Thu Feb 27 21:43:17 UTC 2025 I: starting to build bio-tradis/trixie/i386 on jenkins on '2025-02-27 21:43' Thu Feb 27 21:43:17 UTC 2025 I: The jenkins build log is/was available at https://jenkins.debian.net/userContent/reproducible/debian/build_service/i386_4/54360/console.log Thu Feb 27 21:43:17 UTC 2025 I: Downloading source for trixie/bio-tradis=1.4.5+dfsg2-2 --2025-02-27 21:43:17-- http://deb.debian.org/debian/pool/main/b/bio-tradis/bio-tradis_1.4.5%2bdfsg2-2.dsc Connecting to 46.16.76.132:3128... connected. Proxy request sent, awaiting response... 200 OK Length: 2263 (2.2K) [text/prs.lines.tag] Saving to: ‘bio-tradis_1.4.5+dfsg2-2.dsc’ 0K .. 100% 385M=0s 2025-02-27 21:43:17 (385 MB/s) - ‘bio-tradis_1.4.5+dfsg2-2.dsc’ saved [2263/2263] Thu Feb 27 21:43:17 UTC 2025 I: bio-tradis_1.4.5+dfsg2-2.dsc -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: bio-tradis Binary: bio-tradis Architecture: all Version: 1.4.5+dfsg2-2 Maintainer: Debian Med Packaging Team Uploaders: Andreas Tille Homepage: https://github.com/sanger-pathogens/Bio-Tradis Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/bio-tradis Vcs-Git: https://salsa.debian.org/med-team/bio-tradis.git Build-Depends: debhelper-compat (= 13) Build-Depends-Indep: libbio-perl-perl, libenv-path-perl, libexception-class-perl, libmoose-perl, libtest-exception-perl, libtest-files-perl, libtest-most-perl, libtest-simple-perl, libtext-csv-perl, libtry-tiny-perl, perl, samtools, smalt, tabix, bwa Package-List: bio-tradis deb perl optional arch=all Checksums-Sha1: 8dc680ab6fafa5205030a15c0e8986fb0428f671 7876340 bio-tradis_1.4.5+dfsg2.orig.tar.xz 2a1eadb27d76c6ec3c148df87ddbaa0d885d931a 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz Checksums-Sha256: 2ae1058a077eb8753dea148079c82ac8335c1488886cfbf2a6fe534b7f7c076e 7876340 bio-tradis_1.4.5+dfsg2.orig.tar.xz 32dd5c211c5e7a1180e8050b1da7c0d0b12c5531bd11c61eb2fc837e8f92265c 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz Files: c31ec74b7db82cd7bf39386caf70859f 7876340 bio-tradis_1.4.5+dfsg2.orig.tar.xz b60da3af535d0d1ca443981c7c214475 6096 bio-tradis_1.4.5+dfsg2-2.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmWyckMRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtEcCw//ZTk4IY8aNznJ3KYSWeiaR56je93jBfXP 4LNFWhU+Aff//+l+Z5t8QuwimuggzhW7zEdLVX+f/gFb/HvC0hhc8MnjBNKfOPqB NgaTEr6FLxrMK4fEIlSQ99cHs6MutOVr2hDhLr2Mz4Ubftw7jDWerq7+t4kT0W+l lYExwwtK6MFxYEC2mp5Isl+1nbN9rxA8vAX5viDJ/QAxb+0rQtc5wED+XUarAEmy ySGjuNpyymyRwLwPWfSvxZXaeRLSzsKp6xjaNAU7ehVu3ZTe3o/xjqKBlKFDaBuR lxox1OqDN76xb0l8hxwAviCCcy6pb9kd935trlr0/SSfeDE4Mhmq6xZvP9r0ZTzp 9WpDbaeQcBSlYGm5ONWfIIDCrJ0aT0OvC9uU6EJc0UD+/f9S/rFTfYSOv/SE9V2H Bi6ryezTo7qoO59+iGUB+8j5tpjx7W/DQiJwxUKgxvGuNmBm5aOjlgg/h7a/EXAI 6eD27joS4hBPBrS1aW3KI9hW2W3alolO2rJUqYN5E8hEWQXzW74A4596ruMkduEe HWwCLfWhFeo5Lqe8lsdTiv8gIRSIXguFirdTkt1i2e52brvN47e/Z2M6HIjfbNBp bra2Ja2ufnXb9Sln8ellb8nOQs2txDsl8wFxvnA9foY9YkKILL7dE4B0tSJgvqh0 QkVSpHZ33Q0= =JKCT -----END PGP SIGNATURE----- Thu Feb 27 21:43:17 UTC 2025 I: Checking whether the package is not for us Thu Feb 27 21:43:17 UTC 2025 I: Starting 1st build on remote node ionos16-i386.debian.net. Thu Feb 27 21:43:17 UTC 2025 I: Preparing to do remote build '1' on ionos16-i386.debian.net. Thu Feb 27 21:43:52 UTC 2025 I: Deleting $TMPDIR on ionos16-i386.debian.net. I: pbuilder: network access will be disabled during build I: Current time: Wed Apr 1 16:06:17 -12 2026 I: pbuilder-time-stamp: 1775102777 I: Building the build Environment I: extracting base tarball [/var/cache/pbuilder/trixie-reproducible-base.tgz] I: copying local configuration W: --override-config is not set; not updating apt.conf Read the manpage for details. I: mounting /proc filesystem I: mounting /sys filesystem I: creating /{dev,run}/shm I: mounting /dev/pts filesystem I: redirecting /dev/ptmx to /dev/pts/ptmx I: policy-rc.d already exists I: using eatmydata during job I: Copying source file I: copying [bio-tradis_1.4.5+dfsg2-2.dsc] I: copying [./bio-tradis_1.4.5+dfsg2.orig.tar.xz] I: copying [./bio-tradis_1.4.5+dfsg2-2.debian.tar.xz] I: Extracting source dpkg-source: warning: cannot verify inline signature for ./bio-tradis_1.4.5+dfsg2-2.dsc: unsupported subcommand dpkg-source: info: extracting bio-tradis in bio-tradis-1.4.5+dfsg2 dpkg-source: info: unpacking bio-tradis_1.4.5+dfsg2.orig.tar.xz dpkg-source: info: unpacking bio-tradis_1.4.5+dfsg2-2.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying samtools1.10 I: Not using root during the build. I: Installing the build-deps I: user script /srv/workspace/pbuilder/120586/tmp/hooks/D02_print_environment starting I: set BUILDDIR='/build/reproducible-path' BUILDUSERGECOS='first user,first room,first work-phone,first home-phone,first other' BUILDUSERNAME='pbuilder1' BUILD_ARCH='i386' DEBIAN_FRONTEND='noninteractive' DEB_BUILD_OPTIONS='buildinfo=+all reproducible=+all parallel=22 ' DISTRIBUTION='trixie' HOME='/root' HOST_ARCH='i386' IFS=' ' INVOCATION_ID='79f8cd92fb534c8fad1959aa240798b5' LANG='C' LANGUAGE='en_US:en' LC_ALL='C' LD_LIBRARY_PATH='/usr/lib/libeatmydata' LD_PRELOAD='libeatmydata.so' MAIL='/var/mail/root' OPTIND='1' PATH='/usr/sbin:/usr/bin:/sbin:/bin:/usr/games' PBCURRENTCOMMANDLINEOPERATION='build' PBUILDER_OPERATION='build' PBUILDER_PKGDATADIR='/usr/share/pbuilder' PBUILDER_PKGLIBDIR='/usr/lib/pbuilder' PBUILDER_SYSCONFDIR='/etc' PPID='120586' PS1='# ' PS2='> ' PS4='+ ' PWD='/' SHELL='/bin/bash' SHLVL='2' SUDO_COMMAND='/usr/bin/timeout -k 18.1h 18h /usr/bin/ionice -c 3 /usr/bin/nice /usr/sbin/pbuilder --build --configfile /srv/reproducible-results/rbuild-debian/r-b-build.Q4b1tkO4/pbuilderrc_SgGE --distribution trixie --hookdir /etc/pbuilder/first-build-hooks --debbuildopts -b --basetgz /var/cache/pbuilder/trixie-reproducible-base.tgz --buildresult /srv/reproducible-results/rbuild-debian/r-b-build.Q4b1tkO4/b1 --logfile b1/build.log bio-tradis_1.4.5+dfsg2-2.dsc' SUDO_GID='112' SUDO_UID='107' SUDO_USER='jenkins' TERM='unknown' TZ='/usr/share/zoneinfo/Etc/GMT+12' USER='root' _='/usr/bin/systemd-run' http_proxy='http://213.165.73.152:3128' I: uname -a Linux ionos16-i386 6.1.0-31-amd64 #1 SMP PREEMPT_DYNAMIC Debian 6.1.128-1 (2025-02-07) x86_64 GNU/Linux I: ls -l /bin lrwxrwxrwx 1 root root 7 Nov 22 2024 /bin -> usr/bin I: user script /srv/workspace/pbuilder/120586/tmp/hooks/D02_print_environment finished -> Attempting to satisfy build-dependencies -> Creating pbuilder-satisfydepends-dummy package Package: pbuilder-satisfydepends-dummy Version: 0.invalid.0 Architecture: i386 Maintainer: Debian Pbuilder Team Description: Dummy package to satisfy dependencies with aptitude - created by pbuilder This package was created automatically by pbuilder to satisfy the build-dependencies of the package being currently built. Depends: debhelper-compat (= 13), libbio-perl-perl, libenv-path-perl, libexception-class-perl, libmoose-perl, libtest-exception-perl, libtest-files-perl, libtest-most-perl, libtest-simple-perl, libtext-csv-perl, libtry-tiny-perl, perl, samtools, smalt, tabix, bwa dpkg-deb: building package 'pbuilder-satisfydepends-dummy' in '/tmp/satisfydepends-aptitude/pbuilder-satisfydepends-dummy.deb'. Selecting previously unselected package pbuilder-satisfydepends-dummy. (Reading database ... 19789 files and directories currently installed.) Preparing to unpack .../pbuilder-satisfydepends-dummy.deb ... Unpacking pbuilder-satisfydepends-dummy (0.invalid.0) ... dpkg: pbuilder-satisfydepends-dummy: dependency problems, but configuring anyway as you requested: pbuilder-satisfydepends-dummy depends on debhelper-compat (= 13); however: Package debhelper-compat is not installed. pbuilder-satisfydepends-dummy depends on libbio-perl-perl; however: Package libbio-perl-perl is not installed. pbuilder-satisfydepends-dummy depends on libenv-path-perl; however: Package libenv-path-perl is not installed. pbuilder-satisfydepends-dummy depends on libexception-class-perl; however: Package libexception-class-perl is not installed. pbuilder-satisfydepends-dummy depends on libmoose-perl; however: Package libmoose-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-exception-perl; however: Package libtest-exception-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-files-perl; however: Package libtest-files-perl is not installed. pbuilder-satisfydepends-dummy depends on libtest-most-perl; however: Package libtest-most-perl is not installed. pbuilder-satisfydepends-dummy depends on libtext-csv-perl; however: Package libtext-csv-perl is not installed. pbuilder-satisfydepends-dummy depends on libtry-tiny-perl; however: Package libtry-tiny-perl is not installed. pbuilder-satisfydepends-dummy depends on samtools; however: Package samtools is not installed. pbuilder-satisfydepends-dummy depends on smalt; however: Package smalt is not installed. pbuilder-satisfydepends-dummy depends on tabix; however: Package tabix is not installed. pbuilder-satisfydepends-dummy depends on bwa; however: Package bwa is not installed. Setting up pbuilder-satisfydepends-dummy (0.invalid.0) ... Reading package lists... Building dependency tree... Reading state information... Initializing package states... Writing extended state information... Building tag database... pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) pbuilder-satisfydepends-dummy is already installed at the requested version (0.invalid.0) The following NEW packages will be installed: autoconf{a} automake{a} autopoint{a} autotools-dev{a} bsdextrautils{a} bwa{a} debhelper{a} dh-autoreconf{a} dh-strip-nondeterminism{a} dwz{a} file{a} gettext{a} gettext-base{a} groff-base{a} intltool-debian{a} libalgorithm-c3-perl{a} libalgorithm-diff-perl{a} libarchive-zip-perl{a} libb-hooks-op-check-perl{a} libbambamc0{a} libbio-perl-perl{a} libbrotli1{a} libcapture-tiny-perl{a} libclass-c3-perl{a} libclass-data-inheritable-perl{a} libclass-load-perl{a} libclass-load-xs-perl{a} libclass-xsaccessor-perl{a} libclone-perl{a} libcom-err2{a} libconst-fast-perl{a} libcurl3t64-gnutls{a} libdata-compare-perl{a} libdata-optlist-perl{a} libdata-stag-perl{a} libdebhelper-perl{a} libdeflate0{a} libdevel-callchecker-perl{a} libdevel-globaldestruction-perl{a} libdevel-overloadinfo-perl{a} libdevel-stacktrace-perl{a} libdist-checkconflicts-perl{a} libdynaloader-functions-perl{a} libelf1t64{a} libenv-path-perl{a} libeval-closure-perl{a} libexception-class-perl{a} libffi8{a} libfile-chdir-perl{a} libfile-find-rule-perl{a} libfile-stripnondeterminism-perl{a} libgnutls30t64{a} libgssapi-krb5-2{a} libhts3t64{a} libhtscodecs2{a} libicu72{a} libidn2-0{a} libio-string-perl{a} libk5crypto3{a} libkeyutils1{a} libkrb5-3{a} libkrb5support0{a} libldap2{a} libmagic-mgc{a} libmagic1t64{a} libmodule-implementation-perl{a} libmodule-runtime-conflicts-perl{a} libmodule-runtime-perl{a} libmoose-perl{a} libmro-compat-perl{a} libncurses6{a} libnghttp2-14{a} libnghttp3-9{a} libngtcp2-16{a} libngtcp2-crypto-gnutls8{a} libnumber-compare-perl{a} libp11-kit0{a} libpackage-deprecationmanager-perl{a} libpackage-stash-perl{a} libpackage-stash-xs-perl{a} libpadwalker-perl{a} libparams-classify-perl{a} libparams-util-perl{a} libpath-tiny-perl{a} libpipeline1{a} libpsl5t64{a} librtmp1{a} libsasl2-2{a} libsasl2-modules-db{a} libssh2-1t64{a} libsub-exporter-perl{a} libsub-exporter-progressive-perl{a} libsub-install-perl{a} libsub-uplevel-perl{a} libtasn1-6{a} libtest-deep-perl{a} libtest-differences-perl{a} libtest-exception-perl{a} libtest-files-perl{a} libtest-most-perl{a} libtest-warn-perl{a} libtest2-suite-perl{a} libtext-csv-perl{a} libtext-diff-perl{a} libtext-glob-perl{a} libtool{a} libtry-tiny-perl{a} libuchardet0{a} libunistring5{a} libxml2{a} m4{a} man-db{a} po-debconf{a} samtools{a} sensible-utils{a} smalt{a} tabix{a} The following packages are RECOMMENDED