...
Unpacking libsys-info-base-perl (0.7807-4) ...
Selecting previously unselected package libunix-processors-perl:arm64.
Preparing to unpack .../36-libunix-processors-perl_2.046-3+b4_arm64.deb ...
Unpacking libunix-processors-perl:arm64 (2.046-3+b4) ...
Selecting previously unselected package libsys-info-driver-linux-perl.
Preparing to unpack .../37-libsys-info-driver-linux-perl_0.7905-6_all.deb ...
Unpacking libsys-info-driver-linux-perl (0.7905-6) ...
Selecting previously unselected package libsys-info-perl.
Preparing to unpack .../38-libsys-info-perl_0.7811-3_all.deb ...
Unpacking libsys-info-perl (0.7811-3) ...
Selecting previously unselected package libtbbbind-2-5:arm64.
Preparing to unpack .../39-libtbbbind-2-5_2022.0.0-2_arm64.deb ...
Unpacking libtbbbind-2-5:arm64 (2022.0.0-2) ...
Selecting previously unselected package libtbbmalloc2:arm64.
Preparing to unpack .../40-libtbbmalloc2_2022.0.0-2_arm64.deb ...
Unpacking libtbbmalloc2:arm64 (2022.0.0-2) ...
Selecting previously unselected package libtbb12:arm64.
Preparing to unpack .../41-libtbb12_2022.0.0-2_arm64.deb ...
Unpacking libtbb12:arm64 (2022.0.0-2) ...
Selecting previously unselected package libtbb-dev:arm64.
Preparing to unpack .../42-libtbb-dev_2022.0.0-2_arm64.deb ...
Unpacking libtbb-dev:arm64 (2022.0.0-2) ...
Selecting previously unselected package libtest-deep-perl.
Preparing to unpack .../43-libtest-deep-perl_1.204-1_all.deb ...
Unpacking libtest-deep-perl (1.204-1) ...
Selecting previously unselected package zlib1g-dev:arm64.
Preparing to unpack .../44-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_arm64.deb ...
Unpacking zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ...
Setting up media-types (12.0.0) ...
Setting up libpipeline1:arm64 (1.5.8-1) ...
Setting up libtbbmalloc2:arm64 (2022.0.0-2) ...
Setting up libconfig-general-perl (2.67-1) ...
Setting up libicu72:arm64 (72.1-6) ...
Setting up bsdextrautils (2.40.4-5) ...
Setting up libtest-deep-perl (1.204-1) ...
Setting up libmagic-mgc (1:5.45-3+b1) ...
Setting up libclone-perl:arm64 (0.47-1+b1) ...
Setting up libarchive-zip-perl (1.68-1) ...
Setting up libdebhelper-perl (13.24.1) ...
Setting up libmagic1t64:arm64 (1:5.45-3+b1) ...
Setting up gettext-base (0.23.1-1) ...
Setting up m4 (1.4.19-5) ...
Setting up file (1:5.45-3+b1) ...
Setting up libelf1t64:arm64 (0.192-4) ...
Setting up tzdata (2025a-2) ...
Current default time zone: 'Etc/UTC'
Local time is now: Tue Mar 4 19:43:45 UTC 2025.
Universal Time is now: Tue Mar 4 19:43:45 UTC 2025.
Run 'dpkg-reconfigure tzdata' if you wish to change it.
Setting up autotools-dev (20220109.1) ...
Setting up libunix-processors-perl:arm64 (2.046-3+b4) ...
Setting up libunistring5:arm64 (1.3-1) ...
Setting up libhwloc15:arm64 (2.12.0-1) ...
Setting up autopoint (0.23.1-1) ...
Setting up autoconf (2.72-3) ...
Setting up zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ...
Setting up libffi8:arm64 (3.4.7-1) ...
Setting up dwz (0.15-1+b1) ...
Setting up sensible-utils (0.0.24) ...
Setting up libuchardet0:arm64 (0.0.8-1+b2) ...