but will NOT be installed: bioperl-run ca-certificates curl krb5-locales libace-perl libalgorithm-diff-xs-perl libalgorithm-munkres-perl libarchive-cpio-perl libarray-compare-perl libbio-asn1-entrezgene-perl libbio-perl-run-perl libclass-c3-xs-perl libconvert-binary-c-perl libdbd-mysql-perl libdbd-pg-perl libdbd-sqlite3-perl libdevel-lexalias-perl libdevel-partialdump-perl libgd-perl libgpm2 libgraph-perl libgraphviz-perl libhtml-parser-perl libhtml-tableextract-perl libldap-common liblist-moreutils-perl libltdl-dev libmail-sendmail-perl libmldbm-perl libmodule-pluggable-perl libpostscript-perl libsasl2-modules libset-scalar-perl libsoap-lite-perl libsort-naturally-perl libspreadsheet-parseexcel-perl libspreadsheet-writeexcel-perl libsvg-graph-perl libsvg-perl libtext-csv-xs-perl libunicode-utf8-perl liburi-perl libwww-perl libxml-dom-xpath-perl libxml-libxml-perl libxml-libxslt-perl libxml-parser-perl libxml-perl libxml-sax-perl libxml-sax-writer-perl libxml-simple-perl libxml-twig-perl libxml-writer-perl lynx perl-tk publicsuffix wget 0 packages upgraded, 117 newly installed, 0 to remove and 0 not upgraded. Need to get 32.9 MB of archives. After unpacking 115 MB will be used. Writing extended state information... Get: 1 http://deb.debian.org/debian trixie/main i386 sensible-utils all 0.0.24 [24.8 kB] Get: 2 http://deb.debian.org/debian trixie/main i386 libmagic-mgc i386 1:5.45-3+b1 [314 kB] Get: 3 http://deb.debian.org/debian trixie/main i386 libmagic1t64 i386 1:5.45-3+b1 [115 kB] Get: 4 http://deb.debian.org/debian trixie/main i386 file i386 1:5.45-3+b1 [43.2 kB] Get: 5 http://deb.debian.org/debian trixie/main i386 gettext-base i386 0.23.1-1 [245 kB] Get: 6 http://deb.debian.org/debian trixie/main i386 libuchardet0 i386 0.0.8-1+b2 [69.2 kB] Get: 7 http://deb.debian.org/debian trixie/main i386 groff-base i386 1.23.0-7 [1199 kB] Get: 8 http://deb.debian.org/debian trixie/main i386 bsdextrautils i386 2.40.4-4 [96.4 kB] Get: 9 http://deb.debian.org/debian trixie/main i386 libpipeline1 i386 1.5.8-1 [41.2 kB] Get: 10 http://deb.debian.org/debian trixie/main i386 man-db i386 2.13.0-1 [1428 kB] Get: 11 http://deb.debian.org/debian trixie/main i386 m4 i386 1.4.19-5 [301 kB] Get: 12 http://deb.debian.org/debian trixie/main i386 autoconf all 2.72-3 [493 kB] Get: 13 http://deb.debian.org/debian trixie/main i386 autotools-dev all 20220109.1 [51.6 kB] Get: 14 http://deb.debian.org/debian trixie/main i386 automake all 1:1.17-3 [862 kB] Get: 15 http://deb.debian.org/debian trixie/main i386 autopoint all 0.23.1-1 [770 kB] Get: 16 http://deb.debian.org/debian trixie/main i386 bwa i386 0.7.18-1 [237 kB] Get: 17 http://deb.debian.org/debian trixie/main i386 libdebhelper-perl all 13.24.1 [90.9 kB] Get: 18 http://deb.debian.org/debian trixie/main i386 libtool all 2.5.4-3 [539 kB] Get: 19 http://deb.debian.org/debian trixie/main i386 dh-autoreconf all 20 [17.1 kB] Get: 20 http://deb.debian.org/debian trixie/main i386 libarchive-zip-perl all 1.68-1 [104 kB] Get: 21 http://deb.debian.org/debian trixie/main i386 libfile-stripnondeterminism-perl all 1.14.1-2 [19.7 kB] Get: 22 http://deb.debian.org/debian trixie/main i386 dh-strip-nondeterminism all 1.14.1-2 [8620 B] Get: 23 http://deb.debian.org/debian trixie/main i386 libelf1t64 i386 0.192-4 [195 kB] Get: 24 http://deb.debian.org/debian trixie/main i386 dwz i386 0.15-1+b1 [116 kB] Get: 25 http://deb.debian.org/debian trixie/main i386 libunistring5 i386 1.3-1 [458 kB] Get: 26 http://deb.debian.org/debian trixie/main i386 libicu72 i386 72.1-6 [9582 kB] Get: 27 http://deb.debian.org/debian trixie/main i386 libxml2 i386 2.12.7+dfsg+really2.9.14-0.2+b2 [734 kB] Get: 28 http://deb.debian.org/debian trixie/main i386 gettext i386 0.23.1-1 [1714 kB] Get: 29 http://deb.debian.org/debian trixie/main i386 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get: 30 http://deb.debian.org/debian trixie/main i386 po-debconf all 1.0.21+nmu1 [248 kB] Get: 31 http://deb.debian.org/debian trixie/main i386 debhelper all 13.24.1 [920 kB] Get: 32 http://deb.debian.org/debian trixie/main i386 libalgorithm-c3-perl all 0.11-2 [10.8 kB] Get: 33 http://deb.debian.org/debian trixie/main i386 libalgorithm-diff-perl all 1.201-1 [43.3 kB] Get: 34 http://deb.debian.org/debian trixie/main i386 libb-hooks-op-check-perl i386 0.22-3+b2 [10.7 kB] Get: 35 http://deb.debian.org/debian trixie/main i386 libbambamc0 i386 0.0.50-6+b2 [43.7 kB] Get: 36 http://deb.debian.org/debian trixie/main i386 libio-string-perl all 1.08-4 [12.1 kB] Get: 37 http://deb.debian.org/debian trixie/main i386 libdata-stag-perl all 0.14-3 [448 kB] Get: 38 http://deb.debian.org/debian trixie/main i386 libbio-perl-perl all 1.7.8-1 [2603 kB] Get: 39 http://deb.debian.org/debian trixie/main i386 libbrotli1 i386 1.1.0-2+b7 [299 kB] Get: 40 http://deb.debian.org/debian trixie/main i386 libcapture-tiny-perl all 0.50-1 [24.6 kB] Get: 41 http://deb.debian.org/debian trixie/main i386 libclass-c3-perl all 0.35-2 [21.0 kB] Get: 42 http://deb.debian.org/debian trixie/main i386 libclass-data-inheritable-perl all 0.10-1 [8632 B] Get: 43 http://deb.debian.org/debian trixie/main i386 libparams-util-perl i386 1.102-3+b1 [24.7 kB] Get: 44 http://deb.debian.org/debian trixie/main i386 libsub-install-perl all 0.929-1 [10.5 kB] Get: 45 http://deb.debian.org/debian trixie/main i386 libdata-optlist-perl all 0.114-1 [10.6 kB] Get: 46 http://deb.debian.org/debian trixie/main i386 libdynaloader-functions-perl all 0.004-1 [12.1 kB] Get: 47 http://deb.debian.org/debian trixie/main i386 libdevel-callchecker-perl i386 0.009-1+b1 [16.2 kB] Get: 48 http://deb.debian.org/debian trixie/main i386 libparams-classify-perl i386 0.015-2+b4 [23.1 kB] Get: 49 http://deb.debian.org/debian trixie/main i386 libmodule-runtime-perl all 0.016-2 [19.6 kB] Get: 50 http://deb.debian.org/debian trixie/main i386 libtry-tiny-perl all 0.32-1 [22.9 kB] Get: 51 http://deb.debian.org/debian trixie/main i386 libmodule-implementation-perl all 0.09-2 [12.6 kB] Get: 52 http://deb.debian.org/debian trixie/main i386 libpackage-stash-perl all 0.40-1 [22.0 kB] Get: 53 http://deb.debian.org/debian trixie/main i386 libclass-load-perl all 0.25-2 [15.3 kB] Get: 54 http://deb.debian.org/debian trixie/main i386 libclass-load-xs-perl i386 0.10-2+b4 [14.3 kB] Get: 55 http://deb.debian.org/debian trixie/main i386 libclass-xsaccessor-perl i386 1.19-4+b5 [37.4 kB] Get: 56 http://deb.debian.org/debian trixie/main i386 libclone-perl i386 0.47-1+b1 [14.0 kB] Get: 57 http://deb.debian.org/debian trixie/main i386 libcom-err2 i386 1.47.2-1 [24.3 kB] Get: 58 http://deb.debian.org/debian trixie/main i386 libsub-exporter-perl all 0.990-1 [50.6 kB] Get: 59 http://deb.debian.org/debian trixie/main i386 libsub-exporter-progressive-perl all 0.001013-3 [7496 B] Get: 60 http://deb.debian.org/debian trixie/main i386 libconst-fast-perl all 0.014-2 [8792 B] Get: 61 http://deb.debian.org/debian trixie/main i386 libidn2-0 i386 2.3.7-2+b1 [130 kB] Get: 62 http://deb.debian.org/debian trixie/main i386 libffi8 i386 3.4.7-1 [21.4 kB] Get: 63 http://deb.debian.org/debian trixie/main i386 libp11-kit0 i386 0.25.5-3 [423 kB] Get: 64 http://deb.debian.org/debian trixie/main i386 libtasn1-6 i386 4.20.0-2 [51.6 kB] Get: 65 http://deb.debian.org/debian trixie/main i386 libgnutls30t64 i386 3.8.9-2 [1462 kB] Get: 66 http://deb.debian.org/debian trixie/main i386 libkrb5support0 i386 1.21.3-4 [35.0 kB] Get: 67 http://deb.debian.org/debian trixie/main i386 libk5crypto3 i386 1.21.3-4 [83.7 kB] Get: 68 http://deb.debian.org/debian trixie/main i386 libkeyutils1 i386 1.6.3-4 [9600 B] Get: 69 http://deb.debian.org/debian trixie/main i386 libkrb5-3 i386 1.21.3-4 [354 kB] Get: 70 http://deb.debian.org/debian trixie/main i386 libgssapi-krb5-2 i386 1.21.3-4 [149 kB] Get: 71 http://deb.debian.org/debian trixie/main i386 libsasl2-modules-db i386 2.1.28+dfsg1-8+b1 [20.9 kB] Get: 72 http://deb.debian.org/debian trixie/main i386 libsasl2-2 i386 2.1.28+dfsg1-8+b1 [61.3 kB] Get: 73 http://deb.debian.org/debian trixie/main i386 libldap2 i386 2.6.9+dfsg-1 [205 kB] Get: 74 http://deb.debian.org/debian trixie/main i386 libnghttp2-14 i386 1.64.0-1 [82.4 kB] Get: 75 http://deb.debian.org/debian trixie/main i386 libnghttp3-9 i386 1.6.0-2 [75.9 kB] Get: 76 http://deb.debian.org/debian trixie/main i386 libngtcp2-16 i386 1.9.1-1 [151 kB] Get: 77 http://deb.debian.org/debian trixie/main i386 libngtcp2-crypto-gnutls8 i386 1.9.1-1 [19.1 kB] Get: 78 http://deb.debian.org/debian trixie/main i386 libpsl5t64 i386 0.21.2-1.1+b1 [57.7 kB] Get: 79 http://deb.debian.org/debian trixie/main i386 librtmp1 i386 2.4+20151223.gitfa8646d.1-2+b5 [62.4 kB] Get: 80 http://deb.debian.org/debian trixie/main i386 libssh2-1t64 i386 1.11.1-1 [256 kB] Get: 81 http://deb.debian.org/debian trixie/main i386 libcurl3t64-gnutls i386 8.12.1-2 [411 kB] Get: 82 http://deb.debian.org/debian trixie/main i386 libnumber-compare-perl all 0.03-3 [6332 B] Get: 83 http://deb.debian.org/debian trixie/main i386 libtext-glob-perl all 0.11-3 [7676 B] Get: 84 http://deb.debian.org/debian trixie/main i386 libfile-find-rule-perl all 0.34-3 [26.6 kB] Get: 85 http://deb.debian.org/debian trixie/main i386 libdata-compare-perl all 1.29-1 [19.6 kB] Get: 86 http://deb.debian.org/debian trixie/main i386 libdeflate0 i386 1.23-1+b1 [48.4 kB] Get: 87 http://deb.debian.org/debian trixie/main i386 libdevel-globaldestruction-perl all 0.14-4 [7144 B] Get: 88 http://deb.debian.org/debian trixie/main i386 libmro-compat-perl all 0.15-2 [11.8 kB] Get: 89 http://deb.debian.org/debian trixie/main i386 libdevel-overloadinfo-perl all 0.007-1 [7896 B] Get: 90 http://deb.debian.org/debian trixie/main i386 libdevel-stacktrace-perl all 2.0500-1 [26.4 kB] Get: 91 http://deb.debian.org/debian trixie/main i386 libdist-checkconflicts-perl all 0.11-2 [10.5 kB] Get: 92 http://deb.debian.org/debian trixie/main i386 libenv-path-perl all 0.19-4 [19.1 kB] Get: 93 http://deb.debian.org/debian trixie/main i386 libeval-closure-perl all 0.14-3 [11.2 kB] Get: 94 http://deb.debian.org/debian trixie/main i386 libexception-class-perl all 1.45-1 [34.6 kB] Get: 95 http://deb.debian.org/debian trixie/main i386 libfile-chdir-perl all 0.1008-1.2 [11.9 kB] Get: 96 http://deb.debian.org/debian trixie/main i386 libhtscodecs2 i386 1.6.1-2 [70.9 kB] Get: 97 http://deb.debian.org/debian trixie/main i386 libhts3t64 i386 1.21+ds-1 [506 kB] Get: 98 http://deb.debian.org/debian trixie/main i386 libmodule-runtime-conflicts-perl all 0.003-2 [7356 B] Get: 99 http://deb.debian.org/debian trixie/main i386 libpackage-deprecationmanager-perl all 0.18-1 [17.6 kB] Get: 100 http://deb.debian.org/debian trixie/main i386 libpackage-stash-xs-perl i386 0.30-1+b4 [21.2 kB] Get: 101 http://deb.debian.org/debian trixie/main i386 libmoose-perl i386 2.2207-1+b3 [767 kB] Get: 102 http://deb.debian.org/debian trixie/main i386 libncurses6 i386 6.5+20250216-1 [112 kB] Get: 103 http://deb.debian.org/debian trixie/main i386 libpadwalker-perl i386 2.5-1+b6 [19.1 kB] Get: 104 http://deb.debian.org/debian trixie/main i386 libpath-tiny-perl all 0.146-1 [56.2 kB] Get: 105 http://deb.debian.org/debian trixie/main i386 libsub-uplevel-perl all 0.2800-3 [14.0 kB] Get: 106 http://deb.debian.org/debian trixie/main i386 libtest-deep-perl all 1.204-1 [52.9 kB] Get: 107 http://deb.debian.org/debian trixie/main i386 libtext-diff-perl all 1.45-2 [27.2 kB] Get: 108 http://deb.debian.org/debian trixie/main i386 libtest-differences-perl all 0.71-1 [17.9 kB] Get: 109 http://deb.debian.org/debian trixie/main i386 libtest-exception-perl all 0.43-3 [16.9 kB] Get: 110 http://deb.debian.org/debian trixie/main i386 libtest2-suite-perl all 0.000163-1 [383 kB] Get: 111 http://deb.debian.org/debian trixie/main i386 libtest-files-perl all 0.26-1 [21.6 kB] Get: 112 http://deb.debian.org/debian trixie/main i386 libtest-warn-perl all 0.37-2 [14.5 kB] Get: 113 http://deb.debian.org/debian trixie/main i386 libtest-most-perl all 0.38-1 [25.1 kB] Get: 114 http://deb.debian.org/debian trixie/main i386 libtext-csv-perl all 2.05-1 [115 kB] Get: 115 http://deb.debian.org/debian trixie/main i386 samtools i386 1.21-1 [700 kB] Get: 116 http://deb.debian.org/debian trixie/main i386 smalt i386 0.7.6-13 [127 kB] Get: 117 http://deb.debian.org/debian trixie/main i386 tabix i386 1.21+ds-1 [541 kB] Fetched 32.9 MB in 1s (35.2 MB/s) Preconfiguring packages ... Selecting previously unselected package sensible-utils. (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 19789 files and directories currently installed.) Preparing to unpack .../000-sensible-utils_0.0.24_all.deb ... Unpacking sensible-utils (0.0.24) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../001-libmagic-mgc_1%3a5.45-3+b1_i386.deb ... Unpacking libmagic-mgc (1:5.45-3+b1) ... Selecting previously unselected package libmagic1t64:i386. Preparing to unpack .../002-libmagic1t64_1%3a5.45-3+b1_i386.deb ... Unpacking libmagic1t64:i386 (1:5.45-3+b1) ... Selecting previously unselected package file. Preparing to unpack .../003-file_1%3a5.45-3+b1_i386.deb ... Unpacking file (1:5.45-3+b1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../004-gettext-base_0.23.1-1_i386.deb ... Unpacking gettext-base (0.23.1-1) ... Selecting previously unselected package libuchardet0:i386. Preparing to unpack .../005-libuchardet0_0.0.8-1+b2_i386.deb ... Unpacking libuchardet0:i386 (0.0.8-1+b2) ... Selecting previously unselected package groff-base. Preparing to unpack .../006-groff-base_1.23.0-7_i386.deb ... Unpacking groff-base (1.23.0-7) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../007-bsdextrautils_2.40.4-4_i386.deb ... Unpacking bsdextrautils (2.40.4-4) ... Selecting previously unselected package libpipeline1:i386. Preparing to unpack .../008-libpipeline1_1.5.8-1_i386.deb ... Unpacking libpipeline1:i386 (1.5.8-1) ... Selecting previously unselected package man-db. Preparing to unpack .../009-man-db_2.13.0-1_i386.deb ... Unpacking man-db (2.13.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../010-m4_1.4.19-5_i386.deb ... Unpacking m4 (1.4.19-5) ... Selecting previously unselected package autoconf. Preparing to unpack .../011-autoconf_2.72-3_all.deb ... Unpacking autoconf (2.72-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../012-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../013-automake_1%3a1.17-3_all.deb ... Unpacking automake (1:1.17-3) ... Selecting previously unselected package autopoint. Preparing to unpack .../014-autopoint_0.23.1-1_all.deb ... Unpacking autopoint (0.23.1-1) ... Selecting previously unselected package bwa. Preparing to unpack .../015-bwa_0.7.18-1_i386.deb ... Unpacking bwa (0.7.18-1) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../016-libdebhelper-perl_13.24.1_all.deb ... Unpacking libdebhelper-perl (13.24.1) ... Selecting previously unselected package libtool. Preparing to unpack .../017-libtool_2.5.4-3_all.deb ... Unpacking libtool (2.5.4-3) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../018-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../019-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../020-libfile-stripnondeterminism-perl_1.14.1-2_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.14.1-2) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../021-dh-strip-nondeterminism_1.14.1-2_all.deb ... Unpacking dh-strip-nondeterminism (1.14.1-2) ... Selecting previously unselected package libelf1t64:i386. Preparing to unpack .../022-libelf1t64_0.192-4_i386.deb ... Unpacking libelf1t64:i386 (0.192-4) ... Selecting previously unselected package dwz. Preparing to unpack .../023-dwz_0.15-1+b1_i386.deb ... Unpacking dwz (0.15-1+b1) ... Selecting previously unselected package libunistring5:i386. Preparing to unpack .../024-libunistring5_1.3-1_i386.deb ... Unpacking libunistring5:i386 (1.3-1) ... Selecting previously unselected package libicu72:i386. Preparing to unpack .../025-libicu72_72.1-6_i386.deb ... Unpacking libicu72:i386 (72.1-6) ... Selecting previously unselected package libxml2:i386. Preparing to unpack .../026-libxml2_2.12.7+dfsg+really2.9.14-0.2+b2_i386.deb ... Unpacking libxml2:i386 (2.12.7+dfsg+really2.9.14-0.2+b2) ... Selecting previously unselected package gettext. Preparing to unpack .../027-gettext_0.23.1-1_i386.deb ... Unpacking gettext (0.23.1-1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../028-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../029-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../030-debhelper_13.24.1_all.deb ... Unpacking debhelper (13.24.1) ... Selecting previously unselected package libalgorithm-c3-perl. Preparing to unpack .../031-libalgorithm-c3-perl_0.11-2_all.deb ... Unpacking libalgorithm-c3-perl (0.11-2) ... Selecting previously unselected package libalgorithm-diff-perl. Preparing to unpack .../032-libalgorithm-diff-perl_1.201-1_all.deb ... Unpacking libalgorithm-diff-perl (1.201-1) ... Selecting previously unselected package libb-hooks-op-check-perl:i386. Preparing to unpack .../033-libb-hooks-op-check-perl_0.22-3+b2_i386.deb ... Unpacking libb-hooks-op-check-perl:i386 (0.22-3+b2) ... Selecting previously unselected package libbambamc0:i386. Preparing to unpack .../034-libbambamc0_0.0.50-6+b2_i386.deb ... Unpacking libbambamc0:i386 (0.0.50-6+b2) ... Selecting previously unselected package libio-string-perl. Preparing to unpack .../035-libio-string-perl_1.08-4_all.deb ... Unpacking libio-string-perl (1.08-4) ... Selecting previously unselected package libdata-stag-perl. Preparing to unpack .../036-libdata-stag-perl_0.14-3_all.deb ... Unpacking libdata-stag-perl (0.14-3) ... Selecting previously unselected package libbio-perl-perl. Preparing to unpack .../037-libbio-perl-perl_1.7.8-1_all.deb ... Unpacking libbio-perl-perl (1.7.8-1) ... Selecting previously unselected package libbrotli1:i386. Preparing to unpack .../038-libbrotli1_1.1.0-2+b7_i386.deb ... Unpacking libbrotli1:i386 (1.1.0-2+b7) ... Selecting previously unselected package libcapture-tiny-perl. Preparing to unpack .../039-libcapture-tiny-perl_0.50-1_all.deb ... Unpacking libcapture-tiny-perl (0.50-1) ... Selecting previously unselected package libclass-c3-perl. Preparing to unpack .../040-libclass-c3-perl_0.35-2_all.deb ... Unpacking libclass-c3-perl (0.35-2) ... Selecting previously unselected package libclass-data-inheritable-perl. Preparing to unpack .../041-libclass-data-inheritable-perl_0.10-1_all.deb ... Unpacking libclass-data-inheritable-perl (0.10-1) ... Selecting previously unselected package libparams-util-perl. Preparing to unpack .../042-libparams-util-perl_1.102-3+b1_i386.deb ... Unpacking libparams-util-perl (1.102-3+b1) ... Selecting previously unselected package libsub-install-perl. Preparing to unpack .../043-libsub-install-perl_0.929-1_all.deb ... Unpacking libsub-install-perl (0.929-1) ... Selecting previously unselected package libdata-optlist-perl. Preparing to unpack .../044-libdata-optlist-perl_0.114-1_all.deb ... Unpacking libdata-optlist-perl (0.114-1) ... Selecting previously unselected package libdynaloader-functions-perl. Preparing to unpack .../045-libdynaloader-functions-perl_0.004-1_all.deb ... Unpacking libdynaloader-functions-perl (0.004-1) ... Selecting previously unselected package libdevel-callchecker-perl:i386. Preparing to unpack .../046-libdevel-callchecker-perl_0.009-1+b1_i386.deb ... Unpacking libdevel-callchecker-perl:i386 (0.009-1+b1) ... Selecting previously unselected package libparams-classify-perl:i386. Preparing to unpack .../047-libparams-classify-perl_0.015-2+b4_i386.deb ... Unpacking libparams-classify-perl:i386 (0.015-2+b4) ... Selecting previously unselected package libmodule-runtime-perl. Preparing to unpack .../048-libmodule-runtime-perl_0.016-2_all.deb ... Unpacking libmodule-runtime-perl (0.016-2) ... Selecting previously unselected package libtry-tiny-perl. Preparing to unpack .../049-libtry-tiny-perl_0.32-1_all.deb ... Unpacking libtry-tiny-perl (0.32-1) ... Selecting previously unselected package libmodule-implementation-perl. Preparing to unpack .../050-libmodule-implementation-perl_0.09-2_all.deb ... Unpacking libmodule-implementation-perl (0.09-2) ... Selecting previously unselected package libpackage-stash-perl. Preparing to unpack .../051-libpackage-stash-perl_0.40-1_all.deb ... Unpacking libpackage-stash-perl (0.40-1) ... Selecting previously unselected package libclass-load-perl. Preparing to unpack .../052-libclass-load-perl_0.25-2_all.deb ... Unpacking libclass-load-perl (0.25-2) ... Selecting previously unselected package libclass-load-xs-perl. Preparing to unpack .../053-libclass-load-xs-perl_0.10-2+b4_i386.deb ... Unpacking libclass-load-xs-perl (0.10-2+b4) ... Selecting previously unselected package libclass-xsaccessor-perl. Preparing to unpack .../054-libclass-xsaccessor-perl_1.19-4+b5_i386.deb ... Unpacking libclass-xsaccessor-perl (1.19-4+b5) ... Selecting previously unselected package libclone-perl:i386. Preparing to unpack .../055-libclone-perl_0.47-1+b1_i386.deb ... Unpacking libclone-perl:i386 (0.47-1+b1) ... Selecting previously unselected package libcom-err2:i386. Preparing to unpack .../056-libcom-err2_1.47.2-1_i386.deb ... Unpacking libcom-err2:i386 (1.47.2-1) ... Selecting previously unselected package libsub-exporter-perl. Preparing to unpack .../057-libsub-exporter-perl_0.990-1_all.deb ... Unpacking libsub-exporter-perl (0.990-1) ... Selecting previously unselected package libsub-exporter-progressive-perl. Preparing to unpack .../058-libsub-exporter-progressive-perl_0.001013-3_all.deb ... Unpacking libsub-exporter-progressive-perl (0.001013-3) ... Selecting previously unselected package libconst-fast-perl. Preparing to unpack .../059-libconst-fast-perl_0.014-2_all.deb ... Unpacking libconst-fast-perl (0.014-2) ... Selecting previously unselected package libidn2-0:i386. Preparing to unpack .../060-libidn2-0_2.3.7-2+b1_i386.deb ... Unpacking libidn2-0:i386 (2.3.7-2+b1) ... Selecting previously unselected package libffi8:i386. Preparing to unpack .../061-libffi8_3.4.7-1_i386.deb ... Unpacking libffi8:i386 (3.4.7-1) ... Selecting previously unselected package libp11-kit0:i386. Preparing to unpack .../062-libp11-kit0_0.25.5-3_i386.deb ... Unpacking libp11-kit0:i386 (0.25.5-3) ... Selecting previously unselected package libtasn1-6:i386. Preparing to unpack .../063-libtasn1-6_4.20.0-2_i386.deb ... Unpacking libtasn1-6:i386 (4.20.0-2) ... Selecting previously unselected package libgnutls30t64:i386. Preparing to unpack .../064-libgnutls30t64_3.8.9-2_i386.deb ... Unpacking libgnutls30t64:i386 (3.8.9-2) ... Selecting previously unselected package libkrb5support0:i386. Preparing to unpack .../065-libkrb5support0_1.21.3-4_i386.deb ... Unpacking libkrb5support0:i386 (1.21.3-4) ... Selecting previously unselected package libk5crypto3:i386. Preparing to unpack .../066-libk5crypto3_1.21.3-4_i386.deb ... Unpacking libk5crypto3:i386 (1.21.3-4) ... Selecting previously unselected package libkeyutils1:i386. Preparing to unpack .../067-libkeyutils1_1.6.3-4_i386.deb ... Unpacking libkeyutils1:i386 (1.6.3-4) ... Selecting previously unselected package libkrb5-3:i386. Preparing to unpack .../068-libkrb5-3_1.21.3-4_i386.deb ... Unpacking libkrb5-3:i386 (1.21.3-4) ... Selecting previously unselected package libgssapi-krb5-2:i386. Preparing to unpack .../069-libgssapi-krb5-2_1.21.3-4_i386.deb ... Unpacking libgssapi-krb5-2:i386 (1.21.3-4) ... Selecting previously unselected package libsasl2-modules-db:i386. Preparing to unpack .../070-libsasl2-modules-db_2.1.28+dfsg1-8+b1_i386.deb ... Unpacking libsasl2-modules-db:i386 (2.1.28+dfsg1-8+b1) ... Selecting previously unselected package libsasl2-2:i386. Preparing to unpack .../071-libsasl2-2_2.1.28+dfsg1-8+b1_i386.deb ... Unpacking libsasl2-2:i386 (2.1.28+dfsg1-8+b1) ... Selecting previously unselected package libldap2:i386. Preparing to unpack .../072-libldap2_2.6.9+dfsg-1_i386.deb ... Unpacking libldap2:i386 (2.6.9+dfsg-1) ... Selecting previously unselected package libnghttp2-14:i386. Preparing to unpack .../073-libnghttp2-14_1.64.0-1_i386.deb ... Unpacking libnghttp2-14:i386 (1.64.0-1) ... Selecting previously unselected package libnghttp3-9:i386. Preparing to unpack .../074-libnghttp3-9_1.6.0-2_i386.deb ... Unpacking libnghttp3-9:i386 (1.6.0-2) ... Selecting previously unselected package libngtcp2-16:i386. Preparing to unpack .../075-libngtcp2-16_1.9.1-1_i386.deb ... Unpacking libngtcp2-16:i386 (1.9.1-1) ... Selecting previously unselected package libngtcp2-crypto-gnutls8:i386. Preparing to unpack .../076-libngtcp2-crypto-gnutls8_1.9.1-1_i386.deb ... Unpacking libngtcp2-crypto-gnutls8:i386 (1.9.1-1) ... Selecting previously unselected package libpsl5t64:i386. Preparing to unpack .../077-libpsl5t64_0.21.2-1.1+b1_i386.deb ... Unpacking libpsl5t64:i386 (0.21.2-1.1+b1) ... Selecting previously unselected package librtmp1:i386. Preparing to unpack .../078-librtmp1_2.4+20151223.gitfa8646d.1-2+b5_i386.deb ... Unpacking librtmp1:i386 (2.4+20151223.gitfa8646d.1-2+b5) ... Selecting previously unselected package libssh2-1t64:i386. Preparing to unpack .../079-libssh2-1t64_1.11.1-1_i386.deb ... Unpacking libssh2-1t64:i386 (1.11.1-1) ... Selecting previously unselected package libcurl3t64-gnutls:i386. Preparing to unpack .../080-libcurl3t64-gnutls_8.12.1-2_i386.deb ... Unpacking libcurl3t64-gnutls:i386 (8.12.1-2) ... Selecting previously unselected package libnumber-compare-perl. Preparing to unpack .../081-libnumber-compare-perl_0.03-3_all.deb ... Unpacking libnumber-compare-perl (0.03-3) ... Selecting previously unselected package libtext-glob-perl. Preparing to unpack .../082-libtext-glob-perl_0.11-3_all.deb ... Unpacking libtext-glob-perl (0.11-3) ... Selecting previously unselected package libfile-find-rule-perl. Preparing to unpack .../083-libfile-find-rule-perl_0.34-3_all.deb ... Unpacking libfile-find-rule-perl (0.34-3) ... Selecting previously unselected package libdata-compare-perl. Preparing to unpack .../084-libdata-compare-perl_1.29-1_all.deb ... Unpacking libdata-compare-perl (1.29-1) ... Selecting previously unselected package libdeflate0:i386. Preparing to unpack .../085-libdeflate0_1.23-1+b1_i386.deb ... Unpacking libdeflate0:i386 (1.23-1+b1) ... Selecting previously unselected package libdevel-globaldestruction-perl. Preparing to unpack .../086-libdevel-globaldestruction-perl_0.14-4_all.deb ... Unpacking libdevel-globaldestruction-perl (0.14-4) ... Selecting previously unselected package libmro-compat-perl. Preparing to unpack .../087-libmro-compat-perl_0.15-2_all.deb ... Unpacking libmro-compat-perl (0.15-2) ... Selecting previously unselected package libdevel-overloadinfo-perl. Preparing to unpack .../088-libdevel-overloadinfo-perl_0.007-1_all.deb ... Unpacking libdevel-overloadinfo-perl (0.007-1) ... Selecting previously unselected package libdevel-stacktrace-perl. Preparing to unpack .../089-libdevel-stacktrace-perl_2.0500-1_all.deb ... Unpacking libdevel-stacktrace-perl (2.0500-1) ... Selecting previously unselected package libdist-checkconflicts-perl. Preparing to unpack .../090-libdist-checkconflicts-perl_0.11-2_all.deb ... Unpacking libdist-checkconflicts-perl (0.11-2) ... Selecting previously unselected package libenv-path-perl. Preparing to unpack .../091-libenv-path-perl_0.19-4_all.deb ... Unpacking libenv-path-perl (0.19-4) ... Selecting previously unselected package libeval-closure-perl. Preparing to unpack .../092-libeval-closure-perl_0.14-3_all.deb ... Unpacking libeval-closure-perl (0.14-3) ... Selecting previously unselected package libexception-class-perl. Preparing to unpack .../093-libexception-class-perl_1.45-1_all.deb ... Unpacking libexception-class-perl (1.45-1) ... Selecting previously unselected package libfile-chdir-perl. Preparing to unpack .../094-libfile-chdir-perl_0.1008-1.2_all.deb ... Unpacking libfile-chdir-perl (0.1008-1.2) ... Selecting previously unselected package libhtscodecs2:i386. Preparing to unpack .../095-libhtscodecs2_1.6.1-2_i386.deb ... Unpacking libhtscodecs2:i386 (1.6.1-2) ... Selecting previously unselected package libhts3t64:i386. Preparing to unpack .../096-libhts3t64_1.21+ds-1_i386.deb ... Unpacking libhts3t64:i386 (1.21+ds-1) ... Selecting previously unselected package libmodule-runtime-conflicts-perl. Preparing to unpack .../097-libmodule-runtime-conflicts-perl_0.003-2_all.deb ... Unpacking libmodule-runtime-conflicts-perl (0.003-2) ... Selecting previously unselected package libpackage-deprecationmanager-perl. Preparing to unpack .../098-libpackage-deprecationmanager-perl_0.18-1_all.deb ... Unpacking libpackage-deprecationmanager-perl (0.18-1) ... Selecting previously unselected package libpackage-stash-xs-perl:i386. Preparing to unpack .../099-libpackage-stash-xs-perl_0.30-1+b4_i386.deb ... Unpacking libpackage-stash-xs-perl:i386 (0.30-1+b4) ... Selecting previously unselected package libmoose-perl:i386. Preparing to unpack .../100-libmoose-perl_2.2207-1+b3_i386.deb ... Unpacking libmoose-perl:i386 (2.2207-1+b3) ... Selecting previously unselected package libncurses6:i386. Preparing to unpack .../101-libncurses6_6.5+20250216-1_i386.deb ... Unpacking libncurses6:i386 (6.5+20250216-1) ... Selecting previously unselected package libpadwalker-perl. Preparing to unpack .../102-libpadwalker-perl_2.5-1+b6_i386.deb ... Unpacking libpadwalker-perl (2.5-1+b6) ... Selecting previously unselected package libpath-tiny-perl. Preparing to unpack .../103-libpath-tiny-perl_0.146-1_all.deb ... Unpacking libpath-tiny-perl (0.146-1) ... Selecting previously unselected package libsub-uplevel-perl. Preparing to unpack .../104-libsub-uplevel-perl_0.2800-3_all.deb ... Unpacking libsub-uplevel-perl (0.2800-3) ... Selecting previously unselected package libtest-deep-perl. Preparing to unpack .../105-libtest-deep-perl_1.204-1_all.deb ... Unpacking libtest-deep-perl (1.204-1) ... Selecting previously unselected package libtext-diff-perl. Preparing to unpack .../106-libtext-diff-perl_1.45-2_all.deb ... Unpacking libtext-diff-perl (1.45-2) ... Selecting previously unselected package libtest-differences-perl. Preparing to unpack .../107-libtest-differences-perl_0.71-1_all.deb ... Unpacking libtest-differences-perl (0.71-1) ... Selecting previously unselected package libtest-exception-perl. Preparing to unpack .../108-libtest-exception-perl_0.43-3_all.deb ... Unpacking libtest-exception-perl (0.43-3) ... Selecting previously unselected package libtest2-suite-perl. Preparing to unpack .../109-libtest2-suite-perl_0.000163-1_all.deb ... Unpacking libtest2-suite-perl (0.000163-1) ... Selecting previously unselected package libtest-files-perl. Preparing to unpack .../110-libtest-files-perl_0.26-1_all.deb ... Unpacking libtest-files-perl (0.26-1) ... Selecting previously unselected package libtest-warn-perl. Preparing to unpack .../111-libtest-warn-perl_0.37-2_all.deb ... Unpacking libtest-warn-perl (0.37-2) ... Selecting previously unselected package libtest-most-perl. Preparing to unpack .../112-libtest-most-perl_0.38-1_all.deb ... Unpacking libtest-most-perl (0.38-1) ... Selecting previously unselected package libtext-csv-perl. Preparing to unpack .../113-libtext-csv-perl_2.05-1_all.deb ... Unpacking libtext-csv-perl (2.05-1) ... Selecting previously unselected package samtools. Preparing to unpack .../114-samtools_1.21-1_i386.deb ... Unpacking samtools (1.21-1) ... Selecting previously unselected package smalt. Preparing to unpack .../115-smalt_0.7.6-13_i386.deb ... Unpacking smalt (0.7.6-13) ... Selecting previously unselected package tabix. Preparing to unpack .../116-tabix_1.21+ds-1_i386.deb ... Unpacking tabix (1.21+ds-1) ... Setting up libhtscodecs2:i386 (1.6.1-2) ... Setting up libpipeline1:i386 (1.5.8-1) ... Setting up libkeyutils1:i386 (1.6.3-4) ... Setting up libicu72:i386 (72.1-6) ... Setting up bsdextrautils (2.40.4-4) ... Setting up libdynaloader-functions-perl (0.004-1) ... Setting up libtext-glob-perl (0.11-3) ... Setting up libtest-deep-perl (1.204-1) ... Setting up libmagic-mgc (1:5.45-3+b1) ... Setting up libclone-perl:i386 (0.47-1+b1) ... Setting up libalgorithm-diff-perl (1.201-1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up bwa (0.7.18-1) ... Setting up libdebhelper-perl (13.24.1) ... Setting up libbrotli1:i386 (1.1.0-2+b7) ... Setting up libmagic1t64:i386 (1:5.45-3+b1) ... Setting up libtry-tiny-perl (0.32-1) ... Setting up libnghttp2-14:i386 (1.64.0-1) ... Setting up libdeflate0:i386 (1.23-1+b1) ... Setting up gettext-base (0.23.1-1) ... Setting up m4 (1.4.19-5) ... Setting up libpadwalker-perl (2.5-1+b6) ... Setting up libcom-err2:i386 (1.47.2-1) ... Setting up file (1:5.45-3+b1) ... Setting up libsub-install-perl (0.929-1) ... Setting up libelf1t64:i386 (0.192-4) ... Setting up libtest2-suite-perl (0.000163-1) ... Setting up libkrb5support0:i386 (1.21.3-4) ... Setting up libnumber-compare-perl (0.03-3) ... Setting up libsasl2-modules-db:i386 (2.1.28+dfsg1-8+b1) ... Setting up libio-string-perl (1.08-4) ... Setting up libpackage-stash-xs-perl:i386 (0.30-1+b4) ... Setting up autotools-dev (20220109.1) ... Setting up libclass-data-inheritable-perl (0.10-1) ... Setting up libalgorithm-c3-perl (0.11-2) ... Setting up libtext-diff-perl (1.45-2) ... Setting up libfile-find-rule-perl (0.34-3) ... Setting up libncurses6:i386 (6.5+20250216-1) ... Setting up libenv-path-perl (0.19-4) ... Setting up libunistring5:i386 (1.3-1) ... Setting up libbambamc0:i386 (0.0.50-6+b2) ... Setting up autopoint (0.23.1-1) ... Setting up libb-hooks-op-check-perl:i386 (0.22-3+b2) ... Setting up libk5crypto3:i386 (1.21.3-4) ... Setting up libparams-util-perl (1.102-3+b1) ... Setting up libsasl2-2:i386 (2.1.28+dfsg1-8+b1) ... Setting up autoconf (2.72-3) ... Setting up libnghttp3-9:i386 (1.6.0-2) ... Setting up libsub-exporter-progressive-perl (0.001013-3) ... Setting up libcapture-tiny-perl (0.50-1) ... Setting up libffi8:i386 (3.4.7-1) ... Setting up dwz (0.15-1+b1) ... Setting up libdata-stag-perl (0.14-3) ... Setting up libfile-chdir-perl (0.1008-1.2) ... Setting up sensible-utils (0.0.24) ... Setting up libpath-tiny-perl (0.146-1) ... Setting up libuchardet0:i386 (0.0.8-1+b2) ... Setting up libtasn1-6:i386 (4.20.0-2) ... Setting up libsub-uplevel-perl (0.2800-3) ... Setting up libdevel-globaldestruction-perl (0.14-4) ... Setting up libngtcp2-16:i386 (1.9.1-1) ... Setting up libdevel-stacktrace-perl (2.0500-1) ... Setting up libclass-xsaccessor-perl (1.19-4+b5) ... Setting up libkrb5-3:i386 (1.21.3-4) ... Setting up libbio-perl-perl (1.7.8-1) ... Setting up libssh2-1t64:i386 (1.11.1-1) ... Setting up tabix (1.21+ds-1) ... Setting up libxml2:i386 (2.12.7+dfsg+really2.9.14-0.2+b2) ... Setting up libldap2:i386 (2.6.9+dfsg-1) ... Setting up libtext-csv-perl (2.05-1) ... Setting up automake (1:1.17-3) ... update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.14.1-2) ... Setting up smalt (0.7.6-13) ... Setting up gettext (0.23.1-1) ... Setting up libtool (2.5.4-3) ... Setting up libtest-warn-perl (0.37-2) ... Setting up libtest-differences-perl (0.71-1) ... Setting up libidn2-0:i386 (2.3.7-2+b1) ... Setting up libexception-class-perl (1.45-1) ... Setting up libclass-c3-perl (0.35-2) ... Setting up libdevel-callchecker-perl:i386 (0.009-1+b1) ... Setting up libdata-compare-perl (1.29-1) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up