Setting up netbase (6.4) ...
Setting up libsys-info-base-perl (0.7807-4) ...
Setting up readline-common (8.2-6) ...
Setting up libxml2:arm64 (2.12.7+dfsg+really2.9.14-0.2+b2) ...
Setting up liblocale-gettext-perl (1.07-7+b1) ...
Setting up automake (1:1.17-3) ...
update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode
Setting up libfile-stripnondeterminism-perl (1.14.1-2) ...
Setting up gettext (0.23.1-1) ...
Setting up libsys-info-driver-linux-perl (0.7905-6) ...
Setting up libtool (2.5.4-3) ...
Setting up libtbbbind-2-5:arm64 (2022.0.0-2) ...
Setting up intltool-debian (0.35.0+20060710.6) ...
Setting up help2man (1.49.3+b1) ...
Setting up dh-autoreconf (20) ...
Setting up libreadline8t64:arm64 (8.2-6) ...
Setting up dh-strip-nondeterminism (1.14.1-2) ...
Setting up groff-base (1.23.0-7) ...
Setting up libpython3.13-stdlib:arm64 (3.13.2-1) ...
Setting up libpython3-stdlib:arm64 (3.13.2-1) ...
Setting up libsys-info-perl (0.7811-3) ...
Setting up python3.13 (3.13.2-1) ...
Setting up po-debconf (1.0.21+nmu1) ...
Setting up python3 (3.13.2-1) ...
Setting up libtbb12:arm64 (2022.0.0-2) ...
Setting up man-db (2.13.0-1) ...
Not building database; man-db/auto-update is not 'true'.
Setting up libtbb-dev:arm64 (2022.0.0-2) ...
Setting up debhelper (13.24.1) ...
Processing triggers for libc-bin (2.40-7) ...
Reading package lists...
Building dependency tree...
Reading state information...
Reading extended state information...
Initializing package states...
Writing extended state information...
Building tag database...
-> Finished parsing the build-deps
I: Building the package
I: Running cd /build/reproducible-path/bowtie-1.3.1/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../bowtie_1.3.1-3_source.changes
dpkg-buildpackage: info: source package bowtie
dpkg-buildpackage: info: source version 1.3.1-3
dpkg-buildpackage: info: source distribution unstable
dpkg-buildpackage: info: source changed by Andreas Tille <tille@debian.org>
dpkg-source --before-build .
dpkg-buildpackage: info: host architecture arm64
debian/rules clean
dh clean
debian/rules override_dh_auto_clean
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
rm -f .bowtie*
rm -f .simple*
rm -rf __pycache__
dh_auto_clean
make -j12 clean
make[2]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
rm -f bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-build-s-debug bowtie-build-l-debug bowtie-align-s-debug bowtie-align-l-debug bowtie-inspect-s-debug bowtie-inspect-l-debug \
bowtie_prof \
bowtie-build-s.exe bowtie-build-l.exe bowtie-align-s.exe bowtie-align-l.exe bowtie-inspect-s.exe bowtie-inspect-l.exe bowtie-build-s-debug.exe bowtie-build-l-debug.exe bowtie-align-s-debug.exe bowtie-align-l-debug.exe bowtie-inspect-s-debug.exe bowtie-inspect-l-debug.exe bowtie_prof.exe \
bowtie-src.zip bowtie-bin.zip
rm -f *.core
rm -f bowtie-align-s-master* bowtie-align-s-no-io*
rm -rf .lib .include
make[2]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
dh_clean
debian/rules binary
dh binary
dh_update_autotools_config
dh_autoreconf
dh_auto_configure
debian/rules override_dh_auto_build
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
/usr/bin/make allall
make[2]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-build-s ebwt_build.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
In file included from ebwt_build.cpp:8:
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]' at multikey_qsort.h:597:31:
ds.h:497:17: warning: 'tmp2' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
In file included from diff_sample.h:14,
from blockwise_sa.h:17,
from ebwt.h:25,
from ebwt_build.cpp:10:
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]':
multikey_qsort.h:596:36: note: 'tmp2' declared here
596 | QSortRange tmp2;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]' at multikey_qsort.h:606:31:
ds.h:497:17: warning: 'tmp3' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]':
multikey_qsort.h:605:36: note: 'tmp3' declared here
605 | QSortRange tmp3;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]' at multikey_qsort.h:614:31:
ds.h:497:17: warning: 'tmp4' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]':
multikey_qsort.h:613:36: note: 'tmp4' declared here
613 | QSortRange tmp4;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]' at multikey_qsort.h:597:31:
ds.h:497:17: warning: 'tmp2' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]':
multikey_qsort.h:596:36: note: 'tmp2' declared here
596 | QSortRange tmp2;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]' at multikey_qsort.h:606:31:
ds.h:497:17: warning: 'tmp3' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]':
multikey_qsort.h:605:36: note: 'tmp3' declared here
605 | QSortRange tmp3;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]' at multikey_qsort.h:614:31:
ds.h:497:17: warning: 'tmp4' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]':
multikey_qsort.h:613:36: note: 'tmp4' declared here
613 | QSortRange tmp4;
| ^~~~
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-build-l ebwt_build.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
In file included from ebwt_build.cpp:8:
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]' at multikey_qsort.h:597:31:
ds.h:497:17: warning: 'tmp2' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
In file included from diff_sample.h:14,
from blockwise_sa.h:17,
from ebwt.h:25,
from ebwt_build.cpp:10:
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]':
multikey_qsort.h:596:36: note: 'tmp2' declared here