libtest-exception-perl (0.43-3) ... Setting up libp11-kit0:i386 (0.25.5-3) ... Setting up libgssapi-krb5-2:i386 (1.21.3-4) ... Setting up libdata-optlist-perl (0.114-1) ... Setting up dh-strip-nondeterminism (1.14.1-2) ... Setting up groff-base (1.23.0-7) ... Setting up libmro-compat-perl (0.15-2) ... Setting up libsub-exporter-perl (0.990-1) ... Setting up libeval-closure-perl (0.14-3) ... Setting up libgnutls30t64:i386 (3.8.9-2) ... Setting up libtest-most-perl (0.38-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libparams-classify-perl:i386 (0.015-2+b4) ... Setting up libpsl5t64:i386 (0.21.2-1.1+b1) ... Setting up man-db (2.13.0-1) ... Not building database; man-db/auto-update is not 'true'. Setting up libmodule-runtime-perl (0.016-2) ... Setting up librtmp1:i386 (2.4+20151223.gitfa8646d.1-2+b5) ... Setting up libdist-checkconflicts-perl (0.11-2) ... Setting up libconst-fast-perl (0.014-2) ... Setting up libngtcp2-crypto-gnutls8:i386 (1.9.1-1) ... Setting up libmodule-implementation-perl (0.09-2) ... Setting up libpackage-stash-perl (0.40-1) ... Setting up libcurl3t64-gnutls:i386 (8.12.1-2) ... Setting up debhelper (13.24.1) ... Setting up libmodule-runtime-conflicts-perl (0.003-2) ... Setting up libtest-files-perl (0.26-1) ... Setting up libclass-load-perl (0.25-2) ... Setting up libpackage-deprecationmanager-perl (0.18-1) ... Setting up libhts3t64:i386 (1.21+ds-1) ... Setting up libdevel-overloadinfo-perl (0.007-1) ... Setting up libclass-load-xs-perl (0.10-2+b4) ... Setting up libmoose-perl:i386 (2.2207-1+b3) ... Setting up samtools (1.21-1) ... Processing triggers for libc-bin (2.40-7) ... Reading package lists... Building dependency tree... Reading state information... Reading extended state information... Initializing package states... Writing extended state information... Building tag database... -> Finished parsing the build-deps I: Building the package I: Running cd /build/reproducible-path/bio-tradis-1.4.5+dfsg2/ && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-buildpackage -us -uc -b && env PATH="/usr/sbin:/usr/bin:/sbin:/bin:/usr/games" HOME="/nonexistent/first-build" dpkg-genchanges -S > ../bio-tradis_1.4.5+dfsg2-2_source.changes dpkg-buildpackage: info: source package bio-tradis dpkg-buildpackage: info: source version 1.4.5+dfsg2-2 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-source --before-build . dpkg-buildpackage: info: host architecture i386 debian/rules clean dh clean dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf dh_auto_configure /usr/bin/perl Makefile.PL INSTALLDIRS=vendor "OPTIMIZE=-g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bio-tradis-1.4.5+dfsg2=. -fstack-protector-strong -Wformat -Werror=format-security -Wdate-time -D_FORTIFY_SOURCE=2" "LD=i686-linux-gnu-gcc -g -O2 -Werror=implicit-function-declaration -ffile-prefix-map=/build/reproducible-path/bio-tradis-1.4.5+dfsg2=. -fstack-protector-strong -Wformat -Werror=format-security -Wl,-z,relro" Checking if your kit is complete... Warning: the following files are missing in your kit: BioTraDISTutorial.pdf Please inform the author. Generating a Unix-style Makefile Writing Makefile for Bio::Tradis Writing MYMETA.yml and MYMETA.json dh_auto_build make -j22 make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' cp lib/Bio/Tradis/CombinePlots.pm blib/lib/Bio/Tradis/CombinePlots.pm cp lib/Bio/Tradis/Map.pm blib/lib/Bio/Tradis/Map.pm cp lib/Bio/Tradis/RemoveTags.pm blib/lib/Bio/Tradis/RemoveTags.pm cp lib/Bio/Tradis/Analysis/InsertSite.pm blib/lib/Bio/Tradis/Analysis/InsertSite.pm cp lib/Bio/Tradis/CommandLine/RemoveFastqTags.pm blib/lib/Bio/Tradis/CommandLine/RemoveFastqTags.pm cp lib/Bio/Tradis/Analysis/Exceptions.pm blib/lib/Bio/Tradis/Analysis/Exceptions.pm cp lib/Bio/Tradis/TradisPlot.pm blib/lib/Bio/Tradis/TradisPlot.pm cp lib/Bio/Tradis/Exception.pm blib/lib/Bio/Tradis/Exception.pm cp lib/Bio/Tradis/FilterTags.pm blib/lib/Bio/Tradis/FilterTags.pm cp lib/Bio/Tradis/RunTradis.pm blib/lib/Bio/Tradis/RunTradis.pm cp lib/Bio/Tradis/CommandLine/PlotCombine.pm blib/lib/Bio/Tradis/CommandLine/PlotCombine.pm cp lib/Bio/Tradis/CommandLine/TradisAnalysis.pm blib/lib/Bio/Tradis/CommandLine/TradisAnalysis.pm cp lib/Bio/Tradis/CommandLine/RunMapping.pm blib/lib/Bio/Tradis/CommandLine/RunMapping.pm cp lib/Bio/Tradis/CommandLine/CheckTags.pm blib/lib/Bio/Tradis/CommandLine/CheckTags.pm cp lib/Bio/Tradis/CommandLine/TradisBam.pm blib/lib/Bio/Tradis/CommandLine/TradisBam.pm cp lib/Bio/Tradis/CommandLine/FilterFastqTags.pm blib/lib/Bio/Tradis/CommandLine/FilterFastqTags.pm cp lib/Bio/Tradis/CommandLine/PlotTradis.pm blib/lib/Bio/Tradis/CommandLine/PlotTradis.pm cp lib/Bio/Tradis/Parser/Cigar.pm blib/lib/Bio/Tradis/Parser/Cigar.pm cp lib/Bio/Tradis/Parser/Bam.pm blib/lib/Bio/Tradis/Parser/Bam.pm cp lib/Bio/Tradis/AddTagsToSeq.pm blib/lib/Bio/Tradis/AddTagsToSeq.pm cp lib/Bio/Tradis.pm blib/lib/Bio/Tradis.pm cp lib/Bio/Tradis/CommandLine/AddTags.pm blib/lib/Bio/Tradis/CommandLine/AddTags.pm cp lib/Bio/Tradis/Parser/Fastq.pm blib/lib/Bio/Tradis/Parser/Fastq.pm cp lib/Bio/Tradis/DetectTags.pm blib/lib/Bio/Tradis/DetectTags.pm cp lib/Bio/Tradis/Samtools.pm blib/lib/Bio/Tradis/Samtools.pm cp bin/add_tradis_tags blib/script/add_tradis_tags cp bin/bacteria_tradis blib/script/bacteria_tradis cp bin/check_tradis_tags blib/script/check_tradis_tags cp bin/combine_tradis_plots blib/script/combine_tradis_plots "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/add_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/bacteria_tradis cp bin/filter_tradis_tags blib/script/filter_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/check_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/combine_tradis_plots cp bin/remove_tradis_tags blib/script/remove_tradis_tags "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/filter_tradis_tags cp bin/tradis_comparison.R blib/script/tradis_comparison.R "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/remove_tradis_tags cp bin/tradis_essentiality.R blib/script/tradis_essentiality.R cp bin/tradis_gene_insert_sites blib/script/tradis_gene_insert_sites "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_comparison.R cp bin/tradis_merge_plots blib/script/tradis_merge_plots cp bin/tradis_plot blib/script/tradis_plot "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_essentiality.R "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_gene_insert_sites "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_merge_plots "/usr/bin/perl" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/tradis_plot Manifying 9 pod documents Manifying 25 pod documents make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' debian/rules override_dh_auto_test make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_auto_test || true make -j22 test TEST_VERBOSE=1 make[2]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' PERL_DL_NONLAZY=1 "/usr/bin/perl" "-MExtUtils::Command::MM" "-MTest::Harness" "-e" "undef *Test::Harness::Switches; test_harness(1, 'blib/lib', 'blib/arch')" t/*.t t/Bio/Tradis/*.t t/Bio/Tradis/Analysis/*.t t/Bio/Tradis/CommandLine/*.t t/Bio/Tradis/Parser/*.t # # Versions for all modules listed in MYMETA.json (including optional ones): # # === Configure Requires === # # Module Want Have # ------------------- ---- ---- # ExtUtils::MakeMaker any 7.70 # # === Build Requires === # # Module Want Have # ------------------- ---- ---- # ExtUtils::MakeMaker any 7.70 # # === Test Requires === # # Module Want Have # ------------------- ---- -------- # Env::Path 0.18 0.19 # ExtUtils::MakeMaker any 7.70 # File::Spec any 3.91 # Test::Exception any 0.43 # Test::Files any 0.26 # Test::More any 1.302199 # Test::Most any 0.38 # # === Test Recommends === # # Module Want Have # ---------- -------- -------- # CPAN::Meta 2.120900 2.150010 # # === Runtime Requires === # # Module Want Have # ---------------- ---- ------ # Bio::Seq any 1.7.8 # Bio::SeqIO any 1.7.8 # Cwd any 3.91 # Data::Dumper any 2.189 # Exception::Class any 1.45 # File::Basename any 2.86 # File::Path any 2.18 # File::Spec any 3.91 # File::Temp any 0.2311 # FindBin any 1.54 # Getopt::Long any 2.57 # Moose any 2.2207 # Text::CSV any 2.05 # Try::Tiny any 0.32 # strict any 1.13 # warnings any 1.70 # t/00-report-prereqs.t ...................... 1..1 ok 1 ok # Failed test 'checking file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- t/data/output.sam # +++ t/data/AddTags/expected_tradis.sam # @@ -15,9 +15,7 @@ # @PG ID:picard_markduplicates PN:Picard PP:samtools_sort VN:1.72(1230) CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR' # @PG ID:ChangeBamHeader PN:ChangeBamHeader PP:picard_markduplicates DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. VN:V1.10 CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0 QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false # @PG ID:BamTagStripper PN:BamTagStripper PP:ChangeBamHeader DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip VN:V1.10 CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 # -@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.21 CL:samtools view -H t/data/AddTags/sample_sm_tr.bam # -@PG ID:samtools.1 PN:samtools PP:samtools VN:1.21 CL:samtools view -h -S -b -o t/data/output.bam tmp.20260402040640.sam # -@PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.21 CL:samtools view -h -o t/data/output.sam t/data/output.bam # +@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.21 CL:samtools view -h -o t/data/AddTags/expected_tradis.sam t/data/AddTags/expected_tradis.bam # MS5_9521:1:1101:10072:14269#14 16 ENA|AE004091|AE004091.2 5 37 60M * 0 0 AAGAGACCGGCGATTCTAGTGAAATCGAACGGGCAGGTCAATTTCCAACCCTGACTCTTA HHHGGGGGGGHHHHHHHHHHHGHHHGHHGGGGGGGGGGFFFBFFCBAABAFFFFFBBCCC X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:BBCDECBC XT:A:U tq:Z:CCCBBFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:1103:26809:18585#14 1040 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA 5FGGHHGEGHFEHHHHHGFHHGHGGHGFGGFCGEGBBAFC?DFFFBBBB3FFFFFCCCCB X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:CCCCCCCC XT:A:U tq:Z:BCCCCFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:2101:3627:15042#14 16 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA HHHGHHHGHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGFFCFFFFBBBAAFFFFFCBAAA X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:AAA>AAAA XT:A:U tq:Z:AAABCFFFFF tr:Z:TAAGAGTCAG # Failed test 'checking file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- t/data/AddTags/sample_sm_no_tr.sam # +++ t/data/output.sam # @@ -15,7 +15,9 @@ # @PG ID:picard_markduplicates PN:Picard PP:samtools_sort VN:1.72(1230) CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR' # @PG ID:ChangeBamHeader PN:ChangeBamHeader PP:picard_markduplicates DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. VN:V1.10 CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0 QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false # @PG ID:BamTagStripper PN:BamTagStripper PP:ChangeBamHeader DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip VN:V1.10 CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 # -@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.21 CL:samtools view -h -o t/data/AddTags/sample_sm_no_tr.sam t/data/AddTags/sample_sm_no_tr.bam # +@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.21 CL:samtools view -H t/data/AddTags/sample_sm_tr.bam # +@PG ID:samtools.1 PN:samtools PP:samtools VN:1.21 CL:samtools view -h -S -b -o t/data/output.bam tmp.20260402040640.sam # +@PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.21 CL:samtools view -h -o t/data/output.sam t/data/output.bam # MS5_9521:1:1101:10072:14269#14 16 ENA|AE004091|AE004091.2 5 37 60M * 0 0 