596 | QSortRange tmp2;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]' at multikey_qsort.h:606:31:
ds.h:497:17: warning: 'tmp3' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]':
multikey_qsort.h:605:36: note: 'tmp3' declared here
605 | QSortRange tmp3;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]' at multikey_qsort.h:614:31:
ds.h:497:17: warning: 'tmp4' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = S2bDnaString]':
multikey_qsort.h:613:36: note: 'tmp4' declared here
613 | QSortRange tmp4;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]' at multikey_qsort.h:597:31:
ds.h:497:17: warning: 'tmp2' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]':
multikey_qsort.h:596:36: note: 'tmp2' declared here
596 | QSortRange tmp2;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]' at multikey_qsort.h:606:31:
ds.h:497:17: warning: 'tmp3' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]':
multikey_qsort.h:605:36: note: 'tmp3' declared here
605 | QSortRange tmp3;
| ^~~~
In member function 'void EList<T, S>::push_back(const T&) [with T = QSortRange; int S = 128]',
inlined from 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]' at multikey_qsort.h:614:31:
ds.h:497:17: warning: 'tmp4' may be used uninitialized [-Wmaybe-uninitialized]
497 | list_[cur_++] = el;
| ^~~~~
multikey_qsort.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList<long unsigned int>*) [with T = SString<char>]':
multikey_qsort.h:613:36: note: 'tmp4' declared here
613 | QSortRange tmp4;
| ^~~~
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-align-s ebwt_search.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-align-l ebwt_search.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O3 \
-DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party -I . \
-o bowtie-inspect-s bowtie_inspect.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O3 \
-DCOMPILER_OPTIONS="\"-O3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party -I . \
-o bowtie-inspect-l bowtie_inspect.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-build-s-debug ebwt_build.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-build-l-debug ebwt_build.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O0 -g3 \
-DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-align-s-debug ebwt_search.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O0 -g3 \
-DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party \
-o bowtie-align-l-debug ebwt_search.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O0 -g3 \
-DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party -I . \
-o bowtie-inspect-s-debug bowtie_inspect.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
g++ -O0 -g3 \
-DCOMPILER_OPTIONS="\"-O0 -g3 -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=.=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now\"" -Wl,--hash-style=both -Wdate-time -D_FORTIFY_SOURCE=2 -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -g -O2 -ffile-prefix-map=/build/reproducible-path/bowtie-1.3.1=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -std=c++03 -Wl,-z,relro -Wl,-z,now \
-fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"Debian-reproducible\"" -DBUILD_TIME="\"`dpkg-parsechangelog --show-field Date`\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1 | sed 's/ *(.*//'`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \
-I third_party -I . \
-o bowtie-inspect-l-debug bowtie_inspect.cpp \
ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \
-Wl,-z,relro -Wl,-z,now -lz -lpthread
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
cc1plus: warning: '-Werror=' argument '-Werror=implicit-function-declaration' is not valid for C++
make[2]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
debian/rules override_dh_auto_test
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
unset LD_PRELOAD && make simple-test
make[2]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
./scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build
FASTA-continuous 1 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 3
# reads with at least one alignment: 3 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 3 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 5 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 6 (fw:1, sam:1)
References:
>0
AGCATCGATCAG
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 3
# reads with at least one alignment: 3 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 3 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:12
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
Cline 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Cline 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
0 4 * 0 0 * * 0 0 XM:i:0
Cline 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
Cline multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Cline multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Cline paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Cline paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Cline paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted
100.00%)
No alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII"
0 77 * 0 0 * * 0 0 XM:i:0
0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Fastq 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
@HD VN:1.0 SO:unsorted
Reported 1 alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Fastq 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
r0 4 * 0 0 * * 0 0 XM:i:0
Fastq 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