AAGAGACCGGCGATTCTAGTGAAATCGAACGGGCAGGTCAATTTCCAACCCTGACTCTTA HHHGGGGGGGHHHHHHHHHHHGHHHGHHGGGGGGGGGGFFFBFFCBAABAFFFFFBBCCC X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:BBCDECBC XT:A:U tq:Z:CCCBBFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:1103:26809:18585#14 1040 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA 5FGGHHGEGHFEHHHHHGFHHGHGGHGFGGFCGEGBBAFC?DFFFBBBB3FFFFFCCCCB X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:CCCCCCCC XT:A:U tq:Z:BCCCCFFFFF tr:Z:TAAGAGTCAG # MS5_9521:1:2101:3627:15042#14 16 ENA|AE004091|AE004091.2 23 37 60M * 0 0 GTGAAATCGAACGGGCAGGTCAATTTCCAACCAGCGATGACGTAATAGATCTGACTCTTA HHHGHHHGHHGGHHHHHHHHHHHHHHGGGGGGGGGGGGFFCFFFFBBBAAFFFFFCBAAA X0:i:1 X1:i:0 BC:Z:TCTCGGTT MD:Z:50 RG:Z:1#14 XG:i:0 NM:i:0 XM:i:0 XO:i:0 QT:Z:AAA>AAAA XT:A:U tq:Z:AAABCFFFFF tr:Z:TAAGAGTCAG [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required [E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory [E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta' [W::cram_get_ref] Failed to populate reference for id 0 [E::cram_decode_slice] Unable to fetch reference #0:5-193 [E::cram_next_slice] Failure to decode slice samtools view: error reading file "t/data/AddTags/sample_sm_tr.cram": No such file or directory [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required [E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory [E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta' [W::cram_get_ref] Failed to populate reference for id 0 [E::cram_decode_slice] Unable to fetch reference #0:5-193 [E::cram_next_slice] Failure to decode slice samtools view: error reading file "t/data/AddTags/sample_sm_tr.cram": No such file or directory [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required [E::fai_build3_core] Failed to open the file /nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta : No such file or directory [E::refs_load_fai] Failed to open reference file '/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta' [W::cram_get_ref] Failed to populate reference for id 0 [E::cram_decode_slice] Unable to fetch reference #0:5-203 [E::cram_next_slice] Failure to decode slice samtools view: error reading file "t/data/AddTags/expected_tradis.cram": No such file or directory # Failed test 'checking file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- t/data/output.sam # +++ t/data/AddTags/expected_tradis.sam # @@ -1,4 +1,6 @@ # @HD VN:1.4 SO:coordinate # +@RG ID:1#14 PL:ILLUMINA PU:130320_MS5_9521_A_MS0205701-050V2_1#14 LB:6982965 DS:ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ DT:2013-03-20T00:00:00+0000 SM:ERS222909 CN:SC # +@SQ SN:ENA|AE004091|AE004091.2 LN:6264404 UR:file:/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta AS:PAO1 M5:7f8b730b8a08ebf1eeb7f0de561f0a91 SP:Pseudomonas aeruginosa # @PG ID:SCS PN:MiSeq Control Software DS:Controlling software on instrument VN:2.2.0 # @PG ID:basecalling PN:RTA PP:SCS DS:Basecalling Package VN:1.17.28.0 # @PG ID:Illumina2bam PN:Illumina2bam PP:basecalling DS:Convert Illumina BCL to BAM or SAM file VN:V1.10 CL:uk.ac.sanger.npg.illumina.Illumina2bam INTENSITY_DIR=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities BASECALLS_DIR=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BaseCalls LANE=1 OUTPUT=/dev/stdout SAMPLE_ALIAS=ERS222824,ERS222825,ERS222825,ERS222824,ERS222909,ERS222910 LIBRARY_NAME=6983166 STUDY_NAME=ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ BARCODE_SEQUENCE_TAG_NAME=tr BARCODE_QUALITY_TAG_NAME=tq SECOND_BARCODE_SEQUENCE_TAG_NAME=BC SECOND_BARCODE_QUALITY_TAG_NAME=QT COMPRESSION_LEVEL=0 CREATE_MD5_FILE=true GENERATE_SECONDARY_BASE_CALLS=false PF_FILTER=true READ_GROUP_ID=1 SEQUENCING_CENTER=SC PLATFORM=ILLUMINA VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false # @@ -13,8 +15,4 @@ # @PG ID:picard_markduplicates PN:Picard PP:samtools_sort VN:1.72(1230) CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR' # @PG ID:ChangeBamHeader PN:ChangeBamHeader PP:picard_markduplicates DS:Add extra PGs into bam header, or change SM, LB or DS tag in RG line in header and this only works with one read group in the input bam. VN:V1.10 CL:uk.ac.sanger.npg.picard.ChangeBamHeader INPUT=/dev/stdin OUTPUT=/dev/stdout PG=[ID:samtools_sort;PN:samtools;VN:0.1.18 (r982:295);CL:/software/solexa/bin/aligners/samtools/samtools-0.1.18/samtools sort /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14.bam /nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted, ID:picard_markduplicates;PN:Picard;VN:1.72(1230);CL:/software/java/bin/java -Xmx6000m -jar /software/solexa/bin/aligners/picard/picard-tools-1.72/MarkDuplicates.jar INPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb/sorted.bam OUTPUT=/dev/stdout METRICS_FILE=/tmp/kShEyfoGW1 ASSUME_SORTED='true' COMPRESSION_LEVEL='0' MAX_FILE_HANDLES_FOR_READ_ENDS_MAP='900' READ_NAME_REGEX='[a-zA-Z0-9_]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*' REMOVE_DUPLICATES='false' VALIDATION_STRINGENCY='SILENT' VERBOSITY='ERROR'] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT COMPRESSION_LEVEL=0 QUIET=false MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false # @PG ID:BamTagStripper PN:BamTagStripper PP:ChangeBamHeader DS:Strip a list of tags in bam/sam record. By default, any tags containing lowercase letters will be stripped and other tags will be kept. A list of tags can be given to keep or strip VN:V1.10 CL:uk.ac.sanger.npg.picard.BamTagStripper INPUT=/dev/stdin OUTPUT=/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/9521_1#14_mk.bam TAG_TO_KEEP=[a3, ah, br, qr, tq, tr] TAG_TO_STRIP=[OQ] TMP_DIR=[/nfs/sf49/ILorHSorMS_sf49/analysis/130320_MS5_9521_A_MS0205701-050V2/Data/Intensities/BAM_basecalls_20130321-070041/no_cal/archive/lane1/E2jaMSXizb] VERBOSITY=INFO VALIDATION_STRINGENCY=SILENT CREATE_INDEX=true CREATE_MD5_FILE=true QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 # -@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.21 CL:samtools view -H t/data/AddTags/sample_sm_tr.cram # +@PG ID:samtools PN:samtools PP:BamTagStripper VN:1.21 CL:samtools view -h -o t/data/AddTags/expected_tradis.sam t/data/AddTags/expected_tradis.cram # -@PG ID:samtools.1 PN:samtools PP:samtools VN:1.21 CL:samtools view -h -S -C -o t/data/output.cram tmp.20260402040640.sam # -@PG ID:samtools.2 PN:samtools PP:samtools.1 VN:1.21 CL:samtools view -h -o t/data/output.sam t/data/output.cram # -@SQ SN:ENA|AE004091|AE004091.2 LN:6264404 UR:file:/nfs/srpipe_references/references/Pseudomonas_aeruginosa/PAO1/all/fasta/AE004091.fasta AS:PAO1 M5:7f8b730b8a08ebf1eeb7f0de561f0a91 SP:Pseudomonas aeruginosa # -@RG ID:1#14 PL:ILLUMINA PU:130320_MS5_9521_A_MS0205701-050V2_1#14 LB:6982965 DS:ERP002335: http://www.sanger.ac.uk/resources/downloads/bacteria/citrobacter-rodentium.html This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ DT:2013-03-20T00:00:00+0000 SM:ERS222909 CN:SC # Looks like you failed 3 tests of 15. t/Bio/Tradis/AddTagsToSeq.t ................ ok 1 - use Bio::Tradis::AddTagsToSeq; ok 2 - creating object ok 3 - correctly select the bam output switch ok 4 - testing output ok 5 - checking file existence not ok 6 - checking file contents ok 7 - creating object ok 8 - checking file existence not ok 9 - checking file contents ok 10 - number of reads as expected ok 11 - creating object with cram file ok 12 - correctly select the cram output switch ok 13 - testing output ok 14 - checking file existence not ok 15 - checking file contents 1..15 Dubious, test returned 3 (wstat 768, 0x300) Failed 3/15 subtests t/Bio/Tradis/Analysis/InsertSite.t ......... ok 1 - use Bio::Tradis::Analysis::InsertSite; ok 2 ok 3 ok 4 - check main sequence insert_site values first value ok 5 - check main sequence insert_site value before site ok 6 - check main sequence insert_site values for reverse reads only ok 7 - various values ok 8 - various values ok 9 - various values ok 10 - various values ok 11 - various values ok 12 - check empty plasmid insert_site values first value ok 13 - check empty plasmid insert_site values last value ok 14 - check plasmid with 1 read insert_site values first value ok 15 - check plasmid with 1 read insert_site values first base of read ok 16 - check plasmid with 1 read insert_site values after last base of read ok 17 - check plasmid with 1 read insert_site values last value ok 18 - check another empty plasmid insert_site values first value ok 19 - check another empty plasmid insert_site values last value ok 20 ok 21 ok 22 - check forward read ok 23 - check reverse read 1..23 ok [W::tbx_parse1] Coordinate <= 0 detected. Did you forget to use the -0 option? [W::tbx_parse1] Coordinate <= 0 detected. Did you forget to use the -0 option? [tabix] the index file exists. Please use '-f' to overwrite. t/Bio/Tradis/CombinePlots.t ................ ok 1 - use Bio::Tradis::CombinePlots; ok 2 - creating object ok 3 - combining plots ok 4 - checking first combined plot file exists ok 5 - checking second combined plot file exists ok 6 - checking stats file exists ok 7 - checking first file contents ok 8 - checking second file contents ok 9 - checking stats file contents ok 10 - creating object ok 11 - combining plots ok 12 - checking first combined plot file exists ok 13 - checking tabix sorted combined plot file exists ok 14 - checking tabix index file exists ok 15 - checking zipped file contents ok 16 - checking stats file contents ok 17 - creating object ok 18 - combining plots ok 19 - checking directory exists ok 20 - checking first combined plot file exists ok 21 - checking second combined plot file exists 1..21 ok Attribute (_stats_handle) does not pass the type constraint because: Validation failed for 'FileHandle' with value GLOB(0x5866d878) at reader Bio::Tradis::CommandLine::TradisAnalysis::_stats_handle (defined at lib/Bio/Tradis/CommandLine/TradisAnalysis.pm line 43) line 15 Bio::Tradis::CommandLine::TradisAnalysis::_stats_handle('Bio::Tradis::CommandLine::TradisAnalysis=HASH(0x57616464)') called at lib/Bio/Tradis/CommandLine/TradisAnalysis.pm line 146 Bio::Tradis::CommandLine::TradisAnalysis::run('Bio::Tradis::CommandLine::TradisAnalysis=HASH(0x57616464)') called at t/Bio/Tradis/CommandLine/TradisAnalysis.t line 33 # Tests were run but no plan was declared and done_testing() was not seen. # Looks like your test exited with 255 just after 2. t/Bio/Tradis/CommandLine/TradisAnalysis.t .. ok 1 - use Bio::Tradis::CommandLine::TradisAnalysis; ok 2 - creating object Dubious, test returned 255 (wstat 65280, 0xff00) All 2 subtests passed Attempt to call undefined import method with arguments ("") via package "Bio::Tradis::Parser::Bam" (Perhaps you forgot to load the package?) at lib/Bio/Tradis/DetectTags.pm line 9. [W::find_file_url] Failed to open reference "https://www.ebi.ac.uk/ena/cram/md5/7f8b730b8a08ebf1eeb7f0de561f0a91": Destination address required t/Bio/Tradis/DetectTags.t .................. ok 1 - use Bio::Tradis::DetectTags; ok 2 - testing tag checker - tradis ok 3 - testing output ok 4 - testing tag checker for cram- tradis ok 5 - testing output cram ok 6 - testing tag checker - no tradis ok 7 - testing output 1..7 ok t/Bio/Tradis/FilterTags.t .................. ok 1 - use Bio::Tradis::FilterTags; ok 2 - creating object ok 3 - testing output ok 4 - checking file existence ok 5 - checking file contents ok 6 - creating object ok 7 - testing output ok 8 - checking file existence ok 9 - checking file contents ok 10 - creating object ok 11 - testing output ok 12 - checking file existence ok 13 - checking file contents ok 14 - creating object ok 15 - testing output ok 16 - checking file existence ok 17 - checking file contents 1..17 ok t/Bio/Tradis/Map.t ......................... ok 1 - use Bio::Tradis::Map; ok 2 - creating object ok 3 - testing reference indexing ok 4 - checking index file existence ok 5 - checking index file existence ok 6 - testing smalt mapping ok 7 - checking index file existence ok 8 - checking file contents ok 9 - creating object ok 10 - testing reference indexing ok 11 - checking index file existence ok 12 - checking index file existence ok 13 - checking index file existence ok 14 - checking index file existence ok 15 - checking index file existence ok 16 - testing bwa mapping ok 17 - checking index file existence ok 18 - checking file contents ok 19 - creating object ok 20 - indexing args correct ok 21 - mapping args correct 1..21 ok t/Bio/Tradis/Parser/Bam.t .................. ok 1 - use Bio::Tradis::Parser::Bam; ok 2 - creating object ok 3 - An object of class 'Bio::Tradis::Parser::Bam' isa 'Bio::Tradis::Parser::Bam' ok 4 - seq_info returns a hash ok 5 - first result detected ok 6 - read_info contains correct info for first line ok 7 - testing flag parsing - mapped ok 8 - testing flag parsing - reverse complement ok 9 - last result detected ok 10 - read_info contains correct info for last line ok 11 - EOF detected 1..11 ok t/Bio/Tradis/Parser/Cigar.t ................ ok 1 - use Bio::Tradis::Parser::Cigar; ok 2 - initialise obj -all matching ok 3 - read start -all matching ok 4 - read end -all matching ok 5 - initialise obj -nothing matching ok 6 - read start -nothing matching ok 7 - read end -nothing matching ok 8 - initialise obj -soft clipping at start ok 9 - read start -soft clipping at start ok 10 - read end -soft clipping at start ok 11 - initialise obj -soft clipping at end ok 12 - read start -soft clipping at end ok 13 - read end -soft clipping at end ok 14 - initialise obj -soft clipping at both ends ok 15 - read start -soft clipping at both ends ok 16 - read end -soft clipping at both ends ok 17 - initialise obj -deletion in middle ok 18 - read start -deletion in middle ok 19 - read end -deletion in middle ok 20 - initialise obj -insertions and deletions ok 21 - read start -insertions and deletions ok 22 - read end -insertions and deletions ok 23 - initialise obj -insertions in the middle ok 24 - read start -insertions in the middle ok 25 - read end -insertions in the middle 1..25 ok t/Bio/Tradis/Parser/Fastq.t ................ ok 1 - use Bio::Tradis::Parser::Fastq; ok 2 - creating object ok 3 - An object of class 'Bio::Tradis::Parser::Fastq' isa 'Bio::Tradis::Parser::Fastq' ok 4 - first result detected ok 5 - read_info contains correct info for first line ok 6 - last result detected ok 7 - read_info contains correct info for last line ok 8 - EOF detected 1..8 ok t/Bio/Tradis/RemoveTags.t .................. ok 1 - use Bio::Tradis::RemoveTags; ok 2 - creating object ok 3 - testing output ok 4 - checking file existence ok 5 - checking file contents ok 6 - creating object ok 7 - testing output ok 8 - checking file existence ok 9 - checking file contents ok 10 - creating object ok 11 - testing output ok 12 - checking file existence ok 13 - checking file contents 1..13 ok # Failed test 'checking mapped file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- /build/reproducible-path/bio-tradis-1.4.5+dfsg2/tmp_run_tradis_tests_Nocl1/tmp1.sam # +++ /build/reproducible-path/bio-tradis-1.4.5+dfsg2/tmp_run_tradis_tests_Nocl1/tmp2.sam # @@ -1,5 +1,4 @@ # @SQ SN:AE004091 LN:9840 # -@HD VN:1.5 SO:unsorted GO:query # HS21_09876:1:1105:9650:48712#83 0 AE004091 6697 60 44M * 0 0 GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF NM:i:1 MD:Z:0A43 AS:i:43 XS:i:0 # HS21_09876:1:1106:8638:38957#83 0 AE004091 6697 60 44M * 0 0 GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD NM:i:1 MD:Z:0A43 AS:i:43 XS:i:0 # HS21_09876:1:1204:19746:42237#83 0 AE004091 6697 60 44M * 0 0 GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF NM:i:1 MD:Z:0A43 AS:i:43 XS:i:0 # Looks like you failed 1 test of 45. t/Bio/Tradis/RunTradisBWA.t ................ ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing filtering step ok 4 - checking filtered file existence - Normal files, no mismatch ok 5 - checking filtered file contents - Normal files, no mismatch ok 6 - testing check filtering step ok 7 - complain if no filtered reads ok 8 - complain if filtered reads are empty ok 9 - complain if filtered reads has less than 4 lines ok 10 - complain if filtered reads do not look like a fastq ok 11 - complain if filtered reads are too short ok 12 - check very basic filtered reads validation ok 13 - testing tag removal ok 14 - checking de-tagged file existence - Normal files, no mismatch ok 15 - checking de-tagged file contents - Normal files, no mismatch ok 16 - testing mapping ok 17 - checking SAM existence not ok 18 - checking mapped file contents ok 19 - testing SAM/BAM conversion ok 20 - checking BAM existence ok 21 - testing BAM sorting ok 22 - checking sorted BAM existence - Normal files, no mismatch ok 23 - checking indexed BAM existence - Normal files, no mismatch ok 24 - testing bamcheck ok 25 - checking bamcheck file existence - Normal files, no mismatch ok 26 - testing plotting ok 27 - checking plot file existence - Normal files, no mismatch ok 28 - checking plot file contents - Normal files, no mismatch ok 29 - testing complete analysis - Normal files, no mismatch ok 30 - checking plot file existence - Normal files, no mismatch ok 31 - checking completed pipeline file contents - Normal files, no mismatch ok 32 - creating object - Normal files one mismatch ok 33 - testing complete analysis with mismatch ok 34 - checking plot file existence - Normal files one mismatch ok 35 - checking completed pipeline with mismatch file contents - Normal files one mismatch ok 36 - creating object with gzipped data - Normal files one mismatch ok 37 - testing complete analysis with gzipped data ok 38 - checking plot file existence (gzipped data) - Normal files one mismatch ok 39 - checking mapped bam existence - Normal files one mismatch ok 40 - checking indexed bam file - Normal files one mismatch ok 41 - checking completed pipeline with gzipped data file contents - Normal files one mismatch ok 42 - creating object with custom smalt parameters ok 43 - mapping with custom parameters fine ok 44 - creating object ok 45 - correct error thrown 1..45 Dubious, test returned 1 (wstat 256, 0x100) Failed 1/45 subtests t/Bio/Tradis/RunTradisSmalt.t .............. ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing filtering step ok 4 - checking filtered file existence - Normal files, no mismatch ok 5 - checking filtered file contents - Normal files, no mismatch ok 6 - testing check filtering step ok 7 - complain if no filtered reads ok 8 - complain if filtered reads are empty ok 9 - complain if filtered reads has less than 4 lines ok 10 - complain if filtered reads do not look like a fastq ok 11 - complain if filtered reads are too short ok 12 - check very basic filtered reads validation ok 13 - testing tag removal ok 14 - checking de-tagged file existence - Normal files, no mismatch ok 15 - checking de-tagged file contents - Normal files, no mismatch ok 16 - testing mapping ok 17 - checking SAM existence ok 18 - checking mapped file contents ok 19 - testing SAM/BAM conversion ok 20 - checking BAM existence ok 21 - testing BAM sorting ok 22 - checking sorted BAM existence - Normal files, no mismatch ok 23 - checking indexed BAM existence - Normal files, no mismatch ok 24 - testing bamcheck ok 25 - checking bamcheck file existence - Normal files, no mismatch ok 26 - testing plotting ok 27 - checking plot file existence - Normal files, no mismatch ok 28 - checking plot file contents - Normal files, no mismatch ok 29 - testing complete analysis - Normal files, no mismatch ok 30 - checking plot file existence - Normal files, no mismatch ok 31 - checking completed pipeline file contents - Normal files, no mismatch ok 32 - creating object - Normal files one mismatch ok 33 - testing complete analysis with mismatch ok 34 - checking plot file existence - Normal files one mismatch ok 35 - checking completed pipeline with mismatch file contents - Normal files one mismatch ok 36 - creating object with gzipped data - Normal files one mismatch ok 37 - testing complete analysis with gzipped data ok 38 - checking plot file existence (gzipped data) - Normal files one mismatch ok 39 - checking mapped bam existence - Normal files one mismatch ok 40 - checking indexed bam file - Normal files one mismatch ok 41 - checking completed pipeline with gzipped data file contents - Normal files one mismatch ok 42 - creating object with custom smalt parameters ok 43 - mapping with custom parameters fine ok 44 - creating object with custom smalt parameters ok 45 - correct error thrown 1..45 ok # Failed test 'checking mapped file contents' # at /usr/share/perl5/Test/Files.pm line 376. # --- /build/reproducible-path/bio-tradis-1.4.5+dfsg2/tmp_run_tradis_tagless_tests_fnPjH/tmp1.sam # +++ /build/reproducible-path/bio-tradis-1.4.5+dfsg2/tmp_run_tradis_tagless_tests_fnPjH/tmp2.sam # @@ -1,5 +1,4 @@ # @SQ SN:AE004091 LN:9840 # -@HD VN:1.5 SO:unsorted GO:query # HS21_09876:1:1105:9650:48712#83 0 AE004091 6697 60 44M * 0 0 GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG HHCEE8EEFGFFGFIFGGFGEEHFFFGGGFGFGEGEEEFGFGFF NM:i:1 MD:Z:0A43 AS:i:43 XS:i:0 # HS21_09876:1:1106:8638:38957#83 0 AE004091 6697 60 44M * 0 0 GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG HHCEF7FHFFFFGFEGEFFEHEGEGFGGGEGFGFGGFEHGFEFD NM:i:1 MD:Z:0A43 AS:i:43 XS:i:0 # HS21_09876:1:1204:19746:42237#83 0 AE004091 6697 60 44M * 0 0 GGGTCGGCAGACCGACCCTCATGGAAACCCCGGCCTGGCGCCGG HHCBF2GGFFEFGEEFFFEEHEEHFFFFGFGFFFGGGGHGFEFF NM:i:1 MD:Z:0A43 AS:i:43 XS:i:0 # Looks like you failed 1 test of 22. t/Bio/Tradis/RunTradisTaglessBwa.t ......... ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing mapping ok 4 - checking SAM existence not ok 5 - checking mapped file contents ok 6 - testing SAM/BAM conversion ok 7 - checking BAM existence ok 8 - testing BAM sorting ok 9 - checking sorted BAM existence - Normal files, no mismatch ok 10 - checking indexed BAM existence - Normal files, no mismatch ok 11 - testing bamcheck ok 12 - checking bamcheck file existence - Normal files, no mismatch ok 13 - testing plotting ok 14 - checking plot file existence - Normal files, no mismatch ok 15 - checking plot file contents - Normal files, no mismatch ok 16 - testing complete analysis - Normal files, no mismatch ok 17 - checking plot file existence - Normal files, no mismatch ok 18 - checking completed pipeline file contents - Normal files, no mismatch ok 19 - creating object with custom smalt parameters ok 20 - mapping with custom parameters fine ok 21 - creating object ok 22 - correct error thrown 1..22 Dubious, test returned 1 (wstat 256, 0x100) Failed 1/22 subtests t/Bio/Tradis/RunTradisTaglessSmalt.t ....... ok 1 - use Bio::Tradis::RunTradis; ok 2 - creating object - Normal files, no mismatch ok 3 - testing mapping ok 4 - checking SAM existence ok 5 - checking mapped file contents ok 6 - testing SAM/BAM conversion ok 7 - checking BAM existence ok 8 - testing BAM sorting ok 9 - checking sorted BAM existence - Normal files, no mismatch ok 10 - checking indexed BAM existence - Normal files, no mismatch ok 11 - testing bamcheck ok 12 - checking bamcheck file existence - Normal files, no mismatch ok 13 - testing plotting ok 14 - checking plot file existence - Normal files, no mismatch ok 15 - checking plot file contents - Normal files, no mismatch ok 16 - testing complete analysis - Normal files, no mismatch ok 17 - checking plot file existence - Normal files, no mismatch ok 18 - checking completed pipeline file contents - Normal files, no mismatch ok 19 - creating object with custom smalt parameters ok 20 - mapping with custom parameters fine ok 21 - creating object with custom smalt parameters ok 22 - correct error thrown 1..22 ok t/Bio/Tradis/TradisPlot.t .................. ok 1 - use Bio::Tradis::TradisPlot; ok 2 - creating object ok 3 - testing plotting ok 4 - checking plot file existence ok 5 - checking file contents 1..5 ok t/requires_external.t ...................... 