Fastq multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Fastq multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
@HD VN:1.0 SO:unsorted
Reported 2 alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Fastq paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fastq paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fastq paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 XM:i:0
r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Fasta 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Fasta 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 4 * 0 0 * * 0 0 XM:i:0
Fasta 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
Fasta multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Fasta multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Fasta paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1
r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fasta paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fasta paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
0 77 * 0 0 * * 0 0 XM:i:0
0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Raw 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Raw 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 4 * 0 0 * * 0 0 XM:i:0
Raw 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
Raw multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Raw multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Raw paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Raw paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Raw paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
0 77 * 0 0 * * 0 0 XM:i:0
0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Tabbed 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Tabbed 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 4 * 0 0 * * 0 0 XM:i:0
Tabbed 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
Tabbed multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Tabbed multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Tabbed paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Tabbed paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Tabbed paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 77 * 0 0 * * 0 0 XM:i:0
r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Interleaved 1 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq"
r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 2 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 2 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
Paired-end 2 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 2 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 4, containment excluded (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
Paired-end 4, containment excluded (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
Paired-end 4, containment excluded (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
Paired-end 4, containment excluded (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
Paired-end 5, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 5, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 5, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 5, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 9, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
Paired-end 9, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 9, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
Paired-end 9, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Checking -m, 1 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 1 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 1 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 1 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 2 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking -m, 2 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking -m, 2 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking -m, 2 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking edits 1 (fw:1, sam:1)
References:
>0
TTGCCCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 1 (fw:0, sam:1)
References:
>0
TTGCCCGT
./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 1 (fw:1, sam:1)
References:
>0
TTGCCCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 1 (fw:0, sam:1)
References:
>0
TTGCCCGT
./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 2 (fw:1, sam:1)
References:
>0
TTGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 2 (fw:0, sam:1)
References:
>0
TTGTTCGT
./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 2 (fw:1, sam:1)
References:
>0
TTGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 2 (fw:0, sam:1)
References:
>0
TTGTTCGT
./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 3 (fw:1, sam:1)
References:
>0
ACGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
Checking edits 3 (fw:0, sam:1)
References:
>0
ACGTTCGT
./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
Checking edits 3 (fw:1, sam:1)
References:
>0
ACGTTCGT
./bowtie-build --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
Checking edits 3 (fw:0, sam:1)
References:
>0
ACGTTCGT
./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
FASTA-continuous 1 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 3
# reads with at least one alignment: 3 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 3 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
FASTA-continuous 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 5 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