1..6 ok 1 - awk in PATH ok 2 - samtools in PATH ok 3 - gunzip in PATH ok 4 - gzip in PATH ok 5 - smalt in PATH ok 6 - tabix in PATH ok Test Summary Report ------------------- t/Bio/Tradis/AddTagsToSeq.t (Wstat: 768 (exited 3) Tests: 15 Failed: 3) Failed tests: 6, 9, 15 Non-zero exit status: 3 t/Bio/Tradis/CommandLine/TradisAnalysis.t (Wstat: 65280 (exited 255) Tests: 2 Failed: 0) Non-zero exit status: 255 Parse errors: No plan found in TAP output t/Bio/Tradis/RunTradisBWA.t (Wstat: 256 (exited 1) Tests: 45 Failed: 1) Failed test: 18 Non-zero exit status: 1 t/Bio/Tradis/RunTradisTaglessBwa.t (Wstat: 256 (exited 1) Tests: 22 Failed: 1) Failed test: 5 Non-zero exit status: 1 Files=18, Tests=309, 8 wallclock secs ( 0.06 usr 0.04 sys + 6.20 cusr 0.94 csys = 7.24 CPU) Result: FAIL Failed 4/18 test programs. 5/309 subtests failed. make[2]: *** [Makefile:1077: test_dynamic] Error 255 make[2]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_auto_test: error: make -j22 test TEST_VERBOSE=1 returned exit code 2 make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' create-stamp debian/debhelper-build-stamp dh_prep dh_auto_install --destdir=debian/bio-tradis/ make -j22 install DESTDIR=/build/reproducible-path/bio-tradis-1.4.5\+dfsg2/debian/bio-tradis AM_UPDATE_INFO_DIR=no PREFIX=/usr make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' Manifying 9 pod documents Manifying 25 pod documents Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/TradisPlot.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/AddTagsToSeq.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/FilterTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/RemoveTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/RunTradis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/DetectTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Exception.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Map.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Samtools.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CombinePlots.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Cigar.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Fastq.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Parser/Bam.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Analysis/InsertSite.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/Analysis/Exceptions.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/FilterFastqTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/PlotCombine.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/TradisBam.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/RemoveFastqTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/PlotTradis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/CheckTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/AddTags.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/TradisAnalysis.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/perl5/Bio/Tradis/CommandLine/RunMapping.pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/tradis_gene_insert_sites.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/add_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/tradis_plot.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/bacteria_tradis.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/check_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/remove_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/tradis_merge_plots.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/filter_tradis_tags.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man1/combine_tradis_plots.1p Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CombinePlots.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Analysis::InsertSite.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::CheckTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::TradisPlot.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Cigar.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Exception.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::TradisBam.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::RunTradis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::RemoveTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::TradisAnalysis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::PlotCombine.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Analysis::Exceptions.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::PlotTradis.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::RemoveFastqTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::AddTagsToSeq.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Map.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::RunMapping.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::FilterFastqTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::FilterTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Fastq.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::DetectTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Parser::Bam.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::Samtools.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/share/man/man3/Bio::Tradis::CommandLine::AddTags.3pm Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_plot Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/filter_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/check_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/bacteria_tradis Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/combine_tradis_plots Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_essentiality.R Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/add_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/remove_tradis_tags Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_comparison.R Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_gene_insert_sites Installing /build/reproducible-path/bio-tradis-1.4.5+dfsg2/debian/bio-tradis/usr/bin/tradis_merge_plots make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' debian/rules override_dh_install make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_install for pl in `grep -Rl '#!/usr/bin/env[[:space:]]\+perl' debian/*/usr/*` ; do \ sed -i '1s?^#!/usr/bin/env[[:space:]]\+perl?#!/usr/bin/perl?' ${pl} ; \ done mv debian/bio-tradis/usr/bin/tradis_comparison.R debian/bio-tradis/usr/bin/tradis_comparison mv debian/bio-tradis/usr/bin/tradis_essentiality.R debian/bio-tradis/usr/bin/tradis_essentiality make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_installdocs dh_installchangelogs debian/rules override_dh_installman make[1]: Entering directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_installman rm debian/bio-tradis/usr/share/man/man1/tradis_merge_plots.1p* make[1]: Leaving directory '/build/reproducible-path/bio-tradis-1.4.5+dfsg2' dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_installdeb dh_gencontrol dh_md5sums dh_builddeb dpkg-deb: building package 'bio-tradis' in '../bio-tradis_1.4.5+dfsg2-2_all.deb'. dpkg-genbuildinfo --build=binary -O../bio-tradis_1.4.5+dfsg2-2_i386.buildinfo dpkg-genchanges --build=binary -O../bio-tradis_1.4.5+dfsg2-2_i386.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) dpkg-genchanges: info: not including original source code in upload I: copying local configuration I: unmounting dev/ptmx filesystem I: unmounting dev/pts filesystem I: unmounting dev/shm filesystem I: unmounting proc filesystem I: unmounting sys filesystem I: cleaning the build env I: removing directory /srv/workspace/pbuilder/120586 and its subdirectories I: Current time: Wed Apr 1 16:06:50 -12 2026 I: pbuilder-time-stamp: 1775102810 Thu Feb 27 21:43:52 UTC 2025 I: 1st build successful. Starting 2nd build on remote node ionos2-i386.debian.net. Thu Feb 27 21:43:52 UTC 2025 I: Preparing to do remote build '2' on ionos2-i386.debian.net. Thu Feb 27 21:45:03 UTC 2025 I: Deleting $TMPDIR on ionos2-i386.debian.net. Thu Feb 27 21:45:03 UTC 2025 I: bio-tradis_1.4.5+dfsg2-2_i386.changes: Format: 1.8 Date: Thu, 25 Jan 2024 15:34:52 +0100 Source: bio-tradis Binary: bio-tradis Architecture: all Version: 1.4.5+dfsg2-2 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team Changed-By: Andreas Tille Description: bio-tradis - analyse the output from TraDIS analyses of genomic sequences Closes: 1043774 Changes: bio-tradis (1.4.5+dfsg2-2) unstable; urgency=medium . * Fix watch file * Fix clean target Closes: #1043774 * Standards-Version: 4.6.2 (routine-update) * debhelper-compat 13 (routine-update) * Add salsa-ci file (routine-update) * Rules-Requires-Root: no (routine-update) * Set upstream metadata fields: Bug-Database, Bug-Submit. * dh_install now works even without debian/install * r-bioc-edger is back in Debian thus move it to Recommends and drop the outdated debian/NEWS * artemis is available now thus move it to Recommends Checksums-Sha1: eee16dc6cea6b4315fa5196f3cd240089f2fb5c6 80036 bio-tradis_1.4.5+dfsg2-2_all.deb 5d379c1ebd7feee7337e7aa67140d11d1d85ada8 7548 bio-tradis_1.4.5+dfsg2-2_i386.buildinfo Checksums-Sha256: aa2ab1a955066605b0bf2a0e9e5ac3337d0f58651b3a679d2c91d77333f19920 80036 bio-tradis_1.4.5+dfsg2-2_all.deb 70bbf4b8d23c64c07c675fa0f1322eacb6c3b3d2c21db9354a3473c73e7a5936 7548 bio-tradis_1.4.5+dfsg2-2_i386.buildinfo Files: 27920a3414115f249f2d9662295dd927 80036 perl optional bio-tradis_1.4.5+dfsg2-2_all.deb c47028f614a39df44474d669435e3443 7548 perl optional bio-tradis_1.4.5+dfsg2-2_i386.buildinfo Thu Feb 27 21:45:04 UTC 2025 I: diffoscope 289 will be used to compare the two builds: Running as unit: rb-diffoscope-i386_4-54360.service # Profiling output for: /usr/bin/diffoscope --timeout 7200 --html /srv/reproducible-results/rbuild-debian/r-b-build.Q4b1tkO4/bio-tradis_1.4.5+dfsg2-2.diffoscope.html --text /srv/reproducible-results/rbuild-debian/r-b-build.Q4b1tkO4/bio-tradis_1.4.5+dfsg2-2.diffoscope.txt --json /srv/reproducible-results/rbuild-debian/r-b-build.Q4b1tkO4/bio-tradis_1.4.5+dfsg2-2.diffoscope.json --profile=- /srv/reproducible-results/rbuild-debian/r-b-build.Q4b1tkO4/b1/bio-tradis_1.4.5+dfsg2-2_i386.changes /srv/reproducible-results/rbuild-debian/r-b-build.Q4b1tkO4/b2/bio-tradis_1.4.5+dfsg2-2_i386.changes ## command (total time: 0.000s) 0.000s 1 call cmp (internal) ## has_same_content_as (total time: 0.000s) 0.000s 1 call diffoscope.comparators.binary.FilesystemFile ## main (total time: 0.003s) 0.003s 2 calls outputs 0.000s 1 call cleanup Finished with result: success Main processes terminated with: code=exited/status=0 Service runtime: 245ms CPU time consumed: 246ms Thu Feb 27 21:45:05 UTC 2025 I: diffoscope 289 found no differences in the changes files, and a .buildinfo file also exists. Thu Feb 27 21:45:05 UTC 2025 I: bio-tradis from trixie built successfully and reproducibly on i386. Thu Feb 27 21:45:06 UTC 2025 I: Submitting .buildinfo files to external archives: Thu Feb 27 21:45:06 UTC 2025 I: Submitting 12K b1/bio-tradis_1.4.5+dfsg2-2_i386.buildinfo.asc Thu Feb 27 21:45:07 UTC 2025 I: Submitting 12K b2/bio-tradis_1.4.5+dfsg2-2_i386.buildinfo.asc Thu Feb 27 21:45:08 UTC 2025 I: Done submitting .buildinfo files to http://buildinfo.debian.net/api/submit. Thu Feb 27 21:45:08 UTC 2025 I: Done submitting .buildinfo files. Thu Feb 27 21:45:08 UTC 2025 I: Removing signed bio-tradis_1.4.5+dfsg2-2_i386.buildinfo.asc files: removed './b1/bio-tradis_1.4.5+dfsg2-2_i386.buildinfo.asc' removed './b2/bio-tradis_1.4.5+dfsg2-2_i386.buildinfo.asc'