FASTA-continuous 6 (fw:1, sam:1)
References:
>0
AGCATCGATCAG
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 3
# reads with at least one alignment: 3 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 3 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:12
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests"
seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
Cline 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Cline 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
0 4 * 0 0 * * 0 0 XM:i:0
Cline 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII"
Cline multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Cline multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Cline paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Cline paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: @HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
1
# reads with at least one alignment: 1 (@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII"
0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Cline paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII"
0 77 * 0 0 * * 0 0 XM:i:0
0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Fastq 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: @HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
1 (r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
Fastq 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
r0 4 * 0 0 * * 0 0 XM:i:0
Fastq 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
Fastq multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Fastq multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: @HD VN:1.0 SO:unsorted
2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Fastq paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fastq paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fastq paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 XM:i:0
r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Fasta 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Fasta 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 4 * 0 0 * * 0 0 XM:i:0
Fasta 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
Fasta multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Fasta multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Fasta paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1
r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fasta paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
@HD VN:1.0 SO:unsorted
Reported 1 paired-end alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Fasta paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa"
0 77 * 0 0 * * 0 0 XM:i:0
0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Raw 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Raw 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: @HD VN:1.0 SO:unsorted
1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 4 * 0 0 * * 0 0 XM:i:0
Raw 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted
0.00%)
No alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
Raw multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Raw multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw"
0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Raw paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted
Reported 1 paired-end alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Raw paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Raw paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw"
0 77 * 0 0 * * 0 0 XM:i:0
0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Tabbed 7 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: @HD VN:1.0 SO:unsorted
0 (0.00%)
Reported 1 alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1
Tabbed 8 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 4 * 0 0 * * 0 0 XM:i:0
Tabbed 9 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 0
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
Tabbed multiread 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
Tabbed multiread 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAGTATCTGA
./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 2
# reads with at least one alignment: 2 (100.00%)
# reads that failed to align: @HD VN:1.0 SO:unsorted
0 (0.00%)
Reported 2 alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1
r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1
Tabbed paired 2 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
@HD VN:1.0 SO:unsorted
Reported 1 paired-end alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Tabbed paired 3 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
@HD VN:1.0 SO:unsorted
Reported 1 paired-end alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1
r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1
Tabbed paired 4 (fw:1, sam:1)
References:
>0
AGCATCGATCAAAAACTGA
./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)@HD VN:1.0 SO:unsorted
No alignments
@SQ SN:0 LN:19
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab"
r0 77 * 0 0 * * 0 0 XM:i:0
r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0
Interleaved 1 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq"
r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported @HD VN:1.0 SO:unsorted
1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 1 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 2 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 2 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted
%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 2 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 2 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: @HD VN:1.0 SO:unsorted
1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted
%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted
0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 3 (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted
%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 4, containment excluded (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted
0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
Paired-end 4, containment excluded (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (@HD VN:1.0 SO:unsorted
100.00%)
No alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
Paired-end 4, containment excluded (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted
0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
Paired-end 4, containment excluded (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0
r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0
Paired-end 5, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
@HD VN:1.0 SO:unsorted
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 5, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 5, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted
100.00%)
# reads that failed to align: 0 (0.00%)
@SQ SN:0 LN:25
Reported 1 paired-end alignments
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 5, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0@HD VN:1.0 SO:unsorted
(0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted
%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted
100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 6, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted
%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
@HD VN:1.0 SO:unsorted
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 7, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (@HD VN:1.0 SO:unsorted
0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 8, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 9, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: @HD VN:1.0 SO:unsorted
0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
Paired-end 9, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Paired-end 9, allow contain (fw:1, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00@HD VN:1.0 SO:unsorted
%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
Paired-end 9, allow contain (fw:0, sam:1)
References:
>0
AAAACGAAAGCTTTTATAGATGGGG
./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 paired-end alignments
@SQ SN:0 LN:25
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq"
r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1
r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1
Checking -m, 1 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 1 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 1 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 1 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGT
./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 2 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:16
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2
Checking -m, 2 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking -m, 2 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking -m, 2 (fw:1, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking -m, 2 (fw:0, sam:1)
References:
>0
TTGTTCGTTTGTTCGTTTGTTCGT
./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
# reads with alignments suppressed due to -m: 1 (100.00%)
No alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:24
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq"
Checking edits 1 (fw:1, sam:1)
References:
>0
TTGCCCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 1 (fw:0, sam:1)
References:
>0
TTGCCCGT
./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 1 (fw:1, sam:1)
References:
>0
TTGCCCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 1 (fw:0, sam:1)
References:
>0
TTGCCCGT
./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1
Checking edits 2 (fw:1, sam:1)
References:
>0
TTGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 2 (fw:0, sam:1)
References:
>0
TTGTTCGT
./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: @HD VN:1.0 SO:unsorted
0 (0.00%)
Reported 1 alignments
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 2 (fw:1, sam:1)
References:
>0
TTGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 2 (fw:0, sam:1)
References:
>0
TTGTTCGT
./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1
Checking edits 3 (fw:1, sam:1)
References:
>0
ACGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
Checking edits 3 (fw:0, sam:1)
References:
>0
ACGTTCGT
./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
Checking edits 3 (fw:1, sam:1)
References:
>0
ACGTTCGT
./bowtie-build --large-index --quiet .simple_tests.pl.fa .simple_tests.tmp
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
Checking edits 3 (fw:0, sam:1)
References:
>0
ACGTTCGT
./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
@HD VN:1.0 SO:unsorted
@SQ SN:0 LN:8
@PG ID:Bowtie VN:1.3.1 CL:"/build/reproducible-path/bowtie-1.3.1/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq"
r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1
PASSED
make[2]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
ln -s debian/tests
unset LD_PRELOAD && sh debian/tests/run-unit-test test_at_build_time
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 5 alignments
example1 OK
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 3 alignments
example2 OK
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 5 alignments
example3 OK
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
example4 OK
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 5 alignments
example5 OK
example7 OK
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 5 alignments
example8 OK
Setting the index via positional argument will be deprecated in a future release. Please use -x option instead.
# reads processed: 1
# reads with at least one alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments
rm -f tests examples[0-9].out
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
create-stamp debian/debhelper-build-stamp
dh_prep
dh_installdirs
debian/rules override_dh_auto_install-arch
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
# remove strange byte-compyled Python code bowtie-buildc (no idea how and why it was created)
find . -name bowtie-buildc -delete
find . -name .cvsignore -delete
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
dh_auto_install -Nbowtie
make -j12 install DESTDIR=/build/reproducible-path/bowtie-1.3.1/debian/tmp AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true"
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
mkdir -p /build/reproducible-path/bowtie-1.3.1/debian/tmp/usr/local/bin
for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \
cp -f $file /build/reproducible-path/bowtie-1.3.1/debian/tmp/usr/local/bin ; \
done
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
debian/rules override_dh_install
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
dh_install
if [ -d debian/tmp/usr/local/bin ] ; then \
dh_install -a usr/local/bin usr ; \
fi
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
dh_installdocs
dh_installchangelogs
debian/rules override_dh_installman-arch
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
help2man --name="ultrafast memory-efficient short read aligner" --no-info \
/build/reproducible-path/bowtie-1.3.1/bowtie > /build/reproducible-path/bowtie-1.3.1/debian/bowtie/usr/share/man/man1/bowtie.1
help2man --name="building a colorspace index for bowtie" --no-info \
/build/reproducible-path/bowtie-1.3.1/bowtie-build > /build/reproducible-path/bowtie-1.3.1/debian/bowtie/usr/share/man/man1/bowtie-build.1
help2man --name="extracts information from a bowtie index" --no-info \
/build/reproducible-path/bowtie-1.3.1/bowtie-inspect > /build/reproducible-path/bowtie-1.3.1/debian/bowtie/usr/share/man/man1/bowtie-inspect.1
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
dh_lintian
dh_perl
dh_link
dh_strip_nondeterminism
debian/rules override_dh_compress
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
dh_compress -X.ebwt
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
debian/rules override_dh_fixperms-indep
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
dh_fixperms
chmod 644 debian/bowtie-examples/usr/share/doc/bowtie/examples/indexes/*
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
dh_fixperms -Nbowtie-examples
debian/rules override_dh_missing-indep
make[1]: Entering directory '/build/reproducible-path/bowtie-1.3.1'
dh_missing -i --list-missing
make[1]: Leaving directory '/build/reproducible-path/bowtie-1.3.1'
dh_missing -Nbowtie-examples
dh_dwz -a
dh_strip -a
dh_makeshlibs -a
dh_shlibdeps -a
dpkg-shlibdeps: warning: diversions involved - output may be incorrect
diversion by libc6 from: /lib/ld-linux-aarch64.so.1
dpkg-shlibdeps: warning: diversions involved - output may be incorrect
diversion by libc6 to: /lib/ld-linux-aarch64.so.1.usr-is-merged
dh_installdeb
dh_gencontrol
dh_md5sums
dh_builddeb
dpkg-deb: building package 'bowtie-examples' in '../bowtie-examples_1.3.1-3_all.deb'.
dpkg-deb: building package 'bowtie' in '../bowtie_1.3.1-3_arm64.deb'.
dpkg-deb: building package 'bowtie-dbgsym' in '../bowtie-dbgsym_1.3.1-3_arm64.deb'.
dpkg-genbuildinfo --build=binary -O../bowtie_1.3.1-3_arm64.buildinfo
dpkg-genchanges --build=binary -O../bowtie_1.3.1-3_arm64.changes
dpkg-genchanges: info: binary-only upload (no source code included)
dpkg-source --after-build .
dpkg-buildpackage: info: binary-only upload (no source included)
dpkg-genchanges: info: not including original source code in upload
I: copying local configuration
I: unmounting dev/ptmx filesystem
I: unmounting dev/pts filesystem
I: unmounting dev/shm filesystem
I: unmounting proc filesystem
I: unmounting sys filesystem
I: cleaning the build env
I: removing directory /srv/workspace/pbuilder/3700895 and its subdirectories
I: Current time: Tue Mar 4 07:51:20 -12 2025
I: pbuilder-time-stamp: 1741117880
Tue Mar 4 19:51:22 UTC 2025 I: 1st build successful. Starting 2nd build on remote node codethink03-arm64.debian.net.
Tue Mar 4 19:51:22 UTC 2025 I: Preparing to do remote build '2' on codethink03-arm64.debian.net.
Tue Mar 4 19:58:50 UTC 2025 I: Deleting $TMPDIR on codethink03-arm64.debian.net.
Tue Mar 4 19:58:51 UTC 2025 I: bowtie_1.3.1-3_arm64.changes:
Format: 1.8
Date: Thu, 25 Jan 2024 12:27:31 +0100
Source: bowtie
Binary: bowtie bowtie-dbgsym bowtie-examples
Architecture: arm64 all
Version: 1.3.1-3
Distribution: unstable
Urgency: medium
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Changed-By: Andreas Tille <tille@debian.org>
Description:
bowtie - Ultrafast memory-efficient short read aligner
bowtie-examples - Examples for bowtie, the ultrafast memory-efficient short read al
Closes: 1043697
Changes:
bowtie (1.3.1-3) unstable; urgency=medium
.
* Fix clean target
Closes: #1043697
Checksums-Sha1:
0122d5a65d4aaa4d06f95ef196a2ae39cb8cc402 13721996 bowtie-dbgsym_1.3.1-3_arm64.deb
098f189ee99964932f26396c96d37fead003370e 6304832 bowtie-examples_1.3.1-3_all.deb
004c8591a686b3b3f220bd9b351da7a608732b4b 6081 bowtie_1.3.1-3_arm64.buildinfo
676be9ff66146f5c6ba1b2fba636b28cd53ef7e0 1337596 bowtie_1.3.1-3_arm64.deb
Checksums-Sha256:
bfcabf591bfab3e036f48616a62377f7f59b8bcacefa9f65a5932ef6b0f6b7c3 13721996 bowtie-dbgsym_1.3.1-3_arm64.deb
824b2035ec19fecf4dddf593082721b9be6f2073faae4ba91b99e6b01d607edf 6304832 bowtie-examples_1.3.1-3_all.deb
aea7e9ef5bbbe2240df6fcd1219408e3cf4f063965bb5e4b74c60f5b04fbf4f8 6081 bowtie_1.3.1-3_arm64.buildinfo
1a2151729a875625fc7cf66947bfdb7e0611e2b0ad6bd2e718c8c481f189a697 1337596 bowtie_1.3.1-3_arm64.deb
Files:
8bbcb748a41a135eae87131867430f17 13721996 debug optional bowtie-dbgsym_1.3.1-3_arm64.deb
70d1d55bbd4dbf70ddbef4aca6ad62a9 6304832 science optional bowtie-examples_1.3.1-3_all.deb
e5ee5c7548a04bae0d10018d6e0151b1 6081 science optional bowtie_1.3.1-3_arm64.buildinfo
425854180645da6113ea0bc22d0da5eb 1337596 science optional bowtie_1.3.1-3_arm64.deb
Tue Mar 4 19:58:52 UTC 2025 I: diffoscope 289 will be used to compare the two builds:
Running as unit: rb-diffoscope-arm64_9-62710.service
# Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.g1961dWD/bowtie_1.3.1-3.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.g1961dWD/bowtie_1.3.1-3.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.g1961dWD/bowtie_1.3.1-3.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.g1961dWD/b1/bowtie_1.3.1-3_arm64.changes /srv/reproducible-results/rbuild-debian/r-b-build.g1961dWD/b2/bowtie_1.3.1-3_arm64.changes
## command (total time: 0.000s)
0.000s 1 call cmp (internal)
## has_same_content_as (total time: 0.000s)
0.000s 1 call diffoscope.comparators.binary.FilesystemFile
## main (total time: 0.004s)
0.004s 2 calls outputs
0.000s 1 call cleanup
Finished with result: success
Main processes terminated with: code=exited/status=0
Service runtime: 283ms
CPU time consumed: 275ms
Tue Mar 4 20:01:23 UTC 2025 I: diffoscope 289 found no differences in the changes files, and a .buildinfo file also exists.
Tue Mar 4 20:01:23 UTC 2025 I: bowtie from trixie built successfully and reproducibly on arm64.
Tue Mar 4 20:01:28 UTC 2025 I: Submitting .buildinfo files to external archives:
Tue Mar 4 20:01:28 UTC 2025 I: Submitting 8.0K b1/bowtie_1.3.1-3_arm64.buildinfo.asc
Tue Mar 4 20:01:43 UTC 2025 I: Submitting 8.0K b2/bowtie_1.3.1-3_arm64.buildinfo.asc
Tue Mar 4 20:02:05 UTC 2025 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit.
Tue Mar 4 20:02:05 UTC 2025 I: Done submitting .buildinfo files.
Tue Mar 4 20:02:05 UTC 2025 I: Removing signed bowtie_1.3.1-3_arm64.buildinfo.asc files:
removed './b1/bowtie_1.3.1-3_arm64.buildinfo.asc'
removed './b2/bowtie_1.3.1-3_arm64.buildinfo